Cell line and cell culture
Glioma cell line U87 was purchased from American Type Culture Collection (ATCC), and cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin G, and 100 μg/ml streptomycin at 37℃ in a 5% CO2 incubator. In all experiments, U87 cells were trypsinized at 80% confluency.
Cell proliferation assay
The CCK-8 assay was used to determine cell proliferation ability. In brief, cells were seeded at a density of 1 ×103 cells/well in 96-well plates and incubated overnight at 37°C. IL-10 was then added into the culture medium. at the indicated time points (1, 2, 3, and 4 days), 10 μl of CCK-8 solution was added into the culture medium, and the cells were incubated for an additional 1.5 hours at 37°C. Then, the absorbance of each well was measured at 450 nm using a microplate reader. All experiments were performed in quintuplicate.
Cell invasion assay
Put 100 μl diluted matrigel into upper chamber of 24-well invasion chamber and incubate at 37℃ in a 5% CO2 atmosphere for 4-6 hours to hydrate the matrigel. Then 500 μl serum-free medium was added into bottom well for 30 minutes. Cells were resuspended in 100μl serum-free media at a density of 106 cells/ml, then cell suspension was added into upper chamber and 500μl completed medium was added into bottom well. After incubation overnight, cells on the upper surface of the filter membrane were scraped with cotton swabs, and those cells on the lower surface were fixed with polyoxymethylene for 30 minutes and stained with 0.1% crystal violet solution for 20 minutes. Five visual fields were randomly selected and photographed under a light microscope, and the invaded cells were counted.
RNA extraction and quantitative real-time polymerase chain reaction (qPCR)
Total RNA from U87 cells was extracted purified using RNA extraction kit according to the manufacturer’s protocol. Reserve transcription was performed to generate complementary DNA (cDNA) according to the manufacturer’s protocol. The mRNA level of KPNA2 was measured by qPCR using SYBR premix Ex Tap. The primers were used as follows:
β-actin forward, 5’- CCCGAGCCGTGTTTCCT -3’;
β-actin reserve, 5’- GTCCCAGTTGGTGACGATGC-3’;
kpna2 forward, 5’- TGATATGTCATCTTTAGCATGTGGC-3’;
kpna2 reserve, 5’- GCCCACACAGCTTCCTTTTG -3’;
β-actin was used as internal control. The relative mRNA expression of these genes were calculated using the 2-ΔΔCq method [34].
siRNA transfection
The siRNAs were purchased from Ribobio company (Guangzhou, China), and the sequence of siRNA for KPNA2 is as below:
siKPNA2-1: ATTTACAGTGCCCTGGTTG;
siKPNA2-2: ATGAACGAATTGGCATGGT;
siKPNA2-3: GCATGTGGCTACTTACGTA.
U87 cells were seeded in 6-well plates and cultured overnight. Next day, cells were transfected with three siRNA for KPNA2 at optimal concentration. Forty-eight hours later, cells were used for further experiments.
Statistical analysis
The Student’s t-test was used to quantify significant differences. GraphPad Prism 5 software was used for statistical analysis, Data are presented as the mean ± SD, and a value of P < 0.05 were considered statistically significant.