MATERIALS AND METHODS
Rumen Fluid Collection
To inoculate the engineered rumen systems and collect daily samples for comparison to the artificial models, rumen content was collected from a rumen fistulated Holstein cow housed at the UC Davis Dairy Teaching and Research Facility. The donor animal was fed a dry cow total mixed ration composed of 46.7% wheat hay, 30% alfalfa hay, 20% almond hulls, and 3.3% mineral pellet (Supplemental Table S5). Rumen content collection was performed in accordance with the Institution of Animal Care and Use Committee (IACUC) at the University of California, Davis under protocol number 21117. Four liters of rumen fluid and 90 grams of rumen solids were collected prior to morning feeding on the first day of the experiment. Approximately 100 mL of rumen fluid was collected every morning in 24 hrs increments for five days from the same animal for comparative VFA and microbiome analysis with the in vitro and in vivo system. Rumen fluid collection was performed using a perforated PVC pipe, 500 mL syringe, and Tygon tubing (Saint-Gobain North America, PA, USA). Rumen fluid was immediately strained through a colander into two 4L pre-warmed vacuum insulated containers. Redox potential values and pH of the collected rumen content were recorded at the dairy, then containers were transported to the laboratory.
Feed Collection and Preparation
The same dry cow total mixed ration (TMR) fed to the donor Holstein cow was used as substrate in the in vitro rumen systems to control for diet differences. The feed was provided by and collected from the UC Davis Dairy Teaching and Research Facility with all components mixed as they are normally presented to the pen (Supplemental Table S5). Feed was ground in the laboratory using an Oster 14-Speed blender (SunBeam, Boca Raton, FL, USA), mixed, and subsequently dried at 55°C for 72 hrs using a Model 10 Quincy Lab Oven (Quincy Lab Inc, Chicago, IL, USA). Feed was stored in airtight containers at 4°C until use.
In vitro Rumen Systems
Three in vitro models (Fig. 7) simulating the rumen were set-up and run in parallel for 120 hrs in the laboratory. The first model was the Ankom RF Gas Production System (Ankom Technology RF Gas Production System, Macedon, NY) in a 300 mL vessel (Fig. 7A). The second was a semi-continuous fermentation system, using 1L Polypropylene (PP) vessels (Fig. 7B), based on the rumen simulation technique (RUSITEC) developed by Czerkawski and Breckenridge [21]. The third was a semi-continuous fermentation system, also based on the RUSITEC, in which the 1L PP vessels were replaced with vessels manufactured from tri-clamp food-grade stainless steel (Fig. 7C).
Experimental Design
Rumen fluid collected from the animal was used to inoculate all vessels of each model. Experiments in the Ankom-based systems and both RUSITEC-based systems were run in triplicate (Fig. 1).
Ankom Gas Production System
Each 300 mL vessel contained 150 mL of rumen fluid and 50 mL of an artificial saliva buffer [30] and received feed and solids at a ratio of 1g feed or solid per 75 mL of fluids, resulting in 2.67 g of rumen solids and 2.67 g of the ground dry cow TMR, in individual concentrate bags. Each vessel was fitted with an Ankom head unit, with a foil gas bag (Restek, Bellefonte, PA, USA) fitted to the pressure release valve to collect produced gases. Vessel content was kept at average rumen temperature by placing the vessels in a circulating water bath at 39°C.
RUSITEC, Polypropylene (PP) Vessels
Three PP RUSITEC vessels were each filled with 562.5 mL of rumen fluid and 187.5 mL of the artificial saliva buffer, totaling 750 mL. These vessels received 10 g of rumen solids and 10 g of the same dry cow TMR. Individual vessels were connected to a peristaltic pump administering 0.39 mL/min of artificial saliva buffer to each vessel throughout the experiment. Gas produced was captured in foil gas bags attached to each individual reactor. Effluent fluid was collected into individual overflow vessels and these overflow vessels were chilled in ice to prevent the production of additional fermentation products. RUSITEC vessels were incubated in a 39°C water bath and contents were mixed continuously via piston agitation to simulate rumen conditions.
RUSITEC Prime, Stainless-Steel Vessels
All three stainless steel RUSITEC vessels were incubated under the same conditions and received uniform amounts of rumen fluid, rumen solids, saliva buffer, and feed equal to the PP vessels mentioned above.
Sample Collection
pH, and conductivity measurements were taken every 24 hrs. Vessels were fed every 24 hrs and each feed bag remained in the designated vessel for a total of 48 hrs to simulate rumen retention time and ensure the fiber adherent fraction of the microbiome had sufficient time to transfer to the new feed. Liquid and gas samples were collected daily in 24 hrs increments post-feeding. Fluid samples from each vessel were collected in triplicate in 1.5 mL tubes, flash frozen in liquid nitrogen, and stored at -80°C until further processed. After each feeding and fluid collection, vessels were individually purged with N2 gas to maintain anaerobic conditions. Gas bags were also collected every 24 hrs for total gas production analysis, and CH4 and CO2 concentrations. Gas volumes were measured by manual expulsion of each bag through a flow meter (MGC-1 V3.3, Ritter, Bochum, Germany).
Volatile Fatty Acid and Greenhouse Gas Analysis
To analyze volatile fatty acid concentrations, rumen fluid samples were prepared by using 1/5th volume of 25% metaphosphoric acid and centrifuging. After centrifugation, the supernatant was filtered through a 0.22 µm filter and stored in autosampler vials at 4°C until analysis. The GC conditions were as follows: analytical column RESTEK Rxi® – 5 ms (30 m × 0.25 mm I.D. × 0.25 µm) film thickness; the oven temperature was set to 80°C for 0.50 min, and followed by a 20°C/min ramp rate until 200°C, holding the final temperature for 2 min; carrier gas was high purity helium at a flow rate of 2.0 mL/min, and the FID was held at 250°C. A 1µL sample was injected through Split/Splitless Injectors (SSL), with an injector base temperature set at 250°C. Split flow and split ratio were programmed at 200 and 100 mL/min respectively. To develop calibration curves, certified reference standards (RESTEK, Bellefonte, PA, USA) were used. All analyses were performed using a Thermo TriPlus Autosampler and Thermo Trace GC Ultra (Thermo Electron Corporation, Rodano Milan, Italy).
Methane and CO2 were measured using an SRI Gas Chromatograph (8610C, SRI, Torrance, CA) fitted with a 3’× 1/8′′ stainless steel Haysep D column and a flame ionization detector with methanizer (FID-met). The oven temperature was held at 90°C for 5 min. Carrier gas was high purity hydrogen at a flow rate of 30mL/min. The FID was held at 300°C. A 1mL sample was injected directly onto the column. Calibration curves were developed with an Airgas certified CH4 and CO2 standard (Airgas USA, Sacramento, CA, USA).
DNA Extractions
DNA extractions were performed with 300uL of each fluid sample using the FastDNA SPIN Kit for Soil (MP Biomedicals, Solon, OH, USA) following manufacturer’s directions. Extracted DNA quantity and quality were evaluated using a nanodrop (Thermo Scientific Nanodrop 2000, ThermoFisher Scientific, Pleasanton, CA, USA), then DNA was stored at -20°C until PCR amplification and sequencing.
PCR Amplification, Library Preparation, and Sequencing
Sequencing was done by the Environmental Sample Preparation and Sequencing Facility at Argonne National Laboratory (Lemont, IL, USA) according to the following protocol. Briefly, PCR amplicon libraries targeting the 16S rRNA encoding gene present in metagenomic DNA were produced using a barcoded primer set adapted for the Illumina HiSeq2000 and MiSeq [31]. DNA sequence data was generated using Illumina paired-end sequencing at the Environmental Sample Preparation and Sequencing Facility at Argonne National Laboratory. Specifically, the V4 region of the 16S rRNA gene (515F-806R) was PCR amplified with region-specific primers that include sequencer adapter sequences used in the Illumina flow cell [31, 32]. 515F: AATGATAC-GGCGACCACCGAGATCTACACGCTXXXXXXXXXXXXTATGGTAATTGTGTGYCAGCMGCCGCGTAA; 806R: CAAGCAGAAGACGGCATACGAGATAGTCAGCCAGCCGG-ACTACNVGGGTWTCTAAT. The forward amplification primer contained a twelve base barcode sequence to support pooling of up to 2,167 different samples in each lane [31, 32]. Each 25 µL PCR reaction contains 9.5 µL of MO BIO PCR Water (Certified DNA-Free, Mo bio, Carlsbad, CA, USA), 12.5 µL of QuantaBio’s AccuStart II PCR ToughMix (2x concentration, 1x final, (Quanta Bio, Beverly, MA, USA), 1 µL Golay barcode tagged Forward Primer (5 µM concentration, 200 pM final), 1 µL Reverse Primer (5 µM concentration, 200 pM final), and 1 µL of template DNA. The conditions for PCR are as follows: 94°C for 3 minutes to denature the DNA, with 35 cycles at 94°C for 45 s, 50°C for 60 s, and 72°C for 90 s; with a final extension of 10 min at 72°C to ensure complete amplification. Amplicons are then quantified using PicoGreen (Invitrogen, Waltham, MA, USA) and a plate reader (Infinite® 200 PRO, Tecan). Once quantified, volumes of each of the products are pooled into a single tube so that each amplicon is represented in equimolar amounts. This pool is then cleaned up using AMPure XP Beads (Beckman Coulter, Brea, CA, USA), and then quantified using a fluorometer (Qubit, Invitrogen, Waltham, Massachusetts). After quantification, the molarity of the pool is determined and diluted down to 2 nM, denatured, and then diluted to a final concentration of 6.75 pM with a 10% PhiX spike for sequencing on the Illumina MiSeq (Illumina, San Diego, CA, USA). Amplicons are sequenced on a 251bp x 12bp x 251bp MiSeq run using customized sequencing primers and procedures [31]. Genomic DNA was amplified using an ITS barcoded primer set, adapted for the Illumina HiSeq2000 and MiSeq [33]. ITS1f: AATGATACGGCGACCACCGAGATCTACACGGCTTGGTCATTTAGAGGAA-GTAA; ITS2: CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNCGGCTGCGTT-CTTCATCGATGC. The reverse amplification primer also contained a twelve base barcode sequence that supports pooling of up to 2,167 different samples in each lane [31, 32]. Each 25 µL PCR reaction contains 9.5 µL of MO BIO PCR Water (Certified DNA-Free), 12.5 µL of QuantaBio’s AccuStart II PCR ToughMix (2x concentration, 1x final), 1 µL Golay barcode tagged Forward Primer (5 µM concentration, 200 pM final), 1 µL Reverse Primer (5 µM concentration, 200 pM final), and 1 µL of template DNA. The conditions for PCR are also follows: 94°C for 3 minutes to denature the DNA, with 35 cycles at 94°C for 45 s, 50°C for 60 s, and 72°C for 90 s; with a final extension of 10 min at 72°C to ensure complete amplification. Amplicons were quantified using PicoGreen (Invitrogen) and a plate reader. Once quantified, different volumes of each of the products are pooled into a single tube so that each amplicon is represented equally. This pool is then cleaned up using AMPure XP Beads (Beckman Coulter, Indianapolis, ID, USA), and then quantified using a fluorometer (Qubit, Invitrogen, Waltham, MA, USA). After quantification, the molarity of the pool is determined and diluted down to 2 nM, denatured, and then diluted to a final concentration of 6.75 pM with a 10% PhiX spike for 2x251bp sequencing on the Illumina MiSeq.
Microbiome Analysis
Qiime2 2022.2 [34] was used to process the raw reads, assign taxonomy, and perform diversity analyses. Reads were demultiplexed and quality filtered using the q2-demux plugin [31]. DADA2 [35], along with R 4.1.3 [36], was used to denoise the quality filtered sequences and pair the 16S reads. Internal transcribed spacer sequences were ran unpaired with the forward reads only. Denoised sequences were aligned and sorted into amplicon sequence variants (ASVs) using MAFFT Fast Tree [37] and assigned taxonomy using SciKit-learn [38]. Bacterial 16S sequences were classified using the SILVA 138.1 database at 99% sequence identity [39] and fungal ITS sequences were classified using the UNITE V8.3 database at 99% sequence identity [40]. Faith’s PD and Pielou Evenness diversity analyses were calculated using the q2-diversity plugin [41] and the MAFFT Fast Tree output.