Cell culture & Bacteria strains
Cloning and gene expression were accomplish using E. coli strains NovaBlue GigaSingles™ (Novagen- USA) as the primary cloning host and BL21-DE3 (Novagen-USA) as the expressing host. For gene cloning, plasmid pET-32 LIC vector (Novagen- USA) was utilized. The cell surface expression of MET is abundant in the MDA-MB-435 cell line whereas this protein has no expression in the BT-483 cell line (27). Thus, authenticated human ductal carcinoma cell lines (MDA-MB-435 and BT-483), as well as mouse breast cancer lines (4T1), were purchased from Pasteur Institute of Iran (IPI, Iran). All cell lines were cultured as adherent cells in high glucose Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA), 1% non-essential amino acid (Gibco-USA), 2 mM L-glutamine (Gibco, USA), 1 mM sodium pyruvate (Gibco, USA), and 1% penicillin-streptomycin (Gibco, USA) in gamma radiated sterile polystyrene plates and flasks then stayed at 37°C in a 5% CO2 humidified atmosphere incubator.
Construction Of Recombinant Anti-met Scfv Expression Cassette
The DNA sequences of the variable heavy chain (VH), as well as variable light chain (VL) domains of anti-MET Onartuzumab Fab, were obtained from GenBank (Accession number: 4K3J-H and 4K3J-L respectively). The detailed process of construction of Onartuzumab antibody has been described elsewhere (24). A glycine-rich 15 amino acid peptide was inserted between variable chains as a flexible linker. After the synthesis of this codon (Cinnagen, Inc. Tehran, Iran), it was amplified by PCR, followed by 3 sequential PCR runs to add the following sequences to the reading frame by use of specific primers listed in Table 1: a stII signal peptide coding sequence at the 3' end to localize anti-MET protein in the periplasmic space of expressing bacteria which can then be easily harvested in its native structure after disrupting the bacterial wall, a 6 constitutive histidine tag moiety at 5' to isolate the protein by Ni-NTA affinity chromatography and also for protein characterization by immunoblotting and the compatible overhang sequence compatible to pET-32 Ek-LIC vector at both ends of the codon. (Fig. 1A) The primers were designed by Gene Runner Software v3.05 (Hastings Software Inc. Las Vegas, U.S.A) and then synthesized by Pishgam Biotech Co. (Tehran, Iran). The PCR reaction mix was comprised of 5 µl dNTP mix (0.2 mM), 5 µl of 10× reaction buffer with 1.5 mM MgCl2, 2 µl of each primer (12.5 mM/µl), 0.4 µl Taq DNA polymerase (1 Unit) and 2 µl template (50 ng/ml) and 8.6 µl ddH2O in a total volume of 50 µl in 30 cycles. Each cycle was started with an initial denaturation at 95°C for 2min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 1 min and a final extension at 72°C for 5 min. Then the final PCR product was harvested from the 2% agarose gel after the electrophoresis and concentrated with the Qiagen gel extraction kit (Qiagen, Germany). Molecular weight and theoretical isoelectric point were estimated with Expasy (https://web.expasy.org/compute_pi/).
Table 1
List of primers used for construction of anti-MET scFv expression cassette
Name | Sequence (5'-3') |
Forward 1 | GACATCCATGACCCAG |
Reverse 1 | AGAAGAAACGGTAACCACG |
Forward 2 | AGAAGAAACGGTAACCACG |
Reverse 2 | CGTTTTTTCTATTGCTACAAATGCCTATGCAGACATCCAGATGACCCAG |
Forward 3 | ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAATG |
Reverse 3 | ATGATGATGATGATGATGAGAAGAAACGGTAACCACG |
Cloning And Expression Of Recombinant Anti-met Scfv
The achieved DNA amplicon were cloned within the ligation-independent cloning (LIC) site of the pET-32 EK/LIC vector based on the protocol of manufacturer (Novagen- USA). Transforming the constructed plasmid, pET-32 Ek-LIC/Anti-MET, into E-coli Nova Blue GigaSingles™ competent cells (Novagen- USA), was performed by the calcium chloride method (28). Transformants were then cultured on LB agar containing ampicillin (50µg/ml). The recombinant clones were submitted randomly to colony-PCR and clones with desirable insertion sizes were characterized by sequencing (Gene Fanavaran Co, Iran) to confirm successful cloning. The accuracy of the sequence was confirmed using Sequence Alignment Editor Software Bio Edit. Harvested plasmids were then used to transform into protein-expressing E-coli strain, BL21 (DE3) competent cells (Novagen, USA), and transformants were cultures on LB agar plates containing 50 µg/ml ampicillin. Single colonies of the E. coli BL21 DE3 containing pET32Ek/LIC-anti-MET plasmids were then grown in 5 ml LB broth containing 50 µg/ml ampicillin and incubated at 37°C and 180 rpm in a shaker incubator for 16 h. Subsequently, the culturing tube was poured into 200 mL ampicillin containing terrific broth to reach an optical density (OD) 600 of at least 0.4. At this point, isopropyl thiogalactoside (IPTG) was added (1mM) to induce protein expression at 27°C for 16 h in a shaker incubator (150 rpm).
Protein Purification And Concentration
For the purification of anti-MET scFv, immobilized metal affinity chromatography (IMAC) was performed through denaturing method and by using a Ni-NTA-Agarose column (Qiagen, Germany). For this purpose, expressing bacterial cells were first collected by centrifugation (9000 rpm, 4°C, and 30 min). After resuspension of pellets in the ice-cold denaturing buffer (500mM NaCl, 8 mM Urea, Tris-HCl pH 8.0, and imidazole 10 mM), all soluble periplasmic proteins were extracted utilizing sonication (1mA for 10 min) with subsequent centrifugation (4°C, 15000 rpm). The supernatant, containing His-tagged anti-MET scFv and the host soluble proteins were collected and then submitted for IMAC. First, the column was prepared by passing the binding buffer (300 mM NaCl, 6 mM Urea, Tris-HCl pH:8.0, and imidazole 2 mM) through 5 mg Ni-NTA HisBind Resin (Qiagen). Afterward, the extracted protein was added to the column, incubated at 26°C for 1 h, then washed by three sequential wash buffers to reduce the urea concentration gradually (wash 1: 500 mM NaCl, 4 mM Urea, Tris-HCl pH: 8.0; wash 2: 500 mM NaCl, 2 mM Urea, Tris-HCl pH 8.0; wash 3: 500 mM NaCl, Tris-HCl pH 8.0). In the last stage, the bound anti-MET was eluted by 5 column volumes of elution buffer (300 mM NaCl, 300 mM imidazole, and Tris-HCl pH 8.0). The imidazole of the elute was eliminated by diafiltration. Then Purified proteins were concentrated to 500 micrograms per milliliter on an Amicon (Merk, Germany) concentrator using sterile PBS, pH 7.6, and kept at 4°C for experiments. The concentration was measured by a spectrophotometer (WPA Biowave II, Bichrom, England).
Characterization Of The Purified Protein; Sds-page, Western Blotting
Eluted fractions of IPTG positive, IPTG negative, and purified anti-MET fragments were electrophoresed on a 12% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel), in the presence of 2-mercaptoethanol as a reducing agent. The gels were then stained with Coomassie brilliant blue to evaluate the protein bands. Isolated proteins by SDS-PAGE were then submitted to the polyvinylidene difluoride; PVDF (Millipore Merk) membrane using a semi-dry blot transfer device (Bio-Rad, Hercules, CA) based on the standard protocol (29). To improve the signal-to-noise ratio, the membrane was blocked with a blocking buffer comprising 5% w/v non-fat dried milk (Merck) in 0.05% v/v PBS-Tween-20 solution for 18 h at 4°C. Afterward, the membrane was rinsed thrice in Tris-buffered saline; TBS and 0.1% (v/v) Tween 20 and probed with a mouse horseradish peroxidase (HRP)-conjugated anti-His tag monoclonal antibody (Qiagen, Germany; 1:2000) at 27°C. The protein blots were finally visualized by using 0.05% 3, 3′ -diaminobenzidine (DAB; Sigma-Germany) (0.05% DAB; 0.03% hydrogen peroxide in 100 mM Tris-HCl pH 7.5).
Cell Surface Antigen-binding Assay Via Flow Cytometry
A human metastatic breast carcinoma cell line BT-483 and a putative breast/melanoma cell line MDA-MB-435 were used as rarely expressing (as a control cell line) and constitutively expressing MET, respectively (27). The cells were incubated with 50 µg/ml of purified concentrated anti-MET scFv for 1 h at 4°C. FBS-treated cells were used as a negative control. The cells were then washed three times with ice-cold PBS and 4% FBS and were incubated with 10 µg/ml FITC conjugated anti-His specific antibody (Abcam- UK) for 1 h at 4°C (1:500). Subsequently, antigen-binding to the cell surface was assessed using the FACScalibur Flow Cytometer (FC) device (Becton Dickinson- USA) at the FL1 channel.
Cell Viability Assay; Mtt Assay
To appraise the potentiality of anti-MET scFv cytotoxicity, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H- tetrazolium bromide (MTT) assay was performed. Briefly, 5×103 MBA-MD-435 and BT-483 cells were seeded in every well of a 96-well plate and the cells were cultured with 0.2 ml medium at 37°C for 24 h. Different concentrations (4 to 132 µg/ml) of anti-MET scFv were added to wells followed by 48 h incubation. Cells were then incubated with the MTT dye at 37°C for 3 h. After washing out the MTT with PBS, formazan which was formed from MTT in viable cells by dehydrogenase enzyme was dissolved using DMSO. Finally, absorbance rate was read at 570 nm by a microplate absorbance reader (BioRad- USA), and fifty percent inhibitory concentration values (IC50) were calculated using GraphPad Prism 7 as the concentration of the protein inducing a 50% reduction in viability when compared to untreated cells.
Apoptosis Assay
The percentage of the total, late and early apoptotic cells was determined using flow cytometric Annexin V-FITC)/propidium iodide (PI) assay (Biolegend, San Diego, CA) according to the guidelines manufacturer. For this purpose, 4×105 cells were seeded into each well of a 6-well plate, treated with anti-MET scFv at different concentrations (18, 32, and 50 µg/ml), then incubated for 48 h at 37°C. These concentrations were selected based on the average of 25% and 75% growth inhibitory activity of our protein in the MTT assay amongst all cell lines. Then Cells were harvested utilizing 1X trypsin-EDTA (Gibco-USA) and washed with PBS. Cells were then centrifuged and the pellet was resuspended in 100 µl binding buffer of the assay kit and then stained by FITC-labeled Annexin V and PI. Cells were then submitted to flow cytometry analysis (BD FACS, Calibur) on the FL1/FL3 channels and the double staining quadrant was gated on targeted cells. The single positive FL1 population (Annexin V labeled cells) and double-positive cells (FLs1/FL3) as respective early and late apoptosis, were summed up to obtain the total apoptotic cell percentage.
Invasion Assay
Given the role of MET in metastasis, we examined whether anti-MET scFv affects cancer cell invasion and migration. The Cultrex BME Cell Invasion Assay (R&D Systems) (Trevigen Inc., Gaithersburg, MD, USA) was used based on manufacturer protocol using MBA-MD435 and BT-483 lines. 50 µL basement membrane extract (BME) solution was added to each well of the top chamber and incubated at 37°C. 50,000 cells/ 50 µL serum-free medium containing 10 µM anti-MET were plated on the coated BME. Control wells contained PBS instead of anti-Met. 150 µL of the medium was then loaded into the lower chambers. The Cells were then incubated for 24 h, at 37°C. 100 µL of Calcein AM solution/cell dissociation solution was added to the bottom chamber and incubated for 1 h, at 37°C. Relative fluorescence units (RFU) of the samples were determined at 485 nm excitation and 520 nm emission with an ELISA reader (BioTek-VT- USA). The data was compared to the standard curve to measure the number of cells that have invaded through BME.
Migration Assay
Migration assay was performed utilizing Cultrex BME Cell Migration Assay (R&D Systems) (Trevigen Inc., Gaithersburg, MD, USA) similar to the above-mentioned invasion assay. On the second day, the upper chamber was carefully aspirated and washed with 1X cell wash buffer. Afterward, 100 µL of cell cissociation solution/Calcein-AM was added to the bottom chamber of a black assayed 96-well microplate. The cell migration chamber was assembled and incubated for 1 h, 37°C. The top chamber was eliminated and absorbance was read at 485 nm excitation and 520 emissions compared to the standard curve.
Breast cancer tumor model ( In-vivo )
6–7 week-old female inbred BALB/c mice, weighing 16–17 gram (Veterinary Faculty, University of Tehran) were used for in vivo 4T1 syngeneic homograft TN breast cancer mouse model. Mice were placed in conventional condition at the Animal Care Facility, Veterinary Faculty, and the University of Tehran according to guidelines established by the Animal Care Committee of the University of Tehran. Tumors were established on the left flank by subcutaneous transplantation of 4T1 tumor tissues with the dimensions of 3 mm obtained from a 4T1 tumor-bearing BALB/c mouse. The first day of treatment was initiated when the average tumor size reached 100 cm3 as measured using Ultrasonography (US). 5 µg/g of anti-MET scFv was injected systemically into the mice through the tail vein. A total of 7 injections were performed every other day. The bodyweight of animal was monitored daily. Tumor volume was measured non-invasively through the US imaging every 3 days according to the following formula:
V (mm3) = 1/6 π × x × y × z
In which x, y, and z represent tumor height, width, and length (mm), respectively. The results were then compared to the PBS receiving control group. At the end of the treatment period, mice were sacrificed, then tumors were surgically excised, weighed, and submitted to 10% formaldehyde (NPF, fixative, Sigma-Aldrich, HT501128) for histopathology assessment.
Ultrasonography Techniques
Percutaneous real-time ultrasonography (B-mode and color Doppler) was performed using a multi-frequency (6–13 MHz) linear transducer with a small footprint (SLAx/6–13 Ultrasound Transducer), connected to a portable ultrasound unit (Micro Maxx, Sono Site, USA, 2009). The transducer was aligned to the tumor’s central plane and the maximum depth of 19 mm was set to gain the sagittal and transverse planes. The tumor’s height, width, and length were measured using the unit’s caliper. In addition, tumor’s shape, margin (smooth or irregular), parenchymal echogenicity (hypoechoic or hyperechoic), and echotexture (homogeneous or heterogeneous) were evaluated. Also, probable invasion to regional structures, severity (mild, moderate and severe), and the pattern of the vascularization (centrally, peripherally or both) were assessed. The ultrasonography was performed every 3 days with all the above parameters checked to analyze the amount of tumor outgrowth, spreading and invasion.
For the best attachment of the probe to the skin, the tumor site was shaved and an ultrasonography jelly was applied. Image orientation was performed using landmarks to procure standardized planes and correct measurements. In Color Doppler Technique, high-quality images and accurate measurements of optimum velocity were obtained by setting the sample volume size to 13 mm and by changing its angle to 60 degrees. This was repeated in all animals to decrease the possible miscues.
Histopathology
At the end of the treatment period, tumors were excised and prepared for histopathological evaluation. The H&E staining was performed to study the percentage of the tumor necrosis, mitotic count (per 10 HPF), nuclear pleomorphism (scores 1, 2, and 3), and tumor-infiltrating lymphocytes (TILs) (number of lymphocytes in 10 HPF). Following antibodies were used for immunohistochemical staining: anti-CD8 monoclonal antibody (Catalog number: ab209775, Abcam, USA), marker of cytotoxic T cells; anti-Bax monoclonal antibody (Catalog number: ab263897, Abcam, USA), apoptosis regulator; anti-Ki-67 monoclonal antibody (ab15580, Abcam, USA), marker of proliferation; anti-VEGF receptor 2 (VEGFR2) monoclonal antibody (Catalog number: ab2349, Abcam, USA), indicator of angiogenesis, and anti-matrix metalloproteinase-9 (MMP-9) monoclonal antibody (Catalog number: ab38898, Abcam, USA), a proteinase up-regulating in metastasis and angiogenesis. The specific HRP-conjugated secondary antibody was used. Gill’s hematoxylin was used as counterstaining for all sections. Microvessel density (MVD) was assessed as the average number of microvessels in 4 random fields after VEGF-R2 staining. The percentage of positive nuclei for Ki-67 per 1000 malignant cells was also used to assess proliferation and a modified ALL-Red scoring system (proportion score and intensity score) was used to assess MMP-9- and BAX-stained sections.
Statistics
The quantitative data are expressed as means ± SD. Gaussian distribution was assessed by the Shapiro-Wilk test. Ordinary one-way ANOVA was used to analyze among 3 or more group differences and a Tukey test as post-hop. Two-tailed unpaired t-test was carried out to compare between two groups. Statistically significant, P-value < 0.05 was considered (* p < .05, **p < .01, ***p < .001). Graphpad Prism version 9.0.0 and Excel 2016 software were used for statistical analysis.