Establishment of recombinase polymerase amplification detection method for Puccinia striiformis f. sp. Tritici

doi:10.21203/rs.3.rs-2213303/v1

Download PDF

Research Article

Establishment of recombinase polymerase amplification detection method for Puccinia striiformis f. sp. Tritici

https://doi.org/10.21203/rs.3.rs-2213303/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Wheat stripe rust caused by Puccinia striiformis f. sp. tritici(Pst)is an airborne disease that endangers the entire growth period of wheat. In this study, the effect of gene PS4593 of Pst was used as the target gene, that PS4593 effector genes have significant virulence functions in wheat, this effector gene could suppress wheat ETI against an avirulent Pst isolate, and the primers PS-RPA-F and PS-RPA-R, as well as the probe PS-LF-Probe, were designed for recombinase polymerase amplification (RPA) technology. Flow chromatography was combined with the process to establish an RPA detection method for Pst. This method could establish visual detection within 10 min under a constant temperature of 39°C, and the detection results were consistent with those of ordinary PCR analysis. This method only had high specificity for Pst, and the detection limit was 10 fg/µL. In addition, this rapid method could detect Pst from wheat leaves during the field incubation period, which has strong benefits in application. In sum, the RPA detection method established in this study has the favorable characteristics of high efficiency, simple functionality, and rapid and universal practicability, which provides a theoretical basis for the early detection and prevention of Pst.

Puccinia striiformis f. sp. Tritici

recombinant enzyme polymerase

PS-LF-Probe. practicality

Wheat (Triticum aestivum L.) is the second-largest food crop in China and is one of the most important cereals grown in arid and semi-arid regions. It provides 20% of the total calorie and protein intake in the human diet. However, the mass occurrence of wheat diseases caused by phytopathogens is a critical factor that can negatively impact the yields of wheat (Shiferaw et al., 2013; Boamash et al., 2021). In recent years, wheat stripe rust caused by Puccinia striiformis f. sp. tritici (Pst) has caused great damage to wheat production. Wheat stripe rust is a disease that can occur in plants from the seedling stage to maturity, as the Pst urediospores infect wheat leaves and causes them to be unable to photosynthesize normally, which in turn affects wheat yield (Hovmøller, 2010). Currently, the detection of Pst is mainly accomplished by real-time quantitative fluorescent PCR (Pan et al., 2010), LAMP detection (Aggarwal et al., 2017), the molecular labeling method (Shan et al., 1995; Xi et al., 2021), or ordinary PCR detection methods. However, these technologies impose stringent requirements on personnel and equipment and place high demands on the laboratory environment. A rapid and simple detection procedure to detect Pst has traditionally been difficult to develop.

Recombinase polymerase amplification (RPA) offers a rapid and highly specific isothermal alternative to PCR (Chao et al., 2014). The technology mainly uses recombinase, single-stranded binding protein, and strand displacement polymerase to specifically recognize and amplify the template at any constant temperature within 25 ~ 43℃. The final target product can be visualized on RPA (lateral flow dipstick, LFD) by adding specific probes (Gamze et al., 2020; Kalantar et al., 2011; Lu et al., 2020). Since RPA technology has a fast amplification speed, strong specificity, high sensitivity, and low environmental conditions, it has been used for the detection of citrus yellow pulse virus, broad bean virus, citrus leaf spot virus, wheat blight, and wheat sheath rot of various pathogens (Ma et al., 2021; Qin et al., 2021; Duan et al., 2021; Ju et al., 2020; Ju et al., 2020). However, the detection of Pst has not yet been reported.

In this experiment, a wheat stripe rust effector gene was used as the target gene, specific RPA primers and probes were designed and combined with lateral flow layer test strips, and an RPA-LFD rapid detection system for Pst was established. This system was used to detect Wheat stripe rust in the field and provides a theoretical basis for the early prevention of Pst.

Test materials and reagents

Test pathogens: Puccinia striiformis f. sp. tritici races CYR32, CYR33, CYR34; isolates of Pst; Puccinia graminis Pers tritici Eriks and E Henn; Puccinia recondita, Blumeria graminis f. sp. tritici, Puccinia striiformis West. f. sp., Puccinia recondita. f. sp. agropyri. The pathogens were provided by the Key laboratory of Comprehensive Management of Agricultural Pests of Qinghai province, and the college of plant protection, Northwest A&F University.

Test materials: Mingxian 169 wheat seedling leaves were collected from the Dashijia, Heerjia, and Chada villages in Guide County, the Shangduoba, Xiaduoba, Xingfu, and Longshang villages in Hualong County, Ahetan village in Xunhua County, Baiwujia village in Minhe County, the Kangjia, Hanjia, Baojia, Maojiazhai and Benkang villages in Datong County, Gelong village in Huzhu County, Xiakou village in Ledu Country, and Jianzha County in Yangjiacun (Fig. 1). There was a distance of at least 50 m between samples in a single wheat field to avoid duplication of any original isolate during the season.

Reagents: RAA-nfo nucleic acid amplification reagent (type test strip) was acquired from Qinghai Baisai Trading Co., Ltd.; HybriDetect was purchased from Milenia Biotec Versailler Straße, Gießen Milenia; Premix Ex TaqTM Ⅱ was purchased from TaKaRa; all primers used were synthesized by Shanghai Sangon Biotech Co., Ltd.

Extraction Of Pathogenic Bacteria Dna

Extraction of pathogenic bacteria DNA

Wheat stripe rust samples were stored at 4°C in a desiccator. There were 10 blades of Mingxian 169, and 30 blades of each sample at each sampling point. The genomic DNA of Pst and other control pathogens was extracted using the CTAB method (Wang et al., 2015). The concentration of the obtained DNA was measured using a NanoDropTM One ultra-micro ultraviolet spectrophotometer and the DNA integrity was checked using 2% agarose gel. It was stored at -80℃ until use.

Rpa Reaction System Establishment

Preparation began by adding 40.9 µL of buffer A, 2 µL of forward and reverse primers (10 µmol/L), and 0.6 µL of probe (10 µmol/L) to the detection tube containing the test dry enzyme preparation, then 2.0 µL of the test sample DNA and 2.5 µL of buffer B were added. This was mixed thoroughly by inverting the tube 5–6 times, then the solution was centrifuged at a low speed for 10 seconds. The PE tube was then placed in a water bath at a constant temperature of 39°C and incubated for 10 min. After the reaction, 50 µL DNA extract (volume ratio = 24:25:1) was added for extraction, the tube was centrifuged at 12000 rpm for 5 min and the supernatant was collected. Finally, 20–40 µL of the supernatant was diluted 20–50 times with sterile water or PBS, resulting in a dilution volume that was not less than 100 µL.

The Ordinary Pcr Reaction System

A specific primer of Pst, PS4F/PS4R, was used for ordinary PCR detection. The reaction system was as follows: MasterMix 12.5 µL, primers (10 µmol/L) 1µL each, template 1µL, and ddH₂O 9.5µL. The amplification program was as follows: 95℃ pre-denaturation 3 min, 95℃ denaturation 1 min, 67.2℃ annealing 30 s, 72℃ extension 1 min, 35 cycles; extension 72℃, 5 min; storage at 4℃. A sample of 4 µL was taken for electrophoresis.

Design Of Rpa Primers And Probes

In this study, the Pst effector gene PS4593 was used as the target gene sequence (GeneBank: XM_003319396) (Cheng 2015; Coram 2011) in conjunction with the characteristics of RPA primers, and eight sets of primer pairs were designed using Primer 3.0 online software (Table 1). CYR32 was selected as the source of Pst and RPA flow test paper and conventional PCR detection were used to select specific fragments of Pst. The PCR stock solution was sequenced and analyzed in NCBI, and the primers with low homology were selected. The fragment design probe, sequencing, and primer design were performed by Shanghai Sangon Biological Engineering Co., Ltd.

Table 1

recombinase polymerase amplification (RPA) primer sequence
Primer	Seqence
PS1F	catgtaaagaagtgatgagtgtaggaggag
PS1R	cgaaaagaatgactaggtgaagaattggag
PS2F	tcaagttctgccgatcacaccttttatttc
PS2R	gatatctaagatggtcctagaatcctgagg
PS3F	ctccaattcttcacctagtcattcttttcg
PS3R	cttgtgtctttgtagttcctgttgtacgag
PS4F	cttgtgtctttgtagttcctgttgtacgag
PS4R	cgagtggaagaaatggagaaagtcgttatc
PS5F	catgtaaagaagtgatgagtgtaggaggag
PS5R	gagagaaaggactgaagtgaagggaagaag
PS6F	cttcacttcagtcctttctctcctcattcc
PS6R	gatacgacaatcttttccaattccttgctg
PS7F	tgatccatctccgagacatgttgaattttc
PS7R	ggcacagtcagatacaaagctagaaactga
PS8F	cgtgacttctccgacaaattttctttcctc
PS8R	gaatgaggagagaaaggactgaagtgaagg

RPA specific detection of Puccinia striiformis f. sp. tritici

In this study, the physiological races CYR32, CYR33, and CYR34 of Pst were selected, they are currently the main popular physiological species of Pst in wheat production in China, and the above physiological races have been identified by Chinese differential hosts of Pst, which were composed of 19 wheat varieties; isolates of Puccinia striiformis f. sp. tritici; Puccinia graminis Pers tritici Eriks and E Henn; Puccinia recondita; Blumeria graminis f. sp. Tritici; Puccinia striiformis West. f. sp.; Puccinia recondita. f. sp. agropyri. Wheat gDNA served as the control bacteria, and water was used as the negative control. PS-RPA-F, PS-RPA-R primers, and probe PS-LF-Probe were used to test the specificity of RPA, which was verified by conventional PCR.

RPA-sensitivity testing of Puccinia striiformis f. sp. tritici

A 1 µL sample of CYR33 gDNA was taken and 10-fold serial dilution was conducted to obtain the appropriate concentration as follows: 100 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10pg/µL, 1 pg/µL, 100 fg/µL and 10 fg/µL, 1 fg/µL, and ultimately, 100 ag/µL. The RPA test and an ordinary PCR test were performed, and the results were compared.

Detection of Puccinia striiformis f. sp. tritici isolates

Wheat volunteer seedlings and late-autumn seedlings were collected in the Datong and Huzhu Counties of Qinghai Province. Pst had occurred in the standard samples. The obvious urediospores of Pst appeared on the leaves, but the physiological races of the standard samples were not determined. RPA and PCR analyses were performed to assess the presence of mixed bacteria.

The Practicality Of Rpa Testing System

Mingxian 169 wheat leaves were inoculated with CYR34, and samples were taken after 24 h of humidification culture at 5–10°C between inoculations. After 1 to 8 d, leaves were collected to extract DNA. Historically, the Guide, Xunhua, Hualong, and Minhe counties frequently suffer from wheat stripe rust outbreaks (Yao et al., 2018). The diseased plants were marked in late November 2020 and the marked seedling leaves were collected at the end of March 2021, when no Pst uredospore had appeared on the surface of the leaves. Twenty-one leaf samples were collected for DNA extraction and stored at -80℃. RPA detection and conventional PCR detection methods were used to detect whether the samples were infected with Pst.

Primer screening and probe design

The resulting eight primer sets were used for RPA detection and agarose gel electrophoresis. The results showed that RPA PS4 primers produced detection bands, while other primer pairs produced only quality control bands. The electrophoresis gel detection results also showed that the PS4 primer pair could amplify a 300 bp target band, primer PS1 produced multiple non-target fragments, and primers PS2 ~ 3 and PS5 ~ 8 produced obvious primer dimers. Therefore, primer set PS4 was selected as the primer for this study. Additionally, probes were designed using fragments with low homology between the amplified product and the downstream sequence (Fig. 2, Fig. 3). The primer pairs and probe information used are shown in Table 2.

Table 2

Primer and probe sequences and amplicon
Primer	Seqence	Amplicon (bp)
PS-RPA-F	cgagtggaagaaatggagaaagtcgttatc	300
PS-RPA-R	ggcacagtcagatacaaagctagaaactga	300
PS-LF-Probe	FAM-TGTCCAACTTTCGTCAGTTTCTAGCTTTGTA-THF-TCGGGACTGTGCCATTC-C3-Spacer

Specific detection of Puccinia striiformis f. sp. tritici

The RPA results showed that only the RPA amplification products of Pst CYR32, CYR33, and CYR34 DNA showed detection bands and quality control bands on the flow chromatography test strip. Of the five other pathogens tested, only wheat DNA and blank control showed the quality control zone in ddH₂O. In addition, PS-RPA-F and PS-RPA-R were primers for ordinary PCR detection and the results of agarose gel electrophoresis showed that Pst could be amplified to a specific target of 300 bp with no other pathogen amplification occurring. This shows that the primer had high specificity for Pst (Fig. 4, Fig. 5).

RPA sensitivity detection

Ten-fold dilution of Pst gDNA resulted in flow chromatography test strips showing that 100 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg /µL and 10 fg/µL concentrations were positive, but 1 fg/µL and 100 ag/µL concentrations only produced the quality control band, meaning the result was negative. This illustrated that RPA could detect at least 10 fg/µL of Pst DNA. The same concentrations of Pst gDNA were used for ordinary PCR detection, and the results showed that the lower limit of DNA concentration detected by ordinary PCR was also 10 fg/µL. This indicates that the RPA detection system had high sensitivity for Pst (Fig. 5, Fig. 6).

Detection of Puccinia striiformis f. sp. tritici isolates

Thirteen samples from the Datong and Guide counties were found to be infected with Pst using the RPA test, which was consistent with the results of ordinary PCR analysis. The test results are shown in Fig. 8, Fig. 9, and Table 3.

Table 3

Sampling points and detection results of isolates of *Puccinia striiformis* f. sp. *tritici*
Sequence	Area	Location	PCR assay	RPA assay
1	Datong	Kangjia	+	+
2		Hanrjia	+	+
3		Baojia	+	+
4		Maojiazhai	+	+
5		Benkang	+	+
6	Huzhu	Gelong	+	+
7	Huzhu	Mijiazhuang	+	+
8	Ledu	Xiakou	+	+
9	Jianzha	Yangjia、	+	+
10	Jianzha	Xiaduoba	+	+
11	Hualong	Xinfu	+	+
12	Hualong	Longshang	+	+
13	Guide	Chada	+	+
“+” experimentally verified positive

Rpa Practicality Test

Twenty-one wheat leaf samples were collected from seven areas in Qinghai Province. The leaves were tested and the results from the Dashijia, Ahetan, Shangduoba, and Sheren villages were positive. However, Pst was not detected in samples from the Heerjia, Xiaduoba, and Baiwujia villages. The results of ordinary PCR tests were comparable. Pst could be detected on the first day after inoculation, although the results of RPA and ordinary PCR analysis showed weak bands, indicating that the amount of Pst was relatively low on the first day after infection. Puccinia striiformis were detected from days 2–8, and observation stopped on the ninth day when sporadic urediospores appeared on the surface of the leaves. This shows that the established RPA system can be used to detect Pst at the seedling stage (Fig. 10, Fig. 11, Fig. 12, Fig. 13, and Table 4).

Table 4

Application of recombinase polymerase amplification (RPA) in detection isolaters of *Puccinia striiformis* f. sp. *tritici* in Field
Area	Location	PCR assay、	RPA assay
Guide	Dashijia	+	+
Guide	Heerjia	-	-
Hualong	Shangduoba	-	-
	Xiaduoba	+	+
	Sheren	+	+
Xunhua	Ahetan	+	+
Minhe	Baiwujia	-	-
“+”experimentally verified positive; “-”experimentally verified negative

In this study, we designed and screened specific RPA primers and probes based on PS4593, an effector gene of Pst, and established a rapid detection method for Pst using RPA technology in combination with lateral flow chromatography test strips to visually detect Pst during the incubation period.

Primer and probe design are key factors in the success of RPA detection. The length of RPA primers is generally between 30 and 35 bp, and the target band of the amplified product is between 100 and 500 bp. The primers PS-RPA-F and PS-RPA-R and the probe PS-LF-Probe used in this study could specifically detect the physiological races CYR32, CYR33, and CYR34, and can be used to detect the pathogens of other wheat leaf diseases. This illustrates that the specificity of the test was strong. It has been reported that the detection limit of the LAMP detection system for Pst is 200 fg/µL (Aggarwal et al., 2017), and the dual real-time quantitative fluorescent system established by Pan et al. can detect Pst at a minimum of 50 fg/µL (Pan et al., 2016). When using RPA technology to detect other diseases, the detection sensitivities have been reported as follows: Wei et al. reported a sensitivity of 75 fg/µL for the detection of the causal agent of tomato leaf bacterial spot pathogen (Wei et al., 2016), the RPA detection sensitivity of Pythium acarpa established by Zhao et al. was 1 pg/µL (Zhao et al., 2018), and Shen constructed an RPA for the detection of tobacco and found the sensitivity of bacterial wilt to be 1 pg/µL (Shen et al., 2020). Relatively, PS-RPA-F, PS-RPA-R, and PS-LF-Probe established in this study had a lower detection limit of 10 fg/µL for Pst genomic DNA, and the sensitivity was relatively high.

LAMP detection of Pst requires the design of four primers and a loop primer for amplification (Li et al., 2016), while RPA technology requires only forward and reverse primers to detect the target band. Additionally, the complexity of RPA primer design is relatively low compared to LAMP detection technology, and it can specifically detect Pst within 20 min at a constant temperature of 39°C. The method is simple, fast, and can be conducted at room temperature, and the detection buffer can be divided into aliquots to avoid false positive results. The practicality of RPA technology is an important indicator for the promotion of this method.

In this study, 13 mixed isolates of Pst were collected from the Datong and Huzhu counties of Qinghai Province for testing, as well as 21 self-inoculated leaves of spring wheat seedlings, collected from areas with a high incidence of Pst, that were infected for 1 to 8 days. A small amount of Pst was found in the mixed isolates on the first day after infection. There were 12 samples detected in areas with a high incidence of Pst. This shows that the application of this system can rapidly and efficiently detect Pst in leaves during the incubation period. This study provides a theoretical basis for early prevention and control of wheat stripe rust.

Acknowledgments The authors are grateful for the critical review of the manuscript by Meinan Wang.

Authors’ contributions Yaoxia Liu and Jianyun Hao executed the experiments. Qingyun Guo and Jiahui Yan analyzed the bioinformatic data. Yaoxia Liu and Qiang Yao wrote the manuscript and prepared Figs. 1–13 and table 1-4. All authors reviewed the manuscript.

Funding This project was partially funded by the National Key R&D Program of China (2021YFD1401000), the National Natural Science Foundation of China（31960516）, Key R&D and Transformation Program of Qinghai Province（2022-NK-125）.

Ethics approval and consent to participate Not applicable.

Consent for publication All authors reviewed the manuscript and agreed for publication.

Competing interests -The authors have no competing interests to declare that are relevant to the content of this article.

Financial interest -The authors have no relevant financial or non-financial interests to disclose. -All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or non-financial interest in the subject matter or materials discussed in this manuscript. -The authors have no financial or proprietary interests in any material discussed in this article.

Aggarwal R, Sharm S, Manjunatha C, Gupta S, Singh VK (2017) Development and validation of loop mediated isothermal amplification based detection assay for Puccinia striiformis f. sp. tritici causing stripe rust of wheat. Australasian Plant Pathology 46: 577-583
Boamah SM, Zhang SW, Xu BL, Li T, Inayat RH, Calderón UA (2021) The role of trichoderma species in plant’s response to salt stress. Asian Journal of Research in Crop Science 6: 28-43
Chao X, Liang L, Jin WJ, Wan YS (2014) Recombinase polymerase amplification (rpa) of camv-35s promoter and nos terminator for rapid detection of genetically modified crops. International Journal of Molecular Sciences 15: 18197-18205
Cheng YL (2015) Identification and functional analysis of pathogenicity-related genes of Puccinia striiformis f. sp. tritici. Northwest Agricultural and Forestry University
Coram T (2011) Gene expression profiling of Puccinia striiformis f. sp. tritici during development reveals a highly dynamic transcriptome. Genetics 38: 357-371
Duan Y, Xu J, Ma ZM, Bin Y, Zhou CY, Song Z (2021) Detection of citrus leaf blotch virus by reverse transcription recombinase polymerase amplification (RT-RPA). Scientia Agricutura Sinica 54: 1904-1912
Gamze B, Dobhal S, Crockford AB, Melzer, Alvarez AM, Arif M (2020) Genome-informed recombinase polymerase amplification assay coupled with a lateral flow device for in-field detection of dickeya species. Plant disease 104: 2217-2224
Hovmøller MS (2010) Disease severity and pathotype dynamics of puccinia striiformis f. sp tritici in Denmark. Plant Pathology 50: 181-189
Ju YL, Shen PF, Fan ZP, Yang GG, Wu X, Wan N, Pan YM (2020) Development and evaluation of recombinase polymerase amplification for the detection of Gaeumannomyces graminis var. tritici. Plant protection 46: 150-155 + 180
Ju YL, Shen PF, Feng YJ, Yang GG, Liu WC, Guo WH, Pan YM (2020) Development and application of Rc-RPA-LFD for the rapid detection of Rhizoctonia cerealis. Acta Phytopathologica Sinica 50: 618-621
Kalantar MMH, Masoud S, Ali K, Pooria G (2011) A review of the current isothermal amplification techniques: Applications, advantages and disadvantages. Journal of Global Infectious Diseases 3: 293-293
Lu X, Zheng Y, Zhang Fan, Yu J, Dai TT, Wang RB, Tian YE, Xu H, Shen DY, Dou DL (2020) A Rapid, equipment-free method for detecting phytophthora infestans in the field using a lateral flow strip-based recombinase polymerase amplification assay. Plant disease PDIS01200203SC-PDIS01200203SC
Li JJ, Xiong C, Liu Y, Liang JS, Zhou XW (2016) Loop-Mediated isothermal amplification (LAMP): Emergence as an alternative technology for herbal medicine identification. Frontiers in plant science 7: 1956
Ma ZM, Xu JJ, Duan Y, Wang CQ, Su Y, Zhang Q, Bin Y, Zhou CY, Song Z (2021) Establishment of RT-RPA for citrus yellow vein clearing Virus (CYVCV) Detection. Scientia Agricutura Sinica 54: 3241 – 3249
Pan JJ, Luo Y, Huang C, Sun ZY, Zhao L, Yan JH, Ma ZH (2010) Quantification of latent infections of wheat stripe rust by real-time PCR. Acta Phytopathologica Sinica 40: 504-510
Pan Y, Gu YL, Luo Y, Ma ZH (2016) Establishment and application of duplex real-time PCR quantitative determination method on latent infection of wheat stripe rust. Acta Phytopathologica Sinica 46: 485-491
Qin JC (2021) Pathogen identification of broad bean virus and rapid detection technology of common bean mosaic virus. Yangzhou University
Shiferaw B, Smale M, Braun HJ, Duveiller E, Reynolds M, Muricho G (2013) Crops that feed the world 10. Past successes and future challenges to the role played by wheat in global food security. Food Security 5: 291-317
Shan W, Chen S, Wuliren, Li Z (1995) Rapid analysis of epidemic races of puccinia striiformis f. sp. tritici in China. Scientia Agricutura Sinica 28: 1-7
Shen PF (2020) Rapid detection of ralstonia solanacearum using recombinase polymerase amplification and biocontrol effect of XCS1 Against R. solanacearum. Anhui Agricultural University
Wang Y, Li DQ, Liu XJ, Li T, Ma EB, Fan RJ, Zhang JZ (2015) Molecular characterization and RNAi-based functional analysis of obstructor family genes in Locusta migratoria. Acta Phytopathologica Sinica 48:73-82
Wei M, Qian T, Zhao W, Li G, Kong J (2016) Rapid detection of Pseudomonas syringae pv. tomato by RPA method. Plant protection 42: 150-153
Xi L, Wang YQ, Yang X, Zhu W, Chen GY, Wang Y, Qin P, Zhou YH, Kang HY (2021) Evaluation of resistance to stripe rust and molecular detection of resistance gene(s) in 243 common wheat landraces from the Yunnan Province. Scientia Agricultura Sinica 54: 684-695
Yao Q (2018) Study on the epidemic rule of wheat stripe rust in Qinghai Province. Northwest Agricultural and Forestry University
Zhao YY (2018) Establishment of LAMP detection method For Pythium Arrhenomanes and RPA assay for Pythium Arrhenomanes. Nanjing Agricultural University

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Establishment of recombinase polymerase amplification detection method for Puccinia striiformis f. sp. Tritici

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Test materials and reagents

Extraction Of Pathogenic Bacteria Dna

Rpa Reaction System Establishment

The Ordinary Pcr Reaction System

Design Of Rpa Primers And Probes

The Practicality Of Rpa Testing System

Results

Primer screening and probe design

RPA sensitivity detection

Rpa Practicality Test

Discussion

Declarations

References

Additional Declarations

Status:

Version 1