Cell culture and reagents
The human acute lymphoblastic leukemia cell lines (BV173, NALM6, JM-1, NALM1, RS6 and SUPB15) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) . All cell lines were cultured in Dulbecco's altered Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Hyclone, USA) at 37℃ with 5% CO2 in a humidified incubator. Alantolactone and rapamycin were obtained from MedChemExpress (New Jersey, USA). Both the tested compounds were dissolved in dimethylsulfoxide (DMSO). The final concentration of DMSO in culture medium did not exceed 0.1%.
Cell viability assay
Cell viability assay was evacarried out with a MTT assay kit (Sigma-Aldrich, USA). BV173 and NALM6 cells were seeded in 96-well plates and then treated with 1, 5, and 10 μM of ALT for 24h. After that, 10μl of 5 mg/ml MTT solution was added, and incubated at 37oC for 2 h. MTT solvent was then added to the cuture. The absorbance was read at 570 nm using a microplate reader. Each experiment was performed at least three times.
RNA sequencing
All of these procedures were performed by the Beijing Genomics Institute (BGI, Shenzhen, China). In brief, BV173 and NALM6 cells were treated with ALT (5μM) and control (0.1% DMSO) for 24 hours. Total mRNA was isolated with a Trizol kit (Invitrogen, Life Technologies Corporation, USA), and converted into a library of cDNA fragments using TruSeq Stranded mRNA LTSample Prep Kit (Illumina, USA). Then, these samples were sequenced on the Illumina HiSeq 4000 platform (Illumina, San Diego, CA, USA). Statistical analysis was performed with the ALEXA-seq software package, and differentially expressed genes (DEGs) were selected according to the criteria of a fold change ≥ 2, P < 0.05 and FDR < 0.05.
Plasmids transfection
The siRNA for AP2M1(si-AP2M1), siRNA for Beclin1 (si-Beclin1), pcDNA3.1 vector overexressing AP2M1 and negative controls were obtained from Genepharma (Shanghai, China). Sequences are as follows: si-AP2M1, GGGUGGUGAUGAAGAGCUACC; si-Beclin1, GGUGUUUGAUACUGUUUGAGA. Plasmids were transfected into ALL cells by using Lipofectine 2000 (Invitrogen, USA) according to the manufacturer’s instruction.
Colony formation assay
Cells were seeded in 12-well plates (500 cells/well) and incubated for 14 days and then fixed with 4% paraformaldehyde for 15 minutes. The fixed cells were stained with 0.1% crystal violet, and then photographed with a microscope. The number of visible cell colonies were recorded.
Cell apoptosis
Upon treatment with different concentrations of ALT, both BV173 and NALM6 cells were harvested and washed with PBS for 3 times. For cell apoptosis analysis, cells were labeled with Annexin V-Fluorescein Isothiocyanate (FITC)/propidium iodide (PI) according to manufacturer's instruction. Finally, cells were observed and photographed with the BD FACS Calibur flow cytometry system (Becton Dickinson, NJ, USA).
JC-1 staining
JC-1 staining was performed to assess the mitochondrial membrane potential (MMP) using a JC-1 assay kit (Beyotime, Shanghai, China) according to the operating instruction. Images were taken under a fluorescence microscope (Leica, Wetzlar, Germany). The ratio (%) of red/green fluorescence intensity was calculated by Image J software.
Western blot analysis
The anti-AP2M1, anti-cytochrome C and anti-cleaved caspase-3 antibodies were obtained from Abcam (Shanghai, China). The anti-Beclin 1, -p62, -LC3, bcl-2, -bax, -cleaved-caspase3 and GAPDH antibodies were obtained from Proteintech (Shanghai, China). Total proteins were extracted using RIPA-Buffer supplemented with 10 mM PMSF (Beyotime, Shanghai, China). Bicinchoninic acid assay (BCA) was carried out to quantify protein concentrations. The separation of 40 μg proteins was carried out on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to polyvinylidene fluoride (PVDF) membranes. Then, the membranes were blocked with 5% nonfat milk in Tris-buffered saline and 0.1% Tween 20, and incubated with primary antibodies at 4℃ overnight. Together with washing using TBST buffer for 5 times, the membranes were incubated with secondary antibodies for 2 h. Enhanced chemiluminescence (ECL) system kit (Beyotime, Shanghai, China) was employed for bands density. The optical densities (OD) value was analyzed by ImageJ software (NIH, Bethesda, MD, USA).
Immunofluorescence
BV173 and NALM6 cells were re-suspended to prepare cell suspension after treatment with the designated reagents. 40ul of cell suspension was dropped on coverslips. After that, the coverslips covered with cells were dried in an oven at 50℃, and then washed with PBS. Next, cell coverslips were fixed in 4% paraformaldehyde for 15min, and permeabilized with 0.2% Triton X-100 for 15
min. Subsequently, the cells were sealed with 5% BSA solution at 37 °C for 40 min, and then incubated with anti- AP2M1(Shanghai, China) primary antibodies at 37°C for 4 h.The cells were incubated with the Alexa Fluor®594 or 488 secondary antibodies (Abcam, Shanghai, China) at 37°C for 1 h and stained with DAPI for 3min. Finally, antifade mounting medium was placed on the slide and covered with a cell-coated glass sheet. The glass slides were observed by a fluorescence microscope (Leica, Wetzlar, Germany). Image J software 2.1 was used to measure the fluorescence intensity.
Confocal analysis
For confocal microscopy, the GFP-LC3 vector was transfected into the BV173 cells to generate a stable GFP-LC3 BV173 cell line. After treatment indicated, the GFP-LC3 BV173 cells were fixed in 4% paraformaldehyde for 15min. Subsequently, the cells were permeabilized using 0.05% TritonX-100, and stained with DAPI (Invitrogen, Eugene, OR, USA). In the end, the cells were examined and quantified using the AOBS confocal laser scanning (Leica, Wetzlar, Germany).
Xenograft model
Experiments were performed in BALB/c nu/nu mice (6 weeks old), which were obtained from Charles River Laboratories. A number of 3×106 BV173 cells transfected with AP2M1 siRNA in 100 μl PBS were subcutaneously injected into the posterior flank region of nude mice. The long diameter and short diameter of tumor were measured every 2 days, and calculated using the formula as follows: tumor volume = 0.5 × long diameter × short diameter2. The mice were treated with ALT every day after injection 15 days. Finally, the mice were sacrificed and excised the tumors.
Statistical analysis
SPSS 22.0 software (SPSS Inc., Chicago, IL, USA) were used to analyze all data for statistical significance. All the variables were presented as mean ± standard deviation (SD). One-way ANOVA followed by Tukey's Post hoc test was used to assess the difference between multiple groups. Differences between two groups were analyzed by the Student’s t-test. P<0.05 was considered as statistical significance.