Human pegivirus (HPgV, GBV-C) RNA prevalence, genome characterization and association with HIV coinfection among volunteer blood donors from a public hemotherapy service in Northern Brazil.

doi:10.21203/rs.3.rs-21410/v1

Download PDF

Research

Human pegivirus (HPgV, GBV-C) RNA prevalence, genome characterization and association with HIV coinfection among volunteer blood donors from a public hemotherapy service in Northern Brazil.

https://doi.org/10.21203/rs.3.rs-21410/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 14 Oct, 2020

Read the published version in Virology Journal →

You are reading this latest preprint version

Background

Human pegivirus (HPgV) - formerly known as GBV-C - is a member of the Flaviviridae family and belongs to the species Pegivirus C. It is a non-pathogenic virus and is transmitted among humans mainly through the exposure to contaminated blood and is often associated with human immunodeficiency virus (HIV) infection. This study aimed to determine the prevalence of HPgV viremia, its association with HIV and clinical epidemiological factors, as well as the full-length sequencing and genome characterization of HPgV recovered from blood donors of the HEMOPA Foundation in Belém-PA-Brazil

Methods

Plasma samples were obtained from 459 donors, tested for the presence of HPgV RNA by the RT-qPCR. From these, a total of 26 RT-qPCR positive samples were submitted to the NGS sequencing approach in order to obtain the full genome⁺. Genome characterization and phylogenetic analysis were conducted.

Results

The prevalence of HPgV was 12.42%. We observed the highest prevalences among donors aged between 18 to 30 years old (16.5%), with brown skin color (13.2%) and men (15.8%). The newly diagnosed HIV-1 prevalence was 26.67%. The genotype 2 (2A and 2B) was identified. No data on viral load value was found to corroborate the protective effect of HPgV on HIV evolution.

Conclusions

This study provided information regarding the HPgV infection among blood donors from HEMOPA Foundation. Furthermore, we genetically characterized the HPgV circulating strains and described by the first time the genotype 2 genomes in the Brazilian Amazon region.

Virology

Pegivirus

blood donors

prevalence

genome

HIV coinfection

Human pegivirus (HPgV), formerly known as GBV-C or hepatitis G virus (HGV), is a member of the Flaviviridae family, belongs to the species Pegivirus C [1]. HPgV is an enveloped virus with a single-stranded, positively polarized RNA genome comprising approximately 9,400 nucleotides. The viral genome is similar to the genome of the hepatitis C virus and contains a single open reading frame (ORF) located between the untranslated regions (UTRs) at the 5¢ and 3¢ ends of the viral genome. The 5¢-NTR region is highly conserved with an internal ribosome entry site (IRES) and is responsible for the initiation of the translation of the viral RNA, resulting in the synthesis of a polyprotein of approximately 3,000 amino acid residues. Through the action of cellular peptidases and viral proteases, the polyprotein is cleaved to produce eight mature yet incompletely characterized proteins, including the two structural (E1 and E2) and seven non-structural (NS) proteins [2–4].

HPgV is transmitted among humans mainly through exposure to contaminated blood. This transmission profile deems HPgV as a common coinfection with other viruses such as HIV-1, hepatitis C virus (HCV), and Ebola virus [5–7]. Up to 40% of the individuals infected with HIV and/or HCV are positive for HPgV infection [8,9]

People HIV-1 co-infected with HPgV experience slower disease progression that may be influenced by the interference of HPgV on the pathogenicity of HIV-1, however, the mechanism by which HPgV mediates this protective effect still remains unknown [10,11].

Several studies carried out in different populations in the last decades in Brazil have shown varying prevalence rates [12,13]. In studies among healthy blood donors conducted in Brazil, prevalence rates of 19.5% and 9.7% were observed among individuals with prior exposure and active infection, respectively [14]. However, the most significant prevalence has been reported among patients with HIV, with a value reaching up to 34% [15].

The prevalence of the virus is lower in the developed countries (1-5%) than in the developing countries -(approximately 20%), with South America exhibiting a prevalence rate of up to 14.6% among blood donors [4]. Seroprevalence studies in Brazil reveal the presence of anti-E2 antibodies in 19.5% of healthy blood donors [16], however, little is known about the prevalence of HPgV viremia and its circulating strains among the Brazilian population, particularly blood donors.

This study aimed to determine the prevalence of HPgV viremia, its association with HIV and clinical epidemiological factors, as well as the complete genome characterization of HPgV present in blood donors of the HEMOPA Foundation in Belém-PA-Brazil.

Blood donors and the collection of serum samples

A cross-sectional study was performed in order to determine the prevalence of HPgV infection among blood donors from the HEMOPA Foundation between March 2017 and April 2018. Epidemiological data were obtained through access to the HEMOPA Foundation donor registry. The sample size was calculated using EpiInfo™ software [17] based on the presumed prevalence of 5–10% of HPgV in Brazil [15, 18]. For this calculation, the number of blood donors registered in 2016 at the HEMOPA Foundation (63,501), 95% confidence level, and 20% margin adjustment was used to obtain a total of 366 individuals. A total of 459 serum samples (400 µL) from the blood donors from the HEMOPA Foundation were tested.

Extraction and detection of HIV, HCV, and HPgV nucleic acids

The extraction of nucleic acids was performed using the QIAmp RNA mini Kit (Qiagen®, Hilden, Germany) according to the manufacturer’s recommendations. HIV and HCV detection were performed with Hemocenter’s Nuclear Acid Test Platform (NAT) using the HIV/HCV NAT kit (Bio Manguinhos®, Rio de Janeiro, Brazil), according to the manufacturer’s recommendations.

The presence of HPgV nucleic acid was evaluated by the RT-qPCR, using the custom Assay TaqMan® Fast Virus 1-Step, developed by AB Applied Biosystems (Foster City, California, EUA), following the manufacturer’s Fast protocol as follows: 1 cycle of reverse transcription (RT) for 2 min at 50 °C; inactivation of Reverse Transcription (RT)/start of denaturation (1 cycle) for 20 s at 95°C; amplification for 40 cycles of 95 °C for 3 s and 60 °C for 30 s. The selected primers corresponded to the 5′-UTR of the viral genome according to GenBank NC_001710 and were as follows: RTG1 (GTGGTGGATGGGTGATGACA; sense), RTG2 (GACCCACCTATAGTGGCTACCA; antisense), and NFQ (5′-FAM-CCGGGATTTACGACCTACC3′; probe) [15].

Quantification of HIV‑1 and HPgV plasma viral load

HIV-1 viral load was measured in a Real-Time Rotor-Gene® Q platform using artus HI Virus-1 RG RT-PCR (QIAGEN Hilden, Germany) and HPgV viral load was measured in a Real-Time LightCycler® 480 Instrument II (Roche Applied Science, Penzberg, Germany) using TaqMan® Fast Virus 1-Step Master Mix (Foster City, California, USA). Both methods strictly followed the manufacture´s recommendation.

Sequencing

The RNA, obtained in the nucleic acid extraction step, was quantified in Qubit 2.0 fluorometer (Thermo Fisher Scientific), using the QubitTM RNA HS Assay Kit 500 assays (Invitrogen by Thermo Fisher Scientific). Then, cDNA was synthesized using the cDNA Synthesis System Roche® kit (Roche Applied Science), as described by the manufacturer. The subsequent step was the quantification of cDNA using the qubit 2.0 fluorometer (Thermo Fisher Scientific), using the QubitTM dsDNA HS Assay Kit (Invitrogen by Thermo Fisher Scientific) and analysis of cDNA integrity in the equipment 2100 Bioanalyzer (Agilent Technologies) using the high sensitivity DNA reagents kit (Agilent Technologies). Genome sequencing was performed using the HiSeq 2500 platform (Illumina) as previously described [19].

Bioinformatics Analysis

Generated reads were filtered, adapters and reads with Phred quality scores below 20 and size less than 50 nt, were removed using Trim Galore 0.4.4, Cutadapt and Prinseq-lite 0.20.4 software [20–22]. The filtered reads were used in de novo assembly strategy applying two software: IDBA-UD v.1.1.3 [23] and MEGAHIT v.1.1.3 [24], both set to a k-mer range of 21 to 91, varying every 10 k-mer. For the removal of redundant data, generated contigs were processed using CD-Hit-Est v.4.7 [25] set to a threshold of 90% identity. Then, the non-redundant contigs were aligned against the NCBI non-redundant protein database using the Blastx (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) algorithm and the software Diamond v.0.9.22 [26].

Genome characterization and phylogenetic inference

The HPgV genomes, identified by the Blastx algorithm, were used for predicting the coding region (Open Reading Frame; ORF), as well as the 5'-UTR and 3'-UTR regions using the Geneious v9 tool. Viral genomes were aligned with other HPgV complete genomes available in GenBank database using the MAFFT v7 software [27]. For phylogenetic analyses, ORFs from aligned genomes were used to perform the phylogenetic reconstructions using the maximum-likelihood method, generated by RAxML v.8.2.12 [28], applying 1000 bootstrap replicates[29] and the best nucleotide replacement model calculated by JModelTest [30]. Complete genome sequences of HPgV obtained in this study have been submitted to GenBank (accession numbers MN215894–MN21591).

Statistical analysis

The differences between the groups were analyzed with the chi-square test, G test of independence, Student’s t-test, and odds ratio. The level of significance of α = 0.05 was adopted for the rejection of the null hypothesis. Statistical analyses were performed using the BioEstat program version 5.3 and GraphPad Prism version 8; Microsoft Excel Professional 2007 program was used for data processing and to prepare tables and databases.

Plasma samples were obtained from 459 donors at the time of screening. The prevalence of HPgV in the samples was 12.42% (n = 57) and a total of 26.14% (n = 120) of the donors were HIV positive, diagnosed through routine tests carried out at the HEMOPA Foundation. The HPgV prevalence among HIV donors was 26.67% (n = 32, p < 0 .0001). HIV positive donors were four times more likely to have HPgV infection than those HIV negative (odds ratio = 4.56, p < 0.0001, 95% confidence interval [CI]:2.57–8.10).

The highest prevalences of HPgV were observed among donors with ages ranging from 18 to 30 years old (16.5%, p = 0.024), men (15,8%, p = 0.005) with brown skin color (13.2%, p = 0,462) and 12 or more years of education (24.0%, p < 0.0001) (Table 1).

Table 1

Clinical epidemiological data on the prevalence of HPgV among blood donors.
Variable/category	Total		HPgV⁺		HPgV⁻		p-value
Variable/category	n	(%)	n	(%)	n	(%)	p-value
Age (years)
18–30	224	48.8%	37	16.5%	187	83.5%	p = 0.0273
31–50	197	42.9%	18	9.1%	179	90.9%
≥ 51	38	8.3%	2	5.3%	36	94.7%
Skin color
Brown	356	77.6%	47	13.2%	309	86.8%	p = 0.462
White	84	18.3%	9	10.7%	75	89.3%
Black	19	4.1%	1	5.3%	18	94.7%
Sex
Male	284	61.9%	45	15.8%	241	84.9%	p = 0.0056
Female	175	38.1%	12	6.9%	161	92.0%
Education (years of study)
≥ 12	146	31.8%	35	24.0%	111	76.0%	p < 0.0001
9 to 11	259	56.4%	19	7.3%	240	92.7%
≤ 8	54	11.8%	3	5.6%	51	94.4%
Co-infection
HIV+	120	26.1	32	26.7%	88	73.3%	p < 0.0001
HIV−	339	73.9	25	7.4%	314	92.6%

In 18 of the 57 HPgV positive samples (31.6%) near-complete genomes sequences were obtained. The BlastX result of the 18 genomes obtained showed 91–93.24% identity with Human pegivirus sequences from the United Kingdom (LT009489 and LT009494), France (MH053115) and Japan (D87255), available from GenBank / NCBI (Table 2). The pairwise alignment of the polyprotein amino acid sequences of these four strains of the bank along with the 18 described sequences showed an identity of 98.6%.

Table 2

BlastX result for 18 nearly complete HPgV genome sequences obtained from blood donors from Belém-PA-Brazil.
Sample	Genome Lenth	Mean Cover	Best Hit	Query cover	Identity	Accession
P01	8,392	14,8	Human pegivirus isolate 56330229	100%	92.14%	LT009489
P02	8,995	20,1	Human pegivirus isolate JD2B2C	99%	91.00%	MH053115
P09	8,933	22,9	Human pegivirus isolate 56330229	99%	92.34%	LT009489
P13	9,101	593,8	Human pegivirus isolate JD2B2C	100%	91.63%	MH053115
P21	9,172	448,6	Hepatitis G virus	100%	93.24%	D87255
P22	8,811	26	Human pegivirus isolate JD2B2C	99%	91.60%	MH053115
P23	9,190	133,7	Human pegivirus isolate JD2B2C	99%	91.73%	MH053115
P24	9,306	386	Human pegivirus isolate 56330229	99%	92.80%	LT009489
P25	9,241	327,1	Human pegivirus isolate JD2B2C	99%	91.64%	MH053115
P26	9,189	143,7	Human pegivirus isolate JD2B2C	99%	91.92%	MH053115
P27	8,873	22,6	Human pegivirus isolate 56330229	99%	92.29%	LT009489
P28	8,913	32,5	Hepatitis G virus	99%	93.21%	D87255
P31	9,521	538,5	Human pegivirus isolate 56330229	99%	92.51%	LT009489
P32	9,256	182,7	Human pegivirus isolate 56330286	99%	92.25%	LT009494
P33	9,409	640	Human pegivirus isolate 56330286	100%	92.40%	LT009494
P34	9,270	146,1	Human pegivirus isolate 56330229	100%	92.44%	LT009489
P35	9,198	755,6	Human pegivirus isolate 56330229	100%	92.22%	LT009489
P55	9,203	566,4	Human pegivirus isolate 56330229	100%	92.27%	LT009489

All nearly complete genome sequences showed the common genome organization related to members of the HPgV: unique and large ORF flanked by 5’and 3’ UTRs; two structural proteins (E1 and E2) and seven nonstructural proteins (p5,6, NS2, NS3, NS4A, NS4B, NS5A, NS5B). The phylogenetic tree depicted seven major groups (genotype1, 2a, 2b, 3, 4, 6 and 7) and two subgenotypes (2A and 2B) with high bootstrap values (> 90%). All generated sequences clustered with HPgV genotype 2 sequences (Fig. 1).

We found a higher viral load (2.72 Log₁₀) of HIV-1 in the confected group (HIV + HPgV positive, Fig. 2a), while a higher viral load (4.28 Log₁₀) of HPgV was found in the monoinfected group (HPgV positive, Fig. 2b).

The prevalence of HPgV-1 among blood donors was 12,4%, which is consistent and not significantly different from the expected prevalence in developing countries (up to 20%) [4, 31]. The prevalence calculated in this study was 2,8% higher than reported Slavov et al. [32] in a study among blood donors from the city of Macapá (northern Brazil). Previous studies have shown that the prevalence of HPgV among blood donors in most regions of Brazil varies from 5–10% [14, 33–36], although Da Mota et al. [37] have found a high prevalence of 21.7% in the southernmost region of Brazil.

A significant association was observed between the presence of HPgV and age, gender, and years of education by Miranda et al. [38]. In our findings, the highest prevalence of HPgV occurred among subjects between 18 and 30 years of age (16.5%), males (15.8%), and brown individuals (13.2%). It is important to highlight that the epidemiological profile of the donors was similar to that observed in the epidemiology of HIV/AIDS in Brazil, wherein the majority of the infected individuals were male and young subjects (15 to 39 years) with up to 11 years of age (completed high school) [39]. Another issue to consider is that sexual activity is more evident among young people so this population has shown a greater risk to be infected with HPgV, as suggested Da Mota et al. [15] and Miao et al [40].

The prevalence of HPgV among the individuals diagnosed with HIV-1 in this study was 9,7% higher than that reported by Miranda et al. [38]. The high prevalence of HPgV among HIV-1 individuals has been reported in several studies in Brazil and the world [40–42]. The association between the presence of HPgV and HIV is owing to the fact that HPgV likely acts as a protective factor for the development of HIV [40, 43, 44].

HIV-1 infected people have reduced mortality when co-infected with HPgV, nonetheless the mechanism by which HPgV mediates this protective effect remains unknown [45, 46]. Nevertheless, the present study showed no evidence of viral load value that corroborated with the protective effect of HPgV in the evolution of HIV, instead, HIV-1 viral load in the coinfected group (HIV-1 + HPgV positive) was 0.72 Log₁₀ (p = 0,002) higher than in a monoinfected group (HIV-1 positive). One interpretation of this finding is that the increase in T cells during the expansion phase of viral infection leads to an increase in both viral loads [47, 48]. Another consideration is that all individuals in our sample were newly diagnosed with HIV during the acute phase, suggesting that HPgV does not exert a protective effect on the pathogenesis of HIV during the acute phase of HIV infection as suggested Bailey et al. [49]. We hypothesize that HIV-1 would have an advantage in lymphocyte infection since HPgV may infect the same cells as HIV-1 [50].

The phylogenetic analysis revealed the presence of genotype 2 and the subtypes 2a and 2b in the studied population. These findings corroborate previous studies that identified these same genotypes in other regions of Brazil [18, 33, 41] and in Brazilian Amazon [32].

HPgV is known as a non-pathogenic virus and is not part of the routine diagnosis in the HEMOPA Foundation, but further studies are necessary to evaluate the unclear aspects related to HPgV infection especially those related to viral biology and interaction with HIV-1. This study genetically characterized and identified, by the first time, the circulating strains of HPgV among blood donors from HEMOPA Foundation and described by the first nearly complete genomes of genotype 2 in Brazilian Amazon.

cDNA - Complementary deoxyribonucleic acid

dsDNA - Doble-stranded deoxyribonucleic acid

GBV-C - GB virus C

HCV - Hepatitis C virus

HEMOPA Foundation - Foundation Center for Hemotherapy and Hematology of Pará

HIV - Human immunodeficiency virus

HPgV - Human Pegivirus

IRES - internal ribosome entry site

ORF - open reading frame

RNA - Ribonucleic acid

RT-qPCR- Reverse transcription real-time polimerase chain reaction

UTRs - Untranslated regions

Ethics approval and consent to participate

All procedures performed in this study involving human participants were in accordance with the ethical standards of the institutional research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. This work was approved by the Human Research Ethics Committee of the State University of Pará (Opinion No. 1.868.004/CAAE: 62348616.4.0000.5174) and all donors were informed of their participation in this research project by signing the Term Free and Informed Consent (EHIC) and all the privacy rights were observed.

Consent for publication

Not applicable

Availability of data and materials

Not applicable

Competing interests

The authors declare that they have no competing interests

Funding

The work was supported by the HEMOPA foundation, Evandro Chagas Institute, Foundation for Scientific and Technological Development in Health (FIOTEC; Project PRES-012-FIO-16) and funded in part by the research productivity project CNPq (302584/2015-3).

Authors' contributions

AS contributed to the conception of the work; acquisition, analysis and interpretation of data for the work; revising the work critically for important intellectual content. CS worked on the acquisition, analysis and interpretation of data RB contribuited to the acquisition, analysis and interpretation of the data. PS and PM contributed on the acquisition of data. LL and RB contributed to the conception of the work; acquisition, analysis and interpretation of data for the work; revising it critically for important intellectual content. MN and PM contributed to the conception of the work; acquisition, analysis and interpretation of data for the work; revising it critically for important intellectual content. All authors read and approved the final manuscript.

Acknowledgements

Not applicable

Simmonds P, Becher P, Bukh J, Gould EA, Meyers G, Monath T, et al. ICTV Virus Taxonomy Profile: Dicistroviridae. J Gen Virol [Internet]. 2017;98:355–6. Recuperado de: .
Chowdhury AY, Tavis JE, George SL. Human pegivirus (GB virus C) NS3 protease activity inhibits induction of the type I interferon response and is not inhibited by HCV NS3 protease inhibitors. Virology [Internet] Elsevier. 2014;456–457:300–9. . Recuperado de:.
Stapleton JT, Foung S, Muerhoff AS, Bukh J, Simmonds P. The GB viruses: A review and proposed classification of GBV-A, GBV-C (HGV), and GBV-D in genus Pegivirus within the family Flaviviridae. J Gen Virol. 2011. p. 233–46.
Mohr EL, Stapleton JT. GB virus type C interactions with HIV: The role of envelope glycoproteins. J Viral Hepat. 2009;16:757–68.
Lauck M, Bailey AL, Andersen KG, Goldberg TL, Sabeti PC, O’Connor DH.. Silvestri G. GB Virus C Coinfections in West African Ebola Patients. organizador J Virol [Internet]. 2015;89:2425–9. . Recuperado de:.
Berg MG, Lee D, Coller K, Frankel M, Aronsohn A, Cheng K, et al. Discovery of a Novel Human Pegivirus in Blood Associated with Hepatitis C Virus Co-Infection. Drosten C, organizador. PLOS Pathog [Internet]. 2015;11:e1005325. . Recuperado de:.
Ng KT, Takebe Y, Chook JB, Chow WZ, Chan KG, Abed Al-Darraji HA, et al. Co-infections and transmission networks of HCV, HIV-1 and HPgV among people who inject drugs. Sci Rep [Internet] Nature Publishing Group. 2015;5:15198. . Recuperado de:.
Tenckhoff S, Kaiser T, Bredeek F, Donfield S, Menius E, Lail A, et al. Role of GB virus C in HIV-1-infected and hepatitis C virus-infected hemophiliac children and adolescents. J Acquir Immune Defic Syndr [Internet]. 2012;61:243–8. . Recuperado de:.
Feng Y, Zhao W, Feng Y, Dai J, Li Z, Zhang X, et al. A novel genotype of GB virus C: Its identification and predominance among injecting drug users in Yunnan, China. PLoS One. 2011;6.
Maidana-Giret MT, Silva TM, Sauer MM, Tomiyama H, Levi JE, Bassichetto KC, et al. GB virus type C infection modulates T-cell activation independently of HIV-1 viral load. AIDS [Internet]. 2009;23:2277–87. . Recuperado de:.
Stapleton JT, Chaloner K, Martenson JA, Zhang J, Klinzman D, Xiang J, et al. GB virus C infection is associated with altered lymphocyte subset distribution and reduced T cell activation and proliferation in HIV-infected individuals. PLoS One [Internet]. 2012;7:e50563. . Recuperado de:.
Ramos Filho R, Carneiro MAS, Teles S, a, Dias M, Cardoso DDP, Lampe E, et al. GB virus C/hepatitis G virus infection in dialysis patients and kidney transplant recipients in Central Brazil. Mem Inst Oswaldo Cruz [Internet]. 2004;99:639–43. . Recuperado de:. ;. &pid=S0074-02762004000600019&lng=en&nrm=iso&tlng=en.
Gallian P, Rodrigues V, Cantaloube JF, Dessein H, de Micco P, Dessein AJ, et al. High prevalence of GB-C/hepatitis G virus in a Brazilian population with helminth infection. J Med Virol [Internet]. 1998;56:310–5. . Recuperado de:.
Levi JE, Contri DG, Lima LP, Takaoka DT, Garrini RH, Santos W, et al. High prevalence of GB virus c/hepatitis G virus RNA among Brazilian blood donors. Rev Inst Med Trop Sao Paulo. 2003;45:75–8.
Da Mota LD, Nishiya AS, Finger-Jardim F, Barral MFM, Silva CM, Nader MM, et al. Prevalence of human pegivirus (HPgV) infection in patients carrying HIV-1C or non-C in southern Brazil. J Med Virol. 2016;88:2106–14.
Ross RS, Viazov S, Schmitt U, Schmolke S, Tacke M, Ofenloch-Haehnle B, et al. Distinct prevalence of antibodies to the E2 protein of GB virus C/hepatitis G virus in different parts of the world. J Med Virol [Internet]. 1998;54:103–6. . Recuperado de:.
Centers for Disease Control and Prevention. Epi Info™. Epi Info. 2013.
Giret MTM, Miraglia JL, Sucupira MCA, Nishiya A, Levi JE, Diaz RS, et al. Prevalence, incidence density, and genotype distribution of GB virus C infection in a cohort of recently HIV-1-infected subjects in Sao Paulo, Brazil. PLoS One. 2011;6.
Pease J, Sooknanan R. A rapid, directional RNA-seq library preparation workflow for Illumina[reg] sequencing. Nat Methods. 2012;9:i–i.
Felix K. Trim Galore! Available at: http://www.bioinformatics. . Available at: . ; 2017.
Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal [Internet]. 2011;17:10. Recuperado de: .
Schmieder R, Edwards R. Quality control and preprocessing of metagenomic datasets. Bioinformatics [Internet]. 2011;27:863–4. . Recuperado de:.
IDBA-UD: a de novo assembler for single-cell and metagenomic sequencing data with highly uneven depth

10.1093/bioinformatics/bts174

Recuperado de:

Peng Y, Leung HCM, Yiu SM, Chin FYL. IDBA-UD: a de novo assembler for single-cell and metagenomic sequencing data with highly uneven depth. Bioinformatics [Internet]. 2012;28:1420–8. Recuperado de: .
MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

10.1093/bioinformatics/btv033

Recuperado de:

Li D, Liu C-M, Luo R, Sadakane K, Lam T-W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics [Internet]. 2015;31:1674–6. Recuperado de: .
Li W, Godzik A. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics [Internet]. 2006;22:1658–9. . Recuperado de:.
Buchfink B, Xie C, Huson DH. Fast and sensitive protein alignment using DIAMOND. Nat Methods [Internet]. 2015;12:59–60. . Recuperado de:.
Katoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol [Internet]. 2013;30:772–80. Recuperado de: .
RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies

10.1093/bioinformatics/btu033

Recuperado de:

Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics [Internet]. 2014;30:1312–3. Recuperado de: .
Felsenstein J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution (N Y). 1985;39:783–91.
Posada D. jModelTest. Phylogenetic Model Averaging. Mol Biol Evol [Internet]. 2008;25:1253–6. Recuperado de: .
AbuOdeh RO, Al-Absi E, Ali NH, Khalili M, Al-Mawlawi N, Hadwan TA, et al. Detection and phylogenetic analysis of human pegivirus (GBV-C) among blood donors and patients infected with hepatitis B virus (HBV) in Qatar. Drosten C, organizador. J Med Virol [Internet]. 2015;87:2074–81. . Recuperado de:.
Slavov SN, Maraninchi Silveira R, Hespanhol MR, Sauvage V, Rodrigues ES, Fontanari Krause L, et al. Human pegivirus-1 (HPgV-1) RNA prevalence and genotypes in volunteer blood donors from the Brazilian Amazon. Transfus Clin Biol [Internet]. Société française de transfusion sanguine (SFTS); 2019;1:1–6. Recuperado de: .
Slavov SN, Silveira RM, Rodrigues ES, Diefenbach CF, Zimmermann AM, Covas DT, et al. Human pegivirus-1 (HPgV-1, GBV-C) RNA prevalence and genotype diversity among volunteer blood donors from an intra-hospital hemotherapy service in Southern Brazil. Transfus Apher Sci [Internet] Elsevier. 2019;58:174–8. . Recuperado de.
Ribeiro-dos-Santos G, Nishiya AS, Nascimento CMR, Bassit L, Chamone DF, Focaccia R, et al. Prevalence of GB virus C (hepatitis G virus) and risk factors for infection in São Paulo, Brazil. Eur J Clin Microbiol Infect Dis [Internet]. 2002;21:438–43. . Recuperado de:.
Oliveira LA, Martins RMB, Carneiro MAS, Teles SA, Silva SA, Cardoso DDP, et al. Prevalence and genotypes of GB virus C/hepatitis G virus among blood donors in Central Brazil. Mem Inst Oswaldo Cruz. 2002;97:953–7.
Bassit L, Kleter B, Ribeiro-dos-Santos G, Maertens G, Sabino E, Chamone D, et al. Hepatitis G virus: prevalence and sequence analysis in blood donors of São Paulo, Brazil. Vox Sang [Internet]. 1998;74:83–7. . Recuperado de:.
Da Mota LD, Finger-Jardim F, Silva CM, Germano FN, Nader MM, Gonçalves CV, et al. High prevalence and autochtonous transmission of human pegivirus (HPgV-1) in blood donors in the extreme southern of Brazil. J Med Virol [Internet]. 2019;91:31–7. . Recuperado de:.
10.1007/s00705-017-3514-y
de Miranda BKB, de Sá KSG, da Silva ANR, Feitosa RNM, Cayres-Vallinoto IMV, Ishak R, et al. GBV-C/HIV-1 coinfection is associated with low HIV-1 viral load and high CD4 + T lymphocyte count. Arch Virol [Internet]. Springer Vienna; 2017; Recuperado de: .
BRASIL. Boletim Epidemilógico HIV/AIDS. Bol Epidemiológico HIVAIDS. 2015;1:1–100.
Miao Z, Gao L, Song Y, Yang M, Zhang M, Lou J, et al. Prevalence and Clinical Impact of Human Pegivirus-1 Infection in HIV-1-Infected Individuals in Yunnan, China. Viruses [Internet]. 2017;9:28. Recuperado de: /1999-4915/9/2/28.
Mota LD, Da, Finger-Jardim F, Silva CM, Germano FN, Nader MM, Gonçalves CV, et al. Molecular and Clinical Profiles of Human Pegivirus Type 1 Infection in Individuals Living with HIV-1 in the Extreme South of Brazil. Biomed Res Int [Internet]. 2019;2019:1–11. . Recuperado de.
Santos LM, Lobato RC, Barral MFM, Gonçalves CV, da Hora VP, Martinez AMB. Prevalence and vertical transmission of human pegivirus among pregnant women infected with HIV. Int J Gynaecol Obstet [Internet]. 2017;38:42–9. . Recuperado de:.
Chivero ET, Bhattarai N, McLinden JH, Xiang J, Stapleton JT. Human Pegivirus (HPgV; formerly known as GBV-C) inhibits IL-12 dependent natural killer cell function. Virology [Internet] Elsevier. 2015;485:116–27. . Recuperado de:.
Gómara MJ, Galatola R, Gutiérrez A, Gimeno MC, Gatell JM, Sánchez-Merino V, et al. HIV-1 inhibiting capacity of novel forms of presentation of GB virus C peptide domains is enhanced by coordination to gold compounds. Curr Med Chem [Internet]. 2014;21:238–50. . Recuperado de:.
Vahidnia F, Petersen M, Stapleton JT, Rutherford GW, Busch M, Custer B. Acquisition of GB virus type C and lower mortality in patients with advanced HIV disease. Clin Infect Dis [Internet]. 2012;55:1012–9. . Recuperado de:.
Lanteri MC, Vahidnia F, Tan S, Stapleton JT, Norris PJ, Heitman J, et al. Downregulation of Cytokines and Chemokines by GB Virus C After Transmission Via Blood Transfusion in HIV-Positive Blood Recipients. J Infect Dis [Internet]. 2015;211:1585–96. Recuperado de: .
Murali-Krishna K, Altman JD, Suresh M, Sourdive DJD, Zajac AJ, Miller JD, et al. Counting Antigen-Specific CD8 T Cells: A Reevaluation of Bystander Activation during Viral Infection The T cell proliferation seen during viral infections in vivo could in theory result from a number of mecha. Immunity [Internet]. 1998;8:177–87. . Recuperado de: Spring/MCB 700/20170825 8-25-17 Reading Papers Materials/Krishna.pdf.
Blattman JN, Antia R, Sourdive DJD, Wang X, Kaech SM, Murali-Krishna K, et al. Estimating the Precursor Frequency of Naive Antigen-specific CD8 T Cells. J Exp Med [Internet]. 2002;195:657–64. Recuperado de: .
Bailey AL, Buechler CR, Matson DR, Peterson EJ, Brunner KG, Mohns MS, et al. Pegivirus avoids immune recognition but does not attenuate acute-phase disease in a macaque model of HIV infection. Silvestri G, organizador. PLOS Pathog [Internet]. 2017;13:e1006692. . Recuperado de:.
Chivero ET, Stapleton JT. Tropism of human pegivirus (formerly known as GB virus C/hepatitis G virus) and host immunomodulation: insights into a highly successful viral infection. J Gen Virol [Internet]. 2015;96:1521–32. Recuperado de: .

Download PDF

Journal Publication

published 14 Oct, 2020

Read the published version in Virology Journal →

Editorial decision: Major revision
19 Aug, 2020
Review #2 received at journal
18 Aug, 2020
Review #1 received at journal
01 Aug, 2020
Reviewer #2 agreed at journal
27 Jul, 2020
Reviewer #1 agreed at journal
17 Jul, 2020
Reviewers invited by journal
17 Jul, 2020
Editor assigned by journal
16 Apr, 2020
Editor invited by journal
15 Apr, 2020
Submission checks completed at journal
14 Apr, 2020
First submitted to journal
06 Apr, 2020

You are reading this latest preprint version

Human pegivirus (HPgV, GBV-C) RNA prevalence, genome characterization and association with HIV coinfection among volunteer blood donors from a public hemotherapy service in Northern Brazil.

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Blood donors and the collection of serum samples

Extraction and detection of HIV, HCV, and HPgV nucleic acids

Quantification of HIV‑1 and HPgV plasma viral load

Sequencing

Bioinformatics Analysis

Genome characterization and phylogenetic inference

Statistical analysis

Results

Discussion

Conclusions

List of Abbreviations

Declarations

References

Status:

Journal Publication

Version 1