Hyperoside prevent Aβ42-induced neurotoxicity in PC12 cells and Caenorhabditis elegans

doi:10.21203/rs.3.rs-2200539/v1

Download PDF

Research Article

Hyperoside prevent Aβ42-induced neurotoxicity in PC12 cells and Caenorhabditis elegans

https://doi.org/10.21203/rs.3.rs-2200539/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Traditional Chinese medicines such as hyperoside-rich Acanthopanax senticosus and Crataegus pinnatifida have been confirmed to exhibit anti-oxidative stress properties. Hyperoside, the main ingredient of numerous antioxidant herbs, may have the ability to postpone the onset of neurodegenerative diseases This study investigates the possible therapeutic mechanism of hyperoside as a natural antioxidant against Alzheimer’s disease (AD) in Caenorhabditis elegans and PC12 cells. Specifically, hyperoside reduced reactive oxygen species (ROS) level and Aβ42-induced neurotoxicity in C. elegans worms. Meanwhile, hyperoside reduced ROS production and increased mitochondrial membrane potentialin Aβ42-induced PC12 cells, which possibly due to the increase of antioxidant enzymes activity and the diminution of malondialdehyde levels. Hoechst 33342 staining and real-time PCR results suggested that hyperoside reverses cell apoptosis. Network pharmacology predicts potentially relevant hypericin targets and pathways in AD therapy. As anticipated, hyperoside reversed Aβ42-stimulated downregulation of the PI3K/Akt/Nrf2/HO-1. The PI3K inhibitor LY294002 partially abolished the protective capability of hyperoside. The results of molecular docking further indicated that the PI3K/Akt pathways may be involved in the protection of Aβ42-induced PC12 cells by hyperoside treatment. The study provides theoretical information for research and development of hyperoside as an antioxidant dietary supplement.

Alzheimer’s disease

hyperoside

PC12 cells

apoptosis

oxidative stress

Alzheimer’s disease (AD) is the most general neurodegenerative diseases, manifested by senile plaques and cognitive impairment [1]. These plaques are composed of β-amyloid (Aβ), mainly Aβ40 and Aβ42 [2]. Paul et al. reported that Aβ40 is the most abundant, while Aβ42 aggregates more easily and possess stronger neurotoxicity [3]. Aβ induced neurotoxicity in neuronal cells has been considered as one of the crucial reasons in the development of AD [4]. The Aβ induced cytotoxicity could trigger redox impairment through producing reactive oxygen species (ROS), decreasing the mitochondrial membrane potential (ΔΨm), and inhibiting the activities of antioxidant enzymes [5, 6].

Moreover, increasing studies have confirmed that phosphoinositide 3-kinase/serine-threonine kinase (PI3K/AKT) pathway plays a key role in regulating cell proliferation, pro-apoptotic genes expression, and neuronal survival [7, 8]. Furthermore, PI3K/AKT pathway could activate antioxidant factors, such as nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1).

Hyperoside is a flavonoid existing in a variety of medicinal plants including Acanthopanax senticosus and Hypericum [9]. Recently, many studies have indicated that hyperoside possessed different biological activities such as inhibiting apoptosis, anti-oxidation, and anti-inflammatory etc [10, 11]. In addition, hyperoside suppressed neuroinflammation by inhibiting TNF-α/NF-κB/caspase-3 pathways in type 2 diabetes rats [12]. Thus, we hypothesis that hyperoside may be beneficial in the treatment of AD.

Network pharmacology is a novel analysis of biological systems based on traditional Chinese medicine [13]. In this study, network pharmacology offered integrative relationships between hyperoside and AD, potential therapeutic targets and pathways, which providing a novel direction for AD treatment. C. elegans has the advantage of tiny size, short lifespan, and well-established genetic tractability, which is crucial model organism for exploring neurodegenerative diseases such as AD [14]. Moreover, we used Aβ-induced PC12 cells and molecular simulation to further explore hyperoside’s potential molecular mechanism.

2.1 Chemicals and reagents

Hyperoside (98%) were purchased from Yuanye Biotechnology (Shanghai, China). Purified Aβ42 (> 95%) was synthesized from GL-Biochem (Shanghai, China). The JC-1 kit and Hoechst 33342 kit, 2’,7’-dichlorofluorescein diacetate (DCFH-DA), and LY294002 were acquired from Biyuntian (Shanghai, China). Lactate dehydrogenase (LDH), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA), catalase (CAT), and BCA protein assay kit were obtained from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). All antibodies were obtained from Cell Signaling Technology, Inc (USA).

2.2 Network pharmacological

The PharmMapper database (http://www.lilab-ecust.cn/) was used to obtain the target proteins corresponding to hyperoside. And the target proteins were converted to Gene Name via UniProt database (https://www.uniprot.org/). AD-related genes were searched from Gamecards database and screened by median method. Subsequently, the intersection of hyperoside acting genes and import AD-related genes into the STRING database (https://cn.string-db.org/) to construct a protein-protein interaction (PPI) network map. Gene Ontology (GO) and KEGG enrichment analysis (p < 0.05) were performed by the DAVID Web site (https://david.ncifcrf.gov/). The hyperoside-target gene-pathway network was constructed by Cytoscape 3.6.0.

2.3 Worms culture and phenotypic assays

The C. elegans strains in this study: CL4176 [smg-1(cc546) I], CL2355 [smg-1(cc546) dvIs50 I], and CL2122 (dvls15[(Ppd30.38) unc-54(vector) + (pCL26) mtl-2::GFP]). The worms were cultured on NGM plates with with Escherichia coli (OP50) at 16°C.

The worms were cultured on NGM (worm growth media) plates at 16ºC until they grown the L4 larvae according to the method of GRUBER et al.[15]. The worms were treated with different hyperoside (40, 80, and 120 µM) and final DMSO concentration was 0.1% in NGM plates.

CL4176 strain was used for the Aβ-induced ROS accumulation and paralysis assays, which was performed according to the previous method [16]. In brief, worms were cultured with or without hyperoside at 16ºC for 36 h and transferred to 25ºC to stimulate Aβ aggregation. Afterward, synchronized worms were randomly divided into two groups. One group was transferred to 25°C for 36 h in order to measure the ROS accumulation. In brief, the worms were rinsed 3 times with M9 buffer and then stained in 10 µM HDCF-DA for 1 h. Subsequently, the worms were carefully placed on the glass slide and intracellular ROS levels were observed with an inverted fluorescence microscope (Olympus CKX41, Japan). The other group was lived at 25°C for 30 h and then were calculated until they were paralyzed (one every 2 h). Worms were considered paralysed when they could move the head but not their entire body.

CL2355 and CL2122 strains were used for chemotaxis assay. The test was performed according to the previous method [17]. About 300 worms were cultured on NGM plates with or without hyperoside at different concentrations (40, 80, 120 µM) at 16°C for 36 h and then transferred to 23°C for another 36 h. Then the worms were washed in M9 buffer and transferred to test plates (diameter: 90 mm) at 25°C for 1 h. The attractant was 1 µL 0.1% benzaldehyde in 100% ethanol and the control odorant was 1 µL of 100% ethanol, they all contained 1 µL 1 M NaN₃. Chemotaxis Index (CI) was determined as follows: CI = (Nbenzaldehyde − Nethanol) / Total.

Learning ability assay was same as the chemotaxis assay. Worms were treated with or without hyperoside for 3 d and divided into naive and trained groups. The trained group of worms were removed to NGM plates with 2 µL of 10% butanone in 95% ethanol for 1 h. Then all groups were rinsed and transferred to test plates for 1 h. The test plates were 2 µL 10% butanone in 95% ethanol on one side, and 2 µL 95% ethanol on the other side. The learning index (LI) were determined as follows: LI = CI butanone – CI naive.

2.4 Cell culture and drug preparation

Cell cultures were performed according to the previous method [18]. PC12 cells (Cell Resource Center of Shanghai Institute) were grown in 1640 containing 1% streptomycin, 1% penicillin, 10% FBS, and 5% heat-inactivated horse serum at 37ºC with 5% CO₂ atmosphere.

Aβ42 fibrils were prepared according to the method of Liu et al.[19]. In short, Aβ42 peptide was dissolved in HFIP and the solution was left statically for 3 h at 4ºC, and then sonicated in an ice bath for 15 min. Centrifuge at 13,000g and collect supernatant and freeze dry. The lyophilized Aβ42 was then dissolved in 20 mM NaOH and incubated at 37ºC for 24 h to further use. Moreover, hyperoside stock solution (1 mM) was dissolved in DMSO and stored 4ºC until use.

2.5 Cell viability

PC12 cells were plated in 96-well plates at a density of 2 × 10⁴ cells/well. After 24 hours of incubation, different concentrations of hyperoside (10, 20, 30, 40, 50, and 60 µM), the aged Aβ42 solution (1.25, 2.5, 5, 10 µM), and the aged Aβ42 solution (2.5 µM) with or without hyperoside at different concentrations (10, 20, 30 µM) was added to the cells. Furthermore, in the experiment of PI3K inhibitor, 10 µM LY294002 to pretreat cells 1 h before stimulated hyperoside (30 µM). After 24 hours, cells were allowed to incubate in the MTT solution for 4 h. Then, MTT solution was removed and added 150 µL DMSO as mixed well by plate shaker. The absorbance was measured at 492 nm.

2.6 ROS assay and Hoechst 33342 Staining

Cellular ROS was monitored using DCFH-DA. Briefly, cells (2 × 10⁵ per well) were grown in 6-well plates with or without 2.5 µM the aged Aβ42 solution or different concentrations of hyperoside (10, 20, 30 µM) and after 24 h removing the old culture medium. The cells were treated with 10 µM DCFH-DA for 20 min at 37ºC and rinsed 3 times with 1640 solution. The ROS production was measured by inverted fluorescence microscope.

Chromatin condensation was determined Hoechst 33342. PC12 cells are plated in 6-well plates and stained with Hoechst 33342 solution for 5 min. Then the cells were visualized by inverted fluorescence microscope.

2.7 Determination of MDA, SOD, GSH-Px, CAT, and LDH

Cells were seeded in 6-well plates and treated with different concentrations of hyperoside and the aged Aβ42 solution as described for 24 h. Aspirate the supernatant, then cells were rinsed twice with PBS. Subsequently, cells were harvested with a scraper and lysed with an ultrasonic cell disruptor. The protein contents, MDA, SOD, GSH-Px, and CAT levels were detected by using commercial assay kits according to product manual.

Oxidative stress-stimulated cytotoxicity was assessed by measuring LDH released into the culture medium using the LDH Cytotoxicity Assay Kit. Absorbance was obtained at 450 nm.

2.8 MMP (ΔΨm) measurement

MMP (ΔΨm) was determined using JC-1 florescent probe following the manufacturer’s instructions. PC12 cells were treated in 6-well plates as described previously. The cells were incubated with JC-1 at 37ºC for 20 min in the dark, and rinsed twice with JC-1 staining buffer (1×). Then the cells were observed under an inverted fluorescence microscope.

2.9 Real-time PCR

mRNA was isolated and detected according to our previously research.[20] mRNA extraction of PC12 cells was extracted using Trizol reagent (Solarbio, China) and then mRNA was reverse transcribed to cDNA using AMV reverse transcriptase (TaKaRa, China). The forward and reverse primers of Bax, Bcl-2, Caspase-3, Caspase-9, and β-actin were displayed in Table 1. The β-actin expression was regarded as standard.

Table 1

The sequences of primers used for RT-PCR
Genes	Forward primer	Reveres primer
Bax	GGCGATGAACTGGACAACAAC	CCACACGGAAGAAGACCTCTC
Bcl-2	GGGCTACGAGTGGGATAC	AGGCTGGAAGGAGAAGATG
Caspase-3	GCTGGACTGCGGTATTGAGAC	GCGGTAGAGTAAGCATACAGGAAG
Caspase-9	CTGCCTCATCATCAACAAC	AGTCAGGTCGTTCTTCAC
β-actin	TATCGGCAATGAGCGGTTC	AGCACTGTGTTGGCATAGAG

2.10 Western blotting analysis

Extract protein according to previous studies [18]. Protein was separated by 7% SDS-PAGE, and the resulting protein bands were transferred to PVDF membranes. After that, the membrane was sealed with skimmed milk for 60 min. Then the membrane was incubated in primary antibody overnight for 10 h at 4ºC and washed 3 times for 8 min. The secondary antibody was incubated for 90 minutes and 150 µl of ECL Plus Chemiluminescence Reagent was added. The protein stripes were observed by the gel imaging analyzer (Japan), and measured by Image J.

2.11 Molecular simulation

2.11.1 Molecular docking

Molecular docking was performed to further research the interaction between hyperoside and PI3K protein. The structure of hyperoside were obtained from the Chemical Book Database (http://www.chemicalbook.com). In addition, the amino acid sequences of PI3K (UniProKB-A0A0G2K344) were retrieved from the UNIPROT Protein Database (http://uniprot.org) and then the protein 3D structure was predicted by SWISS-MODEL (https://swissmodel.expasy.org/) [21]. Moleular docking of hyperoside to proteins were performed using Discover Studio (version 3.5).

2.11.2 Molecular dynamics (MD) simulation

MD simulations were performed using GROMACS program with AMBER force field. The optimal conformation for the docking of PI3K protein and hyperoside were selected and the initial energy was minimized. The volume of the water box was 12 × 12 × 12 nm³ to cover the docking structure. The temperature was set to 310.15 K. MD simulations were performed in the range of 10 ns with a 2 fs time step to obtain the radius of gyration (Rg), root-mean-square deviation (RMSD), root mean square fluctuation (RMSF) and solvent accessible surface area (SASA).

2.12 Statistical analysis

All the experiments were repeated three times. Using one-way ANOVA (SPSS 19.0; SPSS Inc.) and Origin 2021 (Origin Lab Crop., MA, United States), statistical analysis and graphics were performed to identify significant differences between the levels of effects. A p value < 0.05 was considered significant.

3.1 Network Pharmacology

Protein–protein interaction network (Fig. 1a) showed 45 targets of hyperoside in the treatment of AD. Targets closer to the center of the network were more closely associated with treatment, including PIK3CA, AKT1, ESR1, EGFR. To further determine the pathways involved, KEGG and GO databases were used for enrichment analysis. The results based on KEGG analysis were shown in Fig. 1b, such as protactin, estrogen, AGE-RAGE, PI3K-Akt, apoptosis signaling pathway. The higher the ranking of pathways may show a better effect for the treatment of AD with hyperoside. The results based on GO analysis (p ≤ 0.01) were shown in Fig. 1c. GO enrichment analysis were grouped into three categories: biological process (BP), cellular component (CC), and molecular function (MF). Obviously, hyperoside treatment are mainly regulated by BP. Figure 1d shows the targets-signaling pathway network diagram of hyperoside. Red lable for hyperoside. PIK3CA, AKT1, MAPK10, and MAPK1 are crucial targets. Apoptosis, alzheimer disease, PI3K-Akt, and MAPK signaling pathway are crucial pathways. These results suggest possible mechanisms for hyperoside to treat AD.

3.2 Aβ-induced cytotoxicity in C. elegans

Aβ protein increases oxidative stress and ROS levels, which are closely related to the etiology of AD [22]. CL4176 worms, expressing Aβ gene, exposed in different concentrations (40, 80, and 120 µM) of hyperoside for subsequent experiments. Figure 2a-b show that hyperoside treatment reduced the content of ROS in CL4176 worms. As shown in Fig. 2c, the mean paralyzed time was increased by 3.40%, 9.40% and 17.16% in 40, 80, and 120 µM hyperoside groups than the untreated worms, respectively. The mean time duration at which 50% worms (PT50) was increased by 9.86%, 12.49%, and 25.52% in 40, 80, and 120 µM hyperoside groups verse the control group, respectively (Fig. 2b).

The behavioral phenotype of CL2355 worms that express Aβ42 protein in neurons has been usually used to study the protective effect of drugs against Aβ42-induced neurotoxicity in the chemotaxis assay. CL2122 worms do not express Aβ42 protein were selected as the vector control group, and showed no obvious difference in CI between the hyperoside treated and untreated groups. Compared with the control CL2122 worms, the CI of the untreated CL2355 worms were significantly lower, which illustrated that Aβ protein leaded to defects of chemotaxis behavior (Fig. 2c). However, hyperoside feeding at different concentrations (40, 80, and 120 µM) of CL2355 increased the CI to 0.19 ± 0.02, 0.22 ± 0.01 and 0.23 ± 0.02, respectively, compared with the CL2355 control group (0.13 ± 0.01). In addition, butanone-induced learning ability assay further confirmed the above results. As shown in Fig. 2C, no significant difference was found between the CL2122 worm groups. The LI of CL2355 was increased to 0.13 ± 0.01, 0.16 ± 0.02 and 0.19 ± 0.02 in 40, 80 and 120 µM hyperoside group than the control group (0.12 ± 0.01), respectively (Fig. 2c). These results suggested that hyperoside improved defective chemotaxis behavior of CL2355 worms by attenuating Aβ42-induced toxicity. This study confirmed that hyperoside attenuate Aβ42-induced neurotoxicity in a transgenic C. elegans in vivo.

3.3 Cell viability

The effects of Aβ42 and hyperoside on cell viability of PC12 cells were detected by MTT assay. The cell viability of Aβ42-induced PC12 cells compared to the control suppressed dramatically with different concentrations (1.25, 2.50, 5.00, and 10.00 µM for 24 h) (Fig. 3a). This experiment selected the Aβ42 concentration (2.5 µM) corresponding to approximate 67% cell viability as the PC12 cell injury modeling condition for further study. The different concentrations of hyperoside had no toxicity on PC12 cells (Fig. 3b). Hyperoside (10, 20 and 30 µM) improved Aβ42-induced cell viability in a dose-dependent manner (Fig. 3c), which is consistent with the results of concentration-dependent alleviation the Aβ-induced cytotoxicity in C. elegans. Additionally, LDH levels were dramatically raised, while hyperoside inhibited the LDH release (Fig. 3d).

3.4 Intracellular oxidative stress

The ROS played essential roles in Aβ42-induced neuron toxicity and AD pathogenesis [23, 24]. To further explore the effects of hyperoside on Aβ42-stimulated PC12 cells, the ROS contents were determined in PC12 cells. As in Fig. 4a, it was found that the ROS levels were increased dramatically in PC12 cells exposed to 2.5 µM Aβ42 compared with control cells. However, treatment with hyperoside (10, 20, and 30 µM) significantly reduced the ROS accumulation in Aβ42-stimulated PC12 cells verse the control cells. Furthermore, the ΔΨm was further observed. These results illustrated that hyperoside treatment dramatically decreased the green fluorescence, compared with the Aβ42 group (Fig. 4b), indicating that hyperoside alleviated the mitochondrial dysfunction induced by Aβ42 in PC12 cells.

3.5 Activities of antioxidant enzymes and the content of MDA

Aβ42 significantly lessened the activity of SOD, GSH-Px, and CAT and increased the content of MDA versus the control group. However, hyperoside treatment remarkably enhanced the activities of downregulated antioxidant enzymes in a dose-dependent manner (Fig. 4d-f). Meanwhile, MDA content was obviously increased (Fig. 5g). These results illustrated that hyperoside protected against Aβ42-induced oxidative damage.

3.6 Apoptosis analysis

Two methods were used to analyze the anti-apoptotic effects of hyperoside: (i) morphology of nucleus by Hoechst 33342 staining, (ii) gene expression of bax, bcl-2, caspase-3 and caspase-9. Aβ42 leaded to an enhancement in apoptosis and the Aβ42 group exhibited more bright fluorescence compared to control group. However, this phenomenon could be inhibited by hyperoside (Fig. 5a). The expression of pro- and anti-apoptotic genes were measured by RT-PCR, as presented in Fig. 5b-e. The expression of caspase-3, caspase-9 and bax elevated dramatically, whereas Aβ42 inhibited expression of bcl-2 versus the control group. The mRNA expression of caspase-3, caspase-9 and bax elevated dramatically, whereas Aβ42 inhibited mRNA expression of bcl-2 versus the control group. In the high-dose group (30 µM), a significant suppression in the mRNA contents of caspase-3, caspase-9 and bax was presented versus the Aβ42 group (p < 0.001). Moreover, cells cultured with high concentrations of hyperoside significantly increased in the expression of bcl 2 in compared to Aβ42 group (p < 0.001).

3.7 The critical effects of the PI3K/AKT and Nrf2/HO-1 signaling pathway

Accumulating research confirm that PI3K/AKT and Nrf2/HO-1 pathways are the vital pathways associated with oxidative stress [25]. Therefore, we measured the protein expression of p-PI3K, PI3K, p-Akt, Akt, nuclear Nrf2 and HO-1 by Western blot. Figure 6a shows that the protein levels of p-PI3K, p-AKT, nuclear Nrf2 and HO-1 were markedly suppressed after stimulation with Aβ42, compared to the control group. However, pretreatment with hyperoside (10, 20, and 30 µM) obviously elevated the p-PI3K, p-AKT, nuclear Nrf2 and HO-1 proteins in PC12 cells, compared to the Aβ42 group. These results indicated that hyperoside may exerts protective effects on Aβ42-induced PC12 cells via the PI3K/AKT/Nrf2/HO-1 pathway.

To further study whether the PI3K/AKT pathways play a key role in the protective effect of hyperoside and thus PI3K inhibitor LY294002 was used for the next step. Figure 6f shows that LY294002 (10 µM) significantly decreased the protective properties of hyperoside. Meanwhile, Fig. 6g shows that LY294002 group dramatically enhanced fluorescence compared to co-treatment of Aβ42 and hyperoside (30 µM). These results showed that PI3K/AKT pathways were essential, at least partially, in the protective effects of hyperoside on Aβ42-induced PC12 cells.

3.8 Molecular simulation analysis

The molecular docking results showed that ligand interacted at sites such as LYS264, GLU849, ASN170, LEU755, HIS670, and SER629, and exhibited strong binding ability to the related amino acid residues and PI3K-binding through hydrogen bonds (Fig. 7a). Moreover, the binding energy between hyperoside and PI3K protein was − 73.216 kcal/mol.

MD simulation was further investigated the dynamic behavior and binding properties of PI3K protein and hyperoside [26]. The Rg value represents the tightness of the protein structure [27]. The Rg value of hyperoside-PI3K complex stabilized at about 3.27 nm after 1000 ps, while the Rg value of free PI3K fluctuated widely during the first 5000 ps and then about 3.32 nm (Fig. 7b). The decrease in the Rg value of the complex indicated that the combination of hyperoside and PI3K make the protein structure tighter. RMSD value assesses complex conformational stability changes [28]. The RMSD values of hyperoside-PI3K complex and free PI3K continued to rise until 7000 ps and then the average RMSD value was about 0.32 nm, which shown that hyperoside bound protein does not cause a large fluctuation (Fig. 7c). RMSF value reflects the flexibility of individual amino acids in protein structure. As shown in Fig. 7d, the amino acid fluctuations of complex and free PI3K were relatively stable. This result was consistent with that of RMSD value. The SASA values of hyperoside-PI3K complex and free PI3K fluctuated within 5000 ps and leveled off after 5000 ps, reflecting that the binding of hyperoside enhanced the ability of protein-molecular interactions (Fig. 7e).

AD is a common neurodegenerative disease that occurs mostly in the elderly. One of the most common pathological features is cerebral β-amyloid deposits in the patient. The amyloid hypothesis proposes Aβ42-induced oxidative responses, which lead to neurotoxicity and cellular damage. Prior research indicates that natural antioxidants might be effective drugs against AD [29]. Hyperoside, a flavonol glycoside compound, is a natural antioxidant. In this study, we reported that hyperoside exhibited neuroprotective effects in vivo (the C. elegans model) and in vitro.

In vivo, Aβ42-induced oxidative stress contributes crucially to AD pathogenesis [30]. ROS, an important marker of oxidative stress, could be reduced by hyperoside in CL4176 worms. The expression of Aβ42 in body wall muscle cells is temperature-inducible, which leads to time-dependent paralysis of CL4176 worms [2]. In addition, the CL2355 worms expressing Aβ42 in neuronal cells is also commonly used to study Aβ-induced neurotoxicity [31]. As the temperature increased from 16 to 23°C, the CL2355 worms exhibited a defective chemotaxis behavior and a poorer learning ability. Hyperoside delayed the paralysis in CL4176 worms, improved the chemotaxis behavior and remedied learning ability in CL2355 worms. These results shown that hyperoside attenuated Aβ42-stimulated toxicity in transgenic C. elegans. This is in accordance with earlier literature that hyperoside treatment (400 mg/kg of body weight) improved cognitive dysfunction, learning and memory capacity in high-fat diet-induced diabetes mellitus rats [12]. The SAMP8-AD mouses model were orally fed dietary supplementation with flavonoids at 200 mg/kg doses once daily, which effectively improved learning and memory deficits [32].

In vitro, excessive ROS can cause oxidative stress and subsequent cell injury and apoptosis, which may be PC12 cells induced by exposure to Aβ42 [5]. The peroxidative damage of mitochondria is closely related to the high content of ROS, and MMP (ΔΨm) is an essential indicator of mitochondrial function and the apoptotic status [33]. This study found that hyperoside significantly reduced Aβ42-induced ROS levels and enhanced MMP (ΔΨm) in a concentration-dependent manner (p < 0.05). The SOD, GSH-Px, and CAT, which are important antioxidant enzymes that maintain intracellular redox balance [34]. MDA, a byproduct of lipid peroxidation that is a valuable indicator of intracellular oxidative stress. The activities of SOD, GSH-Px and CAT decreased and the MDA level increased in Aβ42-treated cells, however, hyperoside effectively reversed this phenomenon. These results indicated that hyperoside might be effective on protecting Aβ42-stimulated PC12 cells from oxidative stress. Similarly, the ethanol extracts of V. dunalianum, rich in flavonoid compound, could protect PC12 cells from H₂O₂-induced oxidative stress by increasing antioxidant enzyme activity and reducing MDA and ROS levels [35].

Network Pharmacology results showed that apoptosis is an important pathway of hyperoside in the AD treatment (Fig. 1d). The results of Hoechst 33342 staining demonstrated that Aβ42 led to an increase in apoptosis, and hyperoside treatment significantly ameliorated the adverse effects of Aβ42. Apoptosis is an extremely regulated process involving Bcl-2, Bax, caspase-3, and caspase-9 [36]. Bcl-2, an anti-apoptosis regulator protein, which plays a key role in the spontaneous apoptosis [37]. In contrast to the effects of Bcl-2, Bax is a pro-apoptotic protein in the Bcl-2 family [38]. The collapse of MMP increases mitochondrial permeability leading to release of cytochrome c into the cytoplasm then forms apoptosome, which triggers the caspase-9 and caspase-3 cascade activation, which promotes programmed cell death [39]. Hence, Aβ42-stimulated PC12 cells presented the enhancement of Caspase-3, Caspase-9 and Bax mRNA contents and suppressed mRNA expression of Bcl-2, which indicated that hyperoside may treat AD via regulating apoptosis. This is similar to a previous report which illustrate that hyperoside could effectively reverse inhibit H₂O₂-stimulated damage in PC12 cells regulating apoptosis-related genes [11]. In addition, Jia et al. reported that dihydromyricetin, a natural flavonoid from Ampelopsis grossedentata, attenuated Aβ40-induced neurotoxicity and apoptosis in PC12 cells [40].

Nrf2 can adaptive responses to oxidative stress or drug stimuli via activating transcription of many antioxidant genes, such as HO-1, which reduce ROS levels [41]. Nrf2 plays a key role in neuroprotection for AD [42]. Numerous studies have shown that the PI3K/Akt pathway is also inseparable from AD treatment [43]. In this study, KEGG pathway enrichment results also confirmed that PI3K/Akt pathway was significantly correlated with the treatment of hyperoside (Fig. 1d). In addition, Akt exerts antioxidant and cytoprotective effects through elevating the Nrf2 transcriptional activity, which reducing its interaction with antiapoptotic Bcl-2 family members [34]. For cells protection of from oxidative stress and apoptosis, the PI3K/Akt pathway is vital for regulating Nrf2/Ho-1 pathway activation. In the present study, hyperoside enhanced the protein contents of nuclear Nrf2 and HO-1 by decraesing the PI3K/Akt phosphorylation levels, which prevented Aβ42-stimulated apoptosis. In addition, the antiapoptotic effect of hyperoside was abolished via PI3K/Akt pathway inhibitor LY294002 and then prevented Nrf2/Ho-1 pathway. Recent literature reports reported that black bean flavonoid anthocyanins, as a natural plant antioxidant, exerted neuroprotective effects through the PI3K/Akt/Nrf2/HO-1 pathway in the APP/PS1 mouse model of AD and AβO-induced mouse hippocampal HT22 cells [44]. Moreover, Wang et al. confirmed that rutin (quercetin-3-O-rutinoside), a natural flavonoid glucoside, protects PC12 cells against sodium nitroprusside-stimulated damage by activating the PI3K/Akt pathway [45].

Molecular simulation is a modelling method for rapidly predicting the potential interaction of ligand (small molecules) and target receptors (proteins). Hyperoside can accurately bind to the essential regulator (P13K) in the P13K/Akt/Nrf2/Ho-1 pathways by hydrogen-bond interactions, which confirmed usefulness and dependability network pharmacology results. These results showed that hyperoside used to treat AD requires the P13K/Akt/Nrf2/Ho-1 pathways. In addition, the detailed regulatory mechanisms of hyperoside are needed to be further studied.

In summary, hyperoside showed a strong protective effect in C. elegans from Aβ42-stimulated neurotoxicity. Meanwhile, its protective effects of hyperoside on Aβ42-induced PC12 cells by inhibition of oxidative stress-induced apoptosis and activation of the P13K/Akt/Nrf2/Ho-1 pathways. These results show that hyperoside possesses a potential role in the prevention and treatment of AD and more in-depth research is necessary.

Acknowledgements:

The authors thank all the participants of the present study as well as all the members of staff of the State Key Laboratory of Food Nutrition and Safety.

Funding:

This work was supported by the open project of the Key Laboratory of Environmental Pollution Monitoring and Disease Control, Ministry of Education, Guizhou Medical University, China (No. GMU-2022-HJZ-06) and Tianjin Science and Technology Planning Project, Tianjin University of Science and Technology, China (No. 21ZYQCSY00050) and the Open Project Program of State Key Laboratory of Food Nutrition and Safety, Tianjin University of Science & Technology (No. SKLFNS-KF-202201)

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Author Contributions

All authors contributed to the study conception and design. Conceptualization were performed by Kexin Wang and Hao Wang. Methodology was performed by Kexin Wang, Qingbin Guo, and Xinyue Zhang. Formal analysis was performed by Kexin Wang and Xin Li. Investigation were performed by Kexin Wang, Xin Li, and Miaosi Zhang. Data curation were performed by Kexin Wang and Hao Wang. Writing—original draft preparation was performed by Kexin Wang. Writing—review and editing were performed by Kexin Wang, Suwen Liu, Qun Huang., Jiao Xie, and Hao Wang. Visualization was performed by Kexin Wang ang Jilite Wang. The authors have read and agreed to the published version of the manuscript.

Availability of data and materials：

All data generated or analysed during this study are included in this published article.

Ethics approval：

Not applicable to this study.

Consent to Participate:

Not applicable to this study.

Consent to Publication:

Not applicable to this study.

Launer LJ, Andersen K, Dewey ME, Letenneur L, Ott A, Amaducci LA, Brayne C, Copeland JR, Dartigues JF, Kragh-Sorensen P, Lobo A, Martinez-Lage JM, Stijnen T, Hofman A (1999) Rates and risk factors for dementia and Alzheimer's disease: results from EURODEM pooled analyses. EURODEM Incidence Research Group and Work Groups. European Studies of Dementia. Neurology 52 (1):78-84. doi:10.1212/wnl.52.1.78
Yang T, Zhu Z, Yin E, Wang Y, Zhang C, Yuan H, Zhang H, Jin S, Guo Z, Wang X (2019) Alleviation of symptoms of Alzheimer's disease by diminishing Abeta neurotoxicity and neuroinflammation. Chem Sci 10 (43):10149-10158. doi:10.1039/c9sc03042e
Paul A, Samantray S, Anteghini M, Khaled M, Strodel B (2021) Thermodynamics and kinetics of the amyloid-beta peptide revealed by Markov state models based on MD data in agreement with experiment. Chem Sci 12 (19):6652-6669. doi:10.1039/d0sc04657d
Chen J, Armstrong AH, Koehler AN, Hecht MH (2010) Small molecule microarrays enable the discovery of compounds that bind the Alzheimer's Abeta peptide and reduce its cytotoxicity. J Am Chem Soc 132 (47):17015-17022. doi:10.1021/ja107552s
Ren X, Zhang J, Zhao Y, Sun L (2022) Senegenin Inhibits Abeta1-42-Induced PC12 Cells Apoptosis and Oxidative Stress via Activation of the PI3K/Akt Signaling Pathway. Neuropsychiatr Dis Treat 18:513-524. doi:10.2147/NDT.S346238
Gao L, Zhou F, Wang KX, Zhou YZ, Du GH, Qin XM (2020) Baicalein protects PC12 cells from Abeta25-35-induced cytotoxicity via inhibition of apoptosis and metabolic disorders. Life Sci 248:117471. doi:10.1016/j.lfs.2020.117471
Nan F, Sun G, Xie W, Ye T, Sun X, Zhou P, Dong X, Sun J, Sun X, Zhang M (2019) Ginsenoside Rb1 mitigates oxidative stress and apoptosis induced by methylglyoxal in SH-SY5Y cells via the PI3K/Akt pathway. Mol Cell Probes 48:101469. doi:10.1016/j.mcp.2019.101469
Zhang C, Li C, Chen S, Li Z, Jia X, Wang K, Bao J, Liang Y, Wang X, Chen M, Li P, Su H, Wan JB, Lee SMY, Liu K, He C (2017) Berberine protects against 6-OHDA-induced neurotoxicity in PC12 cells and zebrafish through hormetic mechanisms involving PI3K/AKT/Bcl-2 and Nrf2/HO-1 pathways. Redox Biol 11:1-11. doi:10.1016/j.redox.2016.10.019
Zou Y, Lu Y, Wei D (2004) Antioxidant activity of a flavonoid-rich extract of Hypericum perforatum L. in vitro. J Agric Food Chem 52 (16):5032-5039. doi:10.1021/jf049571r
Sun K, Luo J, Jing X, Xiang W, Guo J, Yao X, Liang S, Guo F, Xu T (2021) Hyperoside ameliorates the progression of osteoarthritis: An in vitro and in vivo study. Phytomedicine 80:153387. doi:10.1016/j.phymed.2020.153387
Feng Y, Wang DX, Wang Q, Li ZF, Yang SL, Feng YL, Luo T, Li Y (2021) Protective Effects and Mechanism of Hyperoside in PC12 Cells Against Oxidative Stress Injury Induced by Hydrogen Peroxide. Nat Prod Commun 16 (5):1934578X211015126. doi:10.1177/1934578x211015126
Chen X, Famurewa AC, Tang J, Olatunde OO, Olatunji OJ (2022) Hyperoside attenuates neuroinflammation, cognitive impairment and oxidative stress via suppressing TNF-alpha/NF-kappaB/caspase-3 signaling in type 2 diabetes rats. Nutr Neurosci 25 (8):1774-1784. doi:10.1080/1028415X.2021.1901047
Li S, Zhang B (2014) Traditional Chinese medicine network pharmacology: theory, methodology and application. Chinese Journal of Natural Medicines 11 (2):110-120. doi:10.3724/sp.J.1009.2013.00110
Sonnhammer EL, Durbin R (1997) Analysis of protein domain families in Caenorhabditis elegans. Genomics 46 (2):200-216. doi:10.1006/geno.1997.4989
Gruber J, Tang SY, Halliwell B (2007) Evidence for a trade-off between survival and fitness caused by resveratrol treatment of Caenorhabditis elegans. Ann N Y Acad Sci 1100:530-542. doi:10.1196/annals.1395.059
Ge Y, Chen H, Wang J, Liu G, Cui SW, Kang J, Jiang Y, Wang H (2021) Naringenin prolongs lifespan and delays aging mediated by IIS and MAPK in Caenorhabditis elegans. Food Funct 12 (23):12127-12141. doi:10.1039/d1fo02472h
Chen X-y, Liao D-c, Sun M-l, Cui X-h, Wang H-b (2020) Essential Oil of Acorus tatarinowii Schott Ameliorates Aβ-Induced Toxicity in Caenorhabditis elegans through an Autophagy Pathway. J Oxidative medicine cellular longevity 2020. doi:10.1155/2020/3515609
Cheng J, Liu D, Zhao J, Li X, Yan Y, Wu Z, Wang H, Wang C (2019) Lutein attenuates oxidative stress and inhibits lipid accumulation in free fatty acids-induced HepG2 cells by activating the AMPK pathway. Journal of Functional Foods 60. doi:10.1016/j.jff.2019.103445
Liu F, Wang W, Xuan Z, Jiang L, Chen B, Dong Q, Zhao F, Cui W, Li L, Lu F (2021) Fast green FCF inhibits Abeta fibrillogenesis, disintegrates mature fibrils, reduces the cytotoxicity, and attenuates Abeta-induced cognitive impairment in mice. Int J Biol Macromol 170:33-41. doi:10.1016/j.ijbiomac.2020.12.115
Wang HL, Sun ZO, Rehman RU, Wang H, Wang YF, Wang H (2017) Rosemary Extract-Mediated Lifespan Extension and Attenuated Oxidative Damage in Drosophila melanogaster Fed on High-Fat Diet. J Food Sci 82 (4):1006-1011. doi:10.1111/1750-3841.13656
Shanmugam G, Mohankumar A, Kalaiselvi D, Nivitha S, Murugesh E, Shanmughavel P, Sundararaj P (2017) Diosgenin a phytosterol substitute for cholesterol, prolongs the lifespan and mitigates glucose toxicity via DAF-16/FOXO and GST-4 in Caenorhabditis elegans. Biomed Pharmacother 95:1693-1703. doi:10.1016/j.biopha.2017.09.096
Cenini G, Lloret A, Cascella R (2019) Oxidative Stress in Neurodegenerative Diseases: From a Mitochondrial Point of View. Oxid Med Cell Longev 2019:2105607. doi:10.1155/2019/2105607
Shuster SO, Fica-Contreras SM, Hedges JS, Henning NJ, Choi S (2020) Comparison of the reaction of methylglyoxal (MGO) with murine and human amyloid beta (Abeta): Insights into a mechanism of Alzheimer's disease (AD). Biochem Biophys Res Commun 533 (4):1298-1302. doi:10.1016/j.bbrc.2020.10.008
Jiang S, Zhao Y, Zhang T, Lan J, Yang J, Yuan L, Zhang Q, Pan K, Zhang K (2018) Galantamine inhibits beta-amyloid-induced cytostatic autophagy in PC12 cells through decreasing ROS production. Cell Prolif 51 (3):e12427. doi:10.1111/cpr.12427
Fetoni AR, Paciello F, Rolesi R, Eramo SL, Mancuso C, Troiani D, Paludetti G (2015) Rosmarinic acid up-regulates the noise-activated Nrf2/HO-1 pathway and protects against noise-induced injury in rat cochlea. Free Radic Biol Med 85:269-281. doi:10.1016/j.freeradbiomed.2015.04.021
Santana DVS, Trindade IAS, Carvalho Y, Carvalho-Neto AG, Silva ECD, Silva-Junior EF, Leite RFS, Quintans-Junior LJ, Aquino TM, Serafini MR, Guterres SS, Scotti L, Scotti MT, Araujo AAS, Frank LA, Menezes PP (2021) Analytical techniques to recognize inclusion complexes formation involving monoterpenes and cyclodextrins: A study case with (-) borneol, a food ingredient. Food Chem 339:127791. doi:10.1016/j.foodchem.2020.127791
Woolf TB, Roux B (1996) Structure, energetics, and dynamics of lipid–protein interactions: a molecular dynamics study of the gramicidin A channel in a DMPC bilayer. Proteins: Structure, Function, Bioinformatics 24 (1):92-114. doi:10.1002/(SICI)1097-0134(199601)24:1<92::AID-PROT7>3.0.CO,2-QCitations: 231
Bian L, Chung HJ (2016) Molecular structure and physicochemical properties of starch isolated from hydrothermally treated brown rice flour. Food Hydrocolloid 60:345-352. doi:10.1016/j.foodhyd.2016.04.008
Li RL, Zhang Q, Liu J, Sun JY, He LY, Duan HX, Peng W, Wu CJ (2020) Hydroxy-alpha-sanshool Possesses Protective Potentials on H2O2-Stimulated PC12 Cells by Suppression of Oxidative Stress-Induced Apoptosis through Regulation of PI3K/Akt Signal Pathway. Oxid Med Cell Longev 2020:3481758. doi:10.1155/2020/3481758
Butterfield DA, Swomley AM, Sultana R (2013) Amyloid beta-peptide (1-42)-induced oxidative stress in Alzheimer disease: importance in disease pathogenesis and progression. Antioxid Redox Signal 19 (8):823-835. doi:10.1089/ars.2012.5027
Liu H, Qian C, Yang T, Wang Y, Luo J, Zhang C, Wang X, Wang X, Guo Z (2020) Small molecule-mediated co-assembly of amyloid-beta oligomers reduces neurotoxicity through promoting non-fibrillar aggregation. Chem Sci 11 (27):7158-7169. doi:10.1039/d0sc00392a
Jin G, Bai D, Yin S, Yang Z, Zou D, Zhang Z, Li X, Sun Y, Zhu Q (2016) Silibinin rescues learning and memory deficits by attenuating microglia activation and preventing neuroinflammatory reactions in SAMP8 mice. Neurosci Lett 629:256-261. doi:10.1016/j.neulet.2016.06.008
Zhao J, Zou M, Huang M, Zhang L, Yang K, Zhao S, Liu YM (2020) A multifunctional nanoprobe for targeting tumors and mitochondria with singlet oxygen generation and monitoring mitochondrion pH changes in cancer cells by ratiometric fluorescence imaging. Chem Sci 11 (14):3636-3643. doi:10.1039/d0sc00757a
Wang G, Wang Y, Yang Q, Xu C, Zheng Y, Wang L, Wu J, Zeng M, Luo M (2022) Metformin prevents methylglyoxal-induced apoptosis by suppressing oxidative stress in vitro and in vivo. Cell Death Dis 13 (1):29. doi:10.1038/s41419-021-04478-x
Gao SH, Zhao TR, Liu YP, Wang YF, Cheng GG, Cao JX (2022) Phenolic constituents, antioxidant activity and neuroprotective effects of ethanol extracts of fruits, leaves and flower buds from Vaccinium dunalianum Wight. Food Chem 374:131752. doi:10.1016/j.foodchem.2021.131752
Zhang D, Ma Q, Wang Z, Zhang M, Guo K, Wang F, Wu E (2011) β2-adrenoceptor blockage induces G1/S phase arrest and apoptosis in pancreatic cancer cells via Ras/Akt/NFκB pathway. Molecular cancer 10 (1):1-9. doi:10.1186/1476-4598-10-146
Llobet-Navas D, Rodriguez-Barrueco R, Castro V, Ugalde AP, Sumazin P, Jacob-Sendler D, Demircan B, Castillo-Martin M, Putcha P, Marshall N, Villagrasa P, Chan J, Sanchez-Garcia F, Pe'er D, Rabadan R, Iavarone A, Cordon-Cardo C, Califano A, Lopez-Otin C, Ezhkova E, Silva JM (2014) The miR-424(322)/503 cluster orchestrates remodeling of the epithelium in the involuting mammary gland. Genes Dev 28 (7):765-782. doi:10.1101/gad.237404.114
Kolli MB, Manne N, Para R, Nalabotu SK, Nandyala G, Shokuhfar T, He K, Hamlekhan A, Ma JY, Wehner PS, Dornon L, Arvapalli R, Rice KM, Blough ER (2014) Cerium oxide nanoparticles attenuate monocrotaline induced right ventricular hypertrophy following pulmonary arterial hypertension. Biomaterials 35 (37):9951-9962. doi:10.1016/j.biomaterials.2014.08.037
Xi H, Zhang Y, Xu Y, Yang WY, Jiang X, Sha X, Cheng X, Wang J, Qin X, Yu J, Ji Y, Yang X, Wang H (2016) Caspase-1 Inflammasome Activation Mediates Homocysteine-Induced Pyrop-Apoptosis in Endothelial Cells. Circ Res 118 (10):1525-1539. doi:10.1161/CIRCRESAHA.116.308501
Jia L, Zhao W, Sang J, Wang W, Wei W, Wang Y, Zhao F, Lu F, Liu F (2019) Inhibitory Effect of a Flavonoid Dihydromyricetin against Abeta40 Amyloidogenesis and Its Associated Cytotoxicity. ACS Chem Neurosci 10 (11):4696-4703. doi:10.1021/acschemneuro.9b00480
Nakano-Kobayashi A, Fukumoto A, Morizane A, Nguyen DT, Le TM, Hashida K, Hosoya T, Takahashi R, Takahashi J, Hori O, Hagiwara M (2020) Therapeutics potentiating microglial p21-Nrf2 axis can rescue neurodegeneration caused by neuroinflammation. Sci Adv 6 (46):eabc1428. doi:ARTN eabc142810.1126/sciadv.abc1428
Dong Y, Stewart T, Bai L, Li X, Xu T, Iliff J, Shi M, Zheng D, Yuan L, Wei T, Yang X, Zhang J (2020) Coniferaldehyde attenuates Alzheimer's pathology via activation of Nrf2 and its targets. Theranostics 10 (1):179-200. doi:10.7150/thno.36722
Kumar M, Bansal N (2022) Implications of Phosphoinositide 3-Kinase-Akt (PI3K-Akt) Pathway in the Pathogenesis of Alzheimer's Disease. Molecular Neurobiology 59 (1):354-385. doi:10.1007/s12035-021-02611-7
Ali T, Kim T, Rehman SU, Khan MS, Amin FU, Khan M, Ikram M, Kim MO (2018) Natural Dietary Supplementation of Anthocyanins via PI3K/Akt/Nrf2/HO-1 Pathways Mitigate Oxidative Stress, Neurodegeneration, and Memory Impairment in a Mouse Model of Alzheimer's Disease. Mol Neurobiol 55 (7):6076-6093. doi:10.1007/s12035-017-0798-6
Wang R, Sun Y, Huang H, Wang L, Chen J, Shen W (2015) Rutin, A Natural Flavonoid Protects PC12 Cells Against Sodium Nitroprusside-Induced Neurotoxicity Through Activating PI3K/Akt/mTOR and ERK1/2 Pathway. Neurochem Res 40 (9):1945-1953. doi:10.1007/s11064-015-1690-2

Graphicalabstract.png

Download PDF

Version 1

posted

You are reading this latest preprint version

Hyperoside prevent Aβ42-induced neurotoxicity in PC12 cells and Caenorhabditis elegans

Status:

Version 1

Abstract

Figures

1. introduction

2. Materials And Methods

2.1 Chemicals and reagents

2.2 Network pharmacological

2.3 Worms culture and phenotypic assays

2.4 Cell culture and drug preparation

2.5 Cell viability

2.6 ROS assay and Hoechst 33342 Staining

2.7 Determination of MDA, SOD, GSH-Px, CAT, and LDH

2.8 MMP (ΔΨm) measurement

2.9 Real-time PCR

2.10 Western blotting analysis

2.11 Molecular simulation

2.12 Statistical analysis

3. Results

3.1 Network Pharmacology

3.2 Aβ-induced cytotoxicity in C. elegans

3.3 Cell viability

3.4 Intracellular oxidative stress

3.5 Activities of antioxidant enzymes and the content of MDA

3.6 Apoptosis analysis

3.7 The critical effects of the PI3K/AKT and Nrf2/HO-1 signaling pathway

3.8 Molecular simulation analysis

4. Discussion

5. Conclusion

Declarations

References

Supplementary Files

Status:

Version 1