DOI: https://doi.org/10.21203/rs.3.rs-2133713/v1
We investigated the effect of Stilbene on inflammation and the underlying mechanisms in spontaneously hypertensive rats (SHRs).
Rats were divided into the control group, the model group, the positive group (4.56 mg/kg/day), Stilbene LD group (40 mg/kg), Stilbene MD group (60 mg/kg), and Stilbene HD group (80 mg/kg). The open field test (OFT) and Morris water maze test (MWM) were used to compare the behavior of the rats among the groups, while real-time polymerase chain reaction (PCR) and western blot were used to compare the expression of cytokines in different brain tissues among the groups.
OFT and MWM revealed that stilbene significantly reduced hyperactivity and impulsivity, and improved spatial memory in spontaneously hypertensive rats. Stilbene reduced DHA levels in striatum and hippocampus, but increased the mRNA expressions of AKT1, BDNF, SOS1, PIK3CG, GAB1, and NTRK2, and the protein levels of SOS1, GAB1, AKT1, TrkB, and Kinase P110 beta in prefrontal, striatum, and hippocampus.
Stilbene reduced neuroinflammation and attenuated symptoms of ADHD in SHRs.
Attention deficit hyperactivity disorder (ADHD) is a neurobehavioral disorder with a prevalence in children of approximately 7.2% globally(Anand et al., 2017). The core symptoms of ADHD are age-appropriate inattention and impulsivity, which may affect social functions across the lifespan of the child(Aparicio et al., 2019). The common symptoms of ADHD in childhood may vary from hyperactivity and impulsivity to inattention, inability to sit still, learning difficulties, all these behavior may result in impaired academic and work performance, economic underachievement and emotional and behavioral management disorders(Archer, 1973). ADHD is a heterogeneous disease with complex pathogenesis, whose cause and pathogenesis has not yet been well elucidated, and lacks neurobiological diagnostic markers(Corona, 2020). Risk factors for ADHD include biological factors such as environmental toxins, illnesses or drugs during pregnancy or perinatal period, alcohol consumption, smoking, and stress, and psychosocial factors such as emotional trauma, and abuse. Dopaminergic, noradrenergic, and serotonergic neurotransmission may all have a role in ADHD, according to studies based on animal models(Darwish et al., 2019).
Recently, there has been a lot of research focusing on the role of inflammatory factors in the pathogenesis of ADHD. Increasing evidence suggests that inflammation, especially the neuro-inflammation, plays a crucial role in neuropsychiatric disorders, with inflammatory disorders being implicated in the pathogenesis of depression, schizophrenia, bipolar disorder, and post-traumatic stress disorders(Dunn et al., 2019). Neuro-inflammation, particularly chronic neuro-inflammation, plays a key role in central nervous system (CNS) disorders, such as stroke, depression, autism spectrum disorders, schizophrenia, and chronic pain, as well as in neuro-immune diseases, neurodegenerative diseases, and other neuropsychiatric disorders. For example, CNS disorders have been associated with an increase in peripheral blood leukocytes, neutrophils, acute inflammatory proteins, complement, and coagulation factors; and the release of inflammatory mediators such as PGF2a, PGE2, TNF, arginine precursor, norepinephrine, and epinephrine in the blood. Abnormal thalamic-pituitary-thyroid or adrenal target gland regulation. Abnormalities of the autophagy-immune inflammatory system, etc(Archer, 1973, Ferguson and Cada, 2004, Feng et al., 2017). Researchers believe that ADHD and inflammatory processes are closely linked. ADHD patients have been reported to have abnormal blood oxidative stress and inflammation when compared to the healthy individuals(Hendriksen et al., 2017). Some studies have shown that patients with ADHD had aberrant blood pro-inflammatory cytokine concentrations compared with healthy individuals(Kempuraj et al., 2017, Kozłowska et al., 2019). Chronic immunological dysregulation has been implicated in the onset of ADHD(Leffa et al., 2018). In addition, developmental or prenatal exposure to inflammation has been found to play a role in the development of ADHD(Majdak et al., 2014), with evidence implicating the involvement of peripheral inflammation and neuro-inflammation(Miller, 2020), and the connection between microglia, astrocytes, and mast cells are aided by CNS immune-related cytokines(Pape et al., 2019). Neuro-inflammation can be caused by a variety of pro-inflammatory and neurotoxic mediators produced by peripheral inflammation(Thapar and Cooper, 2016), as well as immune cell activity in the brain(Rivera et al., 2015).
Dysregulation of the hippocampal formation has been observed in ADHD patients and animal models(Thapar and Cooper, 2016). The etiology, biochemistry, symptomatology and treatment of spontaneously hypertensive rats (SHR) is well studied, making it a good ADHD model(Aparicio et al., 2019). Candidate gene studies, neurotransmitter dysfunction, neuropathology, and pharmacology studies validate the use of SHR as a ADHD model (Rivera et al., 2015, Leffa et al., 2018). Furthermore, the SHR prototype shows a significant level of predictive relevance for hitherto unknown behavioral, genetic, and neurobiological features of ADHD. In contrast, the white House Rats (SHR) are a biological model that have been produced from natural rats(Majdak et al., 2014).
Based on the theory of neurotransmitter abnormalities, there are two main types of drugs used to treat ADHD: methylphenidate (MPH), a psychostimulant II, and atomoxetine (ATX), a norepinephrine reuptake inhibitor, which are commonly used in combination with non-pharmacological therapies such as psycho-behavioral therapy (Russell, 2011). Long-term use of MPH and ATX may produce adverse effects such as loss of appetite, drowsiness, headache, dizziness, sleep disturbance and growth inhibition, while the use of MPH may also induce obsessive-compulsive symptoms and substance abuse problems(Hendriksen et al., 2017). It is difficult to avoid the side effects, which makes drug selection and administration difficult. Therefore, further studies are looking forward to explore new possibilities in the etiology and pathogenesis of ADHD, and to identify new treatment strategies that may bring about significant changes in the future understanding and clinical management of the disease(Kozłowska et al., 2019). Natural compounds have been shown to possess anti-oxidative stress, anti-inflammatory, immune-modulation effects, which may be with beneficial in regulating the neurological disease(Leffa et al., 2018). Therefore, the use of natural compounds to attenuate ADHD is currently attracting interest(Skaper et al., 2018).
Polygonum multiflorum is a traditional used herb medicine in China, which has the functions of enhancing immunity and improving DNA repair ability(Lin et al., 2018, Liu et al., 2021). The main component in Polygonum multiflorum is stilbene glycosides, which can protect nerve cells from damage by inhibiting apoptosis(Zhang and Chen, 2018). Stilbene glucoside (2,3,5,4༇-Tetrahydroxy stilbene-2-Ο-β-D-glucoside) is a subcategory of polyphenols found in many plant species that is able to induce cellular senescence(Wu et al., 2017). Stilbene glucoside compounds have good safety profiles in humans and have been suggested for use in chemotherapy and adjuvant therapy for tumors. In this study, we investigated the role of inflammation in ADHD and the effect of stilbene glucoside on neuro-inflammation using SHR as a model for ADHD and the Wistar-Kyoto (WKY) rats as controls. We also analyzed the effect of stilbene glucoside on the levels of DHA, BDNF, TrkB, and CNS immune-related cytokines in prefrontal, striatum and hippocampus tissues using immunostaining, real-time PCR and western blot analysis.
As shown in representative trajectories of each group in MWM and OFT (Figure A-B), stilbene glucoside can regulate the activity trajectory of rats. The results of the OFT experiment showed that the total motor distance (Figure C), central area activity time (Figure D) and number of uprightness (Figure E) were higher in the Model group compared with the Control group (p < 0.05). Rats treated with the Positive control or stilbene glucoside had significantly lower total motor distance, central area activity time, and number of uprights compared with rats in the model group (p < 0.05). The results of MWM experiment showed that the latency time of rats in each group gradually decreased in the hidden station experiment (Fig. 1F). In the spatial exploration experiment, the time spent in the target quadrant was significantly longer in the Model group compared with the Control group, but was significantly shorter in the Positive control group and stilbene glucoside treated groups when comparing with the model group (P < 0.05).
Microglia cells were stimulated and invaded in the Model group, as seen in Fig. 2. There were more TrkB positive and BDNF positive microglial cells in the prefrontal cortex, striatum, and hippocampal tissues of the rats in the Model group compared with in the Control group. After the establishment of the SHR model, the levels of DHA in prefrontal tissues decreased in the Model group when compared with the Control group (Fig. 2, P < 0.01). Treatment of rats with stilbene glucoside and atomoxetine increased the levels of DHA, TrkB and BDNF in prefrontal tissues. Specifically, stilbene glucoside increased the levels in a dose-dependent manner, with the HD group having higher levels than the LD and MD groups (Fig. 2, P < 0.01). The model group had higher DHA levels in the striatum and hippocampus compared with the control group (Fig. 2C-D, P < 0.01). However, treatment with stilbene glucoside and atomoxetine decreased the levels of DHA in striatum and hippocampus. The effect of stilbene glucoside seems to be a dose-dependent manner, with the effects in the HD group being greater than those in the LD and MD group (Fig. 2, P < 0.01).
As shown in Table 1, the mRNA expressions of these three pro-inflammatory cytokines: IL-1β, TNF-α and IL-6 in the prefrontal cortex were higher in the SHR rats when compared with the WKY rats (P < 0.01 or 0.05). When treating with different doses of stilbene glucoside, the mRNA expression of IL-1β and IL-6 were significantly decreased when comparing to the SHR rats, especially for the HD group (P < 0.01 or 0.05). Unfortunately, treating with stilbene glucoside did not inhibit the mRNA expression of TNF-α in SHR rats’ prefrontal cortex.
| Groups | IL-1β | TNF-α | IL-6 |
|---|---|---|---|
| Control | 1.00 ± 0.31 | 1.00 ± 0.19 | 1.00 ± 0.22 |
| Model | 2.49 ± 0.46## | 1.63 ± 0.33# | 4.27 ± 0.53## |
| Positive | 1.51 ± 0.24* | 1.53 ± 0.11 | 3.15 ± 0.26* |
| LD | 2.37 ± 0.52 | 1.74 ± 0.42 | 4.42 ± 0.74 |
| MD | 2.01 ± 0.37 | 1.47 ± 0.45 | 3.36 ± 0.35* |
| HD | 1.50 ± 0.22* | 1.31 ± 0.36 | 2.18 ± 0.57** |
| # p < 0.05 Model vs. Control group, # #p < 0.01 Model vs. Control group, *p < 0.05, compared to model group, **p < 0.05, compared to model group. | |||
Effect of Stilbene Glucoside on the mRNA and Protein Expression Levels of Immune Related Proteins in the Prefrontal Cortex
As shown in Fig. 3, the mRNA expressions levels of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 in the prefrontal cortex were lower in the Model group when compared with the Control group (P < 0.01). Treatment of rats with stilbene glucoside and positive control increased the levels of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 in the prefrontal tissues. Stilbene glucoside increased these mRNA levels in a dose-dependent manner, with the levels in the HD group being higher than those in the LD and MD group. As shown in Fig. 4, the results of Western blot analysis showed that the levels of SOS1, GAB1, AKT1, TrkB, and Kinase P110 beta in the prefrontal tissues were lower in the Model group compared with the control (P < 0.01 or P < 0.05).
Effect of Stilbene Glucoside on the mRNA and Protein Expression Levels of Immune Related Protein in Striatum
The mRNA expressions levels of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 (Fig. 5) was lower in the Model when compared with the Control group in striatum tissues (P < 0.01). Treatment of rats with stilbene glucoside and positive control increased the levels of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 in striatum. Stilbene glucoside increased the AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 levels in a dose-dependent manner, with the levels being higher in the HD group than in the LD and MD groups (Fig. 5, P < 0.01 or P < 0.05). Quantification of Western blot results showed that the protein expression levels of SOS1, GAB1, AKT1, TrkB, and Kinase P110 beta in striatum tissues were lower in the Model group compared with the Control group (Fig. 6, P < 0.01 or P < 0.05). stilbene glucoside and positive groups treatment increased the levels of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 in striatum. stilbene glucoside, in particular, had a dose-dependent effect, with the modifications in the HD group being greater than those in the LD and MD groups.
Stilbene Glucoside Regulate the mRNA and Protein Expression Levels of Immune Related Protein in AHDH Rats’ Hippocampus
After the SHR model had been established, the mRNA expression levels of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 in the hippocampus were lower in the model group compared with the Control group (P < 0.01). Treatment of rats with stilbene glucoside and positive control increased the levels of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 in hippocampus. Stilbene glucoside increased the AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 levels in a dose-dependent manner, with the levels being higher in the HD group than in the LD and MD groups (Fig. 3, P < 0.01). Quantification of Western blot results showed that the protein expression levels of SOS1, GAB1, AKT1, TrkB, and Kinase P110 beta in the hippocampus were lower in the model group compared with the control group (P < 0.01 or P < 0.05). Treatment of the stilbene glucoside and positive groups increased the level of AKT1, BDNF, SOS1, PIK3CG, GAB1 and NTRK2 in the hippocampus. In particular, stilbene glucoside was induced in a dose-dependent manner, with higher changes in the HD group than in the LD and MD groups.
Hangzhou Medical College (Certificate of Conformity No. SCXK (Zhe) 2019-0006) provided ten SPF-grade 3-week-old male WKY (Wistar Kyoto) rats and 50 age-paired SHR rats. The Animal Ethics Committee of Guangxi University of Chinese Medicine authorized all protocols for this animal experiment in strict conformity with the International Guide for the Ethical Use of Animals. The animal study was reviewed and approved by Regulation on Animal Ethics Committee of Guangxi University of Chinese Medicine (Number: 20211112Aazz0100000755).
Stilbene glucoside was obtained from Shanghai Maclin Biochemical Technology Co., LTD. The rats were randomly divided into six groups: control group (WKY rats), model group (SHR rats), Positive control group (4.56 mg/kg), stilbene glucoside LD group (Low Dose, 40 mg/kg), stilbene glucoside MD group (Medium Dose, 60 mg/kg), and stilbene glucoside HD group (High Dose, 80 mg/kg)(Solomon and Hechtman, 2019). Atomoxetine was used as a positive control(Thapar and Cooper, 2016), and was diluted to 0.152 mg/mL in distilled water. Distilled water was administered orally to the control and SHR rats, while the drugs were administered twice daily for 4 weeks in the positive and stilbene glucoside treated groups. The rats were sedated and sacrificed after the behavioral tests. Brain tissues were isolated and either used for immediate analysis, or stored in a freezer at -80°C for subsequent analysis.
Open-field experiments were used to assess hyperactive and impulsive behavior in an ADHD rat model(Archer, 1973) at 4 weeks of drug administration. The entire test area was split into sixteen 25×25cm pieces (the central location was a square measuring 50×50cm). The rats were gently put in the appropriations committee center, and their voluntary movements were recorded for 5 minutes. The total distance travelled (m), the time spent moving in the central area (s) and the number of uprights were recorded using the Universal Small Animal Track Recording Analysis System. At the end of each experiment, urine and faeces were removed, the chamber wiped with 75% alcohol and blown dry to remove any remaining odour that might affect the next rat.
The Morris water maze experiment is commonly used to evaluate the spatial learning and memory capacities of animals. In our study, the experiment was carried out after four weeks of treatment, and was run for 6 consecutive days. The testing apparatus included a round black iron barrel (150 cm in diameter) filled with water up to a depth of 50 cm (24 ± 2°C), a circular black platform (12 cm diameter) with a rough surface submerged approximately l cm below the water surface, and a camera and analysis system above the experimental area. The entire experimental area was divided into four quadrants of the same area and shape, and a different geometric pattern was attached to the wall above the water surface in each quadrant as a reference. The hidden station experiment was conducted on days 1–5, four times a day, from each of the four quadrants. Each rat had 60 seconds to locate the station. Rats that failed to find the platform were allowed a 30s rest at the end of each quadrant experiment before proceeding to the next quadrant. The spatial exploration experiment was conducted after the platform had been withdrawn and the trajectory of the rats was recorded over a 60-s period. The latency (s), the time the rat took to reach the platform in spatial exploration experiment, and time spent in target quadrant (s) were captured using the Universal Small Animal Activity Trajectory Recording Analysis System in the concealed station experiment. If the platform was not found within 60s, the latency was calculated as 60s. The animals were wiped with a dry towel immediately after the experiment and dried with a hairdryer before being placed in the cage. The water in the labyrinth was changed daily.
Immunohistochemistry was carried out as previously described(Kozłowska et al., 2019). The prefrontal cortex, striatum, and hippocampus of each group were fixed in 4% formalin, then embedded in paraffin, and sectioned into 3–4 µm thick slices. Immunohistochemistry was used to analyze tryptase expression, while immunofluorescence was used to analyze the expressions of BDNF (1:50, bs-4989R from Bioss) and TrkB (1:50, bs-0288R from Bioss) in brain sections from each group. A fluorescent microscope was used to take images of the prefrontal, striatum and hippocampus at magnification (400×).
DHA concentrations in the prefrontal cortex, striatum, and hippocampus were measured using DHA kits acquired from YUDUOBIO (Shanghai, YD2024). Tissues were weighted and 10 times of PBS were added and homogenated. This process was carried out on ice and then centrifuged (12,000 g), at 4°C for 20 min. The supernatant were collected and 200 µL of supernatant was accurately pipetted into a 96-well plate, zeroed with a blank, and the absorbance at 534 nm was detected.
Total RNA was isolated from the prefrontal cortex, striatum and hippocampus tissues using Trizol according to the manufacture’s protocol. Complementary DNA (cDNA) was synthesized following a program for cDNA elongation. The CFX96 Real-Time PCR machine was used to perform qRT-PCR. All reactions were run in triplicate and β-actin was used as a control for gene amplification. Primers used in real - time quantitative PCR are shown in Table 2.
| Gene | Forward | Reverse |
|---|---|---|
| IL-1β | TCTCACAGCAGCATCTCGAC | GGTCGTCATCATCCCACGAG |
| TNF-α | GGCATGGATCTCAAAGACAACC | AAATCGGCTGACGGTGTGG |
| IL-6 | CTGCTCTGGTCTTCTGGAGT | GCATTGGAAGTTGGGGTAGG |
| Akt1 | CTCTTCTTCCACCTGTCTCGT | TATCTTGATGTGCCCGTCCT |
| Bdnf | GGTTATTTCATACTTCGGTTGC | CCCATTCACGCTCTCCAG |
| Gab1 | CTGCTGATTCACCGTTCG | AGTCAAAATGGGCTCTGG |
| Ntrk2 | TATTCCTGCCTTTGATGTGG | CTCCTGCTGTGCTTTATGGT |
| Pik3cg | CGATGACGTTTTACATTACC | CACTTCGCAAGAACCAGA |
| Sos1 | AGTCCTATGCTCGGGATGTTCT | AGGGCTGTTATTGCTTGTTTCA |
| β-actin | CGTTGACATCCGTAAAGAC | CTGGAAGGTGGACAGTGAG |
Proteins were extracted from the prefrontal cortex, striatum and hippocampus tissues and quantified using a BCA protein assay kit. SDS-PAGE was utilized to separate the target proteins, which were then transferred to polyvinylidene difluoride membranes (0.45 m, Millipore, USA). The membranes were incubated overnight with primary antibodies against SOS1 (1:1,000, BM5105 from BOSTER), TrkB (1:1,000, bs-0288r from Bioss), Gab1 (1:1,000, 3232 from CST), Kinase P110 beta (1:1,000, bs-10657r from Bioss), AKT1 (1:1,000, 10176-1-AP from Proteintech), and β-actin (1:1,000, 10176-1-AP from Proteintech). After washing, the membranes were incubated with secondary antibody (1:10,000, sc-69879 from Santa Cruz). Protein bands were captured and analyzed using ImageJ software. The experiments were carried out in triplicates.
Data were presented as mean ± standard deviation (SD) and were analyzed using a one-way analysis of variance (ANOVA) followed by Dunnett's post hoc test using GraphPad Prism 6.0. (GraphPad Software, Inc., San Diego, CA, United States). Differences with a significance level of p༜0.05 were considered statistically significant.
ADHD is a protracted behavioral condition with an unknown cause that typically necessitates protracted medication to regulate the symptoms of hyperactivity, impulsivity, and inattention. However, atomoxetine, the most common medication for the treatment of ADHD, is associated with irritability, growth limitation, gastrointestinal side effects, sleep disruptions, and sleepiness(Thapar and Cooper, 2016). Therefore, there has an urgent need for new medications or treating strategies that are effective and safe in ADHD therapy. In this study, we investigated the effect of stilbene glucoside on behavioral performance and neuro-inflammatory pathways in ADHD. This research adds to the body of knowledge and lays the theoretical groundwork for pharmacological research and innovation in the treatment of ADHD.
Modern pharmacological studies have shown that stilbene glucoside has significant pharmacological effects, including anti-inflammatory, neuroprotective, and memory enhancement(Chin et al., 2016, Li et al., 2018). It is mainly useful in the prevention and treatment of various diseases such as inflammatory diseases and neurodegenerative diseases(Gao et al., 2020, Fan et al., 2021). Fortunately, in recent years, it has been widely reported in the literature that stilbene glucoside shows neuroprotective effects in neurodegenerative diseases, specifically by inhibiting microglia-mediated neuroinflammation and inhibiting neuronal apoptosis(Wang et al., 2021).
Behavioral and histomorphological assays were used to investigate the effect of stilbene glucoside on behavior and neuro-inflammation in the ADHD model, SHR. OFT has been used to assess hyperactive behavior in people with ADHD(Ferguson and Cada, 2004), while MWM has been commonly utilized in SHR rats to evaluate learning and memory capacity(Majdak et al., 2014). In this study, the distance traveled and the time spent in the center region was higher in the Model (SHR) group compared with the control group, which are typical indicators of hyperactivity and inattention. In contrast, the amount of time spent in the center and the distance covered were significantly lower in rats treated with stilbene glucoside and the positive control. The usual trajectories revealed that the rats treated with positive control and stilbene glucoside displayed substantial thigmotaxis movement sites, whereas the SHR group had disorganized movement trajectories. According to the MWM test results, rats treated with atomoxetine and stilbene glucoside exhibited stronger learning and memory capabilities, smaller escape latencies, more trips to the annulus, and longer stays in the target quadrant than rats in the SHR group. These findings revealed that stilbene glucoside reduced the fundamental symptoms of ADHD in SHRs.
Inflammation is associated with the pathogenesis of ADHD and is one of the key causes of central nervous system (CNS) disorders. Although some studies have found that inflammatory markers are overexpressed in ADHD patients(Russell, 2011, O'Shea et al., 2014, Kozłowska et al., 2019), other studies have yielded contradicting findings(Thapar et al., 2013). Inflammation can induce anxiety and depression or other psychiatric disorders(Majdak et al., 2014, Miller, 2020). Specifically, stilbene glycoside can protect neurons from LPS-induced neurotoxicity by ameliorating microglia-mediated neuroinflammation that regulates glial cells(Zhou et al., 2018), our data also indicated that stilbene glycoside could inhibit the neuro-inflammation. Mast cells can also induce glial cell activation and amplify neuro-inflammatory responses through PAR2-MAPK and PI3K/AKT signaling pathways(Verlaet et al., 2014, Yuan et al., 2019). Previous studies revealed that traditional chinese medicine an shen ding zhi ling improved NE and DHA deficiency in the prefrontal and striatum of SHRs(Song et al., 2020). In this study, we found that stilbene glucoside increased the levels of DHA in prefrontal tissues.
One of the neurotrophins that has been investigated the most in both the healthy and sick brain is BDNF(Lima Giacobbo et al., 2019). Since BDNF is linked to neuronal survival, plasticity, and neurotransmitter modulation, there is a wealth of research supporting this association (Panja and Bramham, 2014). BDNF levels in the blood and brain are frequently lower in patients with mental and neurodegenerative illnesses(Misiak et al., 2022). Resveratrol, a stilbene compound, increases BDNF serum concentrations on cognitive impairments and dementias(Wiciński et al., 2018). Our study found stilbene glucoside increased the mRNA expressions of BDNF. When Grb2 and its associated Sos1 and Gab1 bind to ShcA during cell transformation by the middle T-antigen of the polyoma virus, binding sites are created, and BDNF can activate Nrf2 via the truncated TrkB(Cheng et al., 2009, Ishii et al., 2019, Jiang et al., 2021). This in turn activates neuroinflammation, tyrosine phosphorylation, and PI3K and PLCgamma-1 enzymatic activity, and TRKs (Ntrk2), which are primarily involved in the development of the nervous system, can control cell division, proliferation, and even apoptosis through the PI3K/AKT pathways(Jiang et al., 2021). According to our research, stilbene glucoside groups showed significant increased the mRNA expressions of AKT1, SOS1, PIK3CG, GAB1 and NTRK2 and the protein levels of SOS1, GAB1, AKT1, TrkB, and Kinase P110 beta in the prefrontal cortex, striatum and hippocampus.
Our findings suggest that stilbene glucoside reduced the basic symptoms of ADHD by acting as BDNF and anti-inflammatory agent. This experiment has initially explored the neuro-inflammatory mechanism of ADHD, but the neuro-inflammatory mechanism is very complex and involves many cell types and signal pathways. The next step is to conduct in vitro experiments to explore the deeper relationship between ADHD and inflammation, and to find more powerful targets for stilbene glucoside to treat ADHD.
Ethical Approval The animal study was reviewed and approved by Regulation on Animal Ethics Committee of Guangxi University of Chinese Medicine (Permit Number: 20211112Aazz0100000755).
Competing interests Not applicable.
Authors' contributions Conceptualization, S.X. and L.P.; methodology, J.S. and S.X.; validation, J.S., W.L. and B.Z.; formal analysis, S.C.; investigation, W.Z. and D.W.; resources, M.Z.; data curation, J.S., W.L. and B.Z.; writing—original draft preparation, J.S.; writing—review and editing, W.Z. and D.W.; supervision, J.S.; project administration, W.L. and B.Z.; funding acquisition, S.X. and L.P. All authors have read and agreed to the published version of the manuscript.
Funding This study was financially supported by National Natural Science Foundation of China (8180414), Guangxi Natural Science Foundation Youth Fund (2017JJB140344y), Guangxi Natural Science Fund (2020JJA140275), Basic ability improvement project for young and middle-aged teachers in Guangxi universities (2018KY0281), and Guangxi University of Traditional Chinese Medicine Introduces Doctoral Research Start-up Fund Project (2017BS046).
Availability of data and materials Full availability of data and materials.