Identification of Rboh genes from Neoporphyra haitanensis and their expression profiling under stress conditions

doi:10.21203/rs.3.rs-2220572/v1

Download PDF

Research Article

Identification of Rboh genes from Neoporphyra haitanensis and their expression profiling under stress conditions

https://doi.org/10.21203/rs.3.rs-2220572/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Respiratory burst oxidase homolog (Rbohs) is key enzymes in the reactive oxygen species (ROS) metabolic network. Various studies had shown that plant Rboh genes were involved in plant growth and developmental processes as well as in biotic and abiotic stress responses, but little is known about its functional role in red algae. In the present study, 10 putative NhRboh genes were identified from the genome of Neoporphyra haitanensis. It predicted that most of NhRbohs encode acidic hydrophobic proteins, locating in plasma membrane and chloroplast. Genome-wide syntenic analysis indicated 6 of 10 NhRboh genes were in conserved collinear blocks between N. haitanensis and N. yezoensis, and many cis-acting elements related to stress response were predicted in the up-stream regions of NhRboh genes. Additionally, expression profiles of 8 NhRboh genes were analyzed under stress conditions of dehydration, heat stress and co-stresses of heat and dehydration. Together with transcriptomic and proteomic results, it showed that the expression patterns of these genes were divergent among different conditions, suggesting some genes may be involved in the process of stress tolerance in N. haitanensis. This study provides valuable information to help with further functional studies of Rboh genes in N. haitanensis.

Neoporphyra haitanensis

Rboh genes

Synteny analysis

Gene expression

Neoporphyra haitanensis is an endemic red algal species to China, which is of great economic and ecological values (Cao et al. 2020; Ding et al. 2020). As inhabiting on the intertidal and subtidal zones, the gametophytic blades of N. haitanensis faced daily and seasonal fluctuations in environmental conditions with stresses as high temperature, high intensity of illumination, dehydration, and so on (Huang et al. 2021; Shi et al. 2019; Yang et al. 2022). Recently, with the trend of global warming, the cultivating of N. haitanensis is challenged as the high temperature will damage the germlings when cultivating. To solve this problem, a serial of new cultivars for the purpose of improving high temperature tolerance has been developed and applied for field cultivation (Yang et al. 2022). Therefore, it is important to screen and characterize the function genes related to the stress tolerance in N. haitanensis, which will provide the theoretical basis for developing stress tolerant cultivars and improve the efficiency of breeding.

Respiratory burst oxygen homolog (Rboh, also known as NADPH oxidase) is hub enzyme in reactive oxide species (ROS) production pathway and key node for ROS signaling network (Suzuki et al. 2011). Rboh is present in fungi, molds, animal, and plant, indicating the evolutionary of this enzyme is conserved (Vermot et al. 2021). As a class of transmembrane protein, Rboh mediates the transfer of electrons from intracellular NADPH to extracellular O₂, resulting in the production of O₂^·−, which is then catalyzed to H₂O₂ by SOD enzyme (Wang et al. 2020b). Rboh are complex multidomain proteins, with the C-terminal region containing functional oxidase domains and the N-terminal region containing calcium-binding EF-hands motif and phosphorylation domains (Wang et al. 2020c). In angiosperms, Rboh are encoded by the Rboh gene family, and there are 10, 9 and 13 Rboh gene members in model species of Arabidopsis thaliana, Oryza sativa and Zea mays, respectively (Groom et al. 1996; Kimura et al. 2020; Lin et al. 2009; Torres and Dangl 2005; Wong et al. 2007). As specialized ROS producers, Rboh genes participate in numerous crucial physiological processes, including host defense, the post-translational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation (Wang et al. 2018). In red algae, only few studies have been carried out on the constitution and potential function of Rboh genes (Hervé et al. 2006; Luo et al. 2014), which also been less characterized in N. haitanensis.

It found that Rboh genes in red algae may play important regulatory roles in the process of adaptation to the harsh environmental conditions where they dwelled. For example, homologous gene of Ccrboh has been isolated from Chondrus crispus, which was highly expressed during the treatment of C. crispus with its endophyte (Hervé et al. 2006). Shim et al. (2022) indicated that Rboh gene could participate the fertilization process in Bostrychia moritziana. In addition, a Phrboh gene has been cloned from N. haitanensis, which was up-regulated under stress condition of 35℃ heat shock, accompanied by higher level of ROS (Luo et al. 2014). Accordingly, our transcriptomic and proteomic studies also found that some Rboh genes and proteins were highly expressed under heat stress, suggesting their potential role in dealing with the stresses (Huang et al. 2021).

In this study, we retrieved Rboh genes from the genome of N. haitanensis, and their physicochemical properties, synteny with Rboh genes from N. yezonesis, and cis-acting elements were analyzed. Furthermore, the expression patterns of HSP20 family genes under heat stress, dehydration stress and co-stresses of heat and dehydration were also analyzed. This study could provide basis for revealing the biological functions of Rboh genes in N. haitanensis.

2.1. Experimental material and stress treatment

The experimental material used in this study was the artificially bred strain of N. haitanensis (SW-81) (Ding et al. 2020), and the cultivating method for conchospores and gametophytic blades was referred as reference (Yan et al. 2010). The conditions for culturing gametophytic blades were as following: appropriate temperature of 23 ± 0.5°C; 10 L /14 D photoperiod; light intensity of 40–50 µmol photons m^− 2 s^− 1. When the length of blades reaching 15 ± 2 cm, the healthy and flat blades were selected for the stress treatment materials. Three stresses treatment were carried out for 3.0 h as following conditions: drying the blades at 23 ± 0.3℃ in a growth chamber was set as dehydration stress group; treating the blades with heat shock at 29 ± 0.3℃ in constant temperature incubator was set as heat stress group; treating the blades with drying at 29 ± 0.3℃ in constant temperature incubator was set as co-stresses of heat and dehydration group. For qRT-PCR analysis, three duplicate samples for each group were sampled, respectively. The samples of about 0.1 g wet weight were immediately frozen in liquid nitrogen and then stored in ultra-low temperature refrigerator at -80 ℃. The samples for transcriptome and proteome profiling were referred as reference (Huang et al. 2021).

2.2. Gene identification and bioinformatics analysis

The genome sequences of N. haitanensis were acquired from the NCBI database (https://www.ncbi.nlm.nih.gov/), and the sequences of Rboh genes in Arabidopsis thaliana were downloaded from TAIR database (https://www.arabidopsis.org/). Candidate Rboh genes were retrieved from N. haitanensis genome via BLAST homology searching. The resulting sequences of RBOH screened were submitted to the HMMER website (https://www.ebi.ac.uk/Tools/hmmer/) and the SMART website (http://smart.embl-heidelberg.de/) to verify the conserved domains of NAD and FAD. The online software of Protparam (http://web.expasy.org/protparam/) was used for molecular weight, instability index, PI, and grand average of hydropathicity analysis of putative RBOHs. Furthermore, protein subcellular localization prediction was carried out using online software of WoLFPSORT (https://wolfpsort.hgc.jp/) and Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) and Yloc (https://www.yloc.org/en/).

2.3. Chromosomal localization and genome-wide synteny analysis

The collinearity of genome sequence between Neopypopia yezoensis and Neoporphyra haitanensis was analyzed through Tbtools (Chen et al. 2020) with the module of One Step MCScanX-Super Fast. The synteny visualization was produced through Dual Systeny Plot of TBtools based on the files obtained from MCScanX. Manually edited Ctl file was used to filter and simplify the visualization, and additionally input gene list was set for highlighting the Rboh genes.

2.4. Gene expression analysis

Based on Coding region sequences of Rbohs in N. haitanensis, primers for fluorescence quantitative analysis were successfully designed for eight genes by using Primer Premier 5 software (Table 1). Total RNA was extract from each samples using TRIzol reagent (Thermo Fisher Scientific), which were reverse transcribed into cDNA using PrimeScriptTM RT Reagent Kit with gDNA Eraser Kit (TaKaRa). Bio-RAD CFX96 PCR instrument and TB Green® Premix Ex Taq™ II (TaKaRa) were used for real-time fluorescence quantitative PCR detection. And the PCR reaction system and program were set according to reference (Gui et al. 2022), with each group including three biological and technical replicates, respectively. NhUBC was set as an internal reference gene (Li et al. 2014), and 0 h of stress treatment was used as the initial value, and the relative expressions of the genes were calculated by the 2^−ΔΔCt method. For statistical analysis, the quantitative results were exhibited as mean ± standard deviation, and one-way ANOVA was performed using SPSS 26.0 software to reflect significant difference between values (P < 0.05).

Table 1

PCR quantitative primer sequences for *Rboh* genes in *Neoporphyra haitanensis*
Gene name	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
NhRbohA	GTTTTACCCGCTCCTCCTCG	AGCGCGTAGACGATCATTGG
NhRbohB	CCTCGCTCCTTCACCTAT	TCCAGTCGCCACCATT
NhRbohC	CGTCGTTGCCTACTCCCTC	GTCCCACGGATGAAAGCGA
nhRbohD	GATGCTGCTGCTGCTGTACCTC	GAGAAGCCGACCACCACAAACC
NhRbohE	CGTTTGACAAGGCGATGC	CCCAGAGGGAGCCGATAA
NhRbohG	CCATTGACACGCCCTTTCC	AACGGGTGCCACTGACG
NhRboH	CCTCCTCATCTTTCACGG	AAGCAACGACACCACCC
NhRbohJ	TGTTCCTGCTGCCCATCT	TCCACCACCACGACACG
NhUBC	TCACAACGAGGATTTACCACC	GAGGAGCACCTTGGAAACG

3.1. Identification of Rboh genes and physicochemical characteristics of Rboh proteins in N. haitanensis

Based on BLAST homologous searching against N. haitanensis genome sequence, a total of 10 Rboh genes were retrieved. Further HMMER and SMART analysis verified that all the deduced Rboh proteins have conserved characteristic domains of NAD and FAD, confirming that the Rboh gene family in N. haitanensis contains 10 members. According to the nomenclature rule of plant Rboh gene family, these Rboh genes were named as NhRbohA-J. Like other red algal Rboh proteins, all NhRbohs lack an EF hand motif which serves as a calcium binding site (Luo et al. 2014; Shim et al. 2022).

Based on physicochemical properties analysis, it showed that molecular weight of NhRbohs was ranged from 41.30 to 149.19 kDa, the PI value was from 7.80 to 11.40, the instability coefficient was from 36.77 and 48.19, and the grand average of hydropathicity was from 0.033 to 0.457 (Table 2). In addition, the subcellular localization prediction suggested that all NhRbohs were localized in the plasma membrane, with NhRbohD and NhRbohD showing an extra chloroplast localization (Table 2).

Table 2

Physicochemical properties and predicted subcellular localization of Rboh proteins in *Neoporphyra haitanensis*
Protein Name	Physicochemical properties				Subcellular localization
Protein Name	Molecular weight (KDa)	pI	Instability index	Grand average of hydropathicity	Subcellular localization
NhRbohA	130.77	9.02	48.19	0.152	Plasma membrane
NhRbohB	103.10	9.22	41.44	0.081	Plasma membrane
NhRbohC	149.19	9.04	43.49	0.033	Plasma membrane
NhRbohD	110.73	7.80	42.85	0.121	Plasma membrane /Chloroplast
NhRbohE	116.41	8.97	41.36	0.114	Plasma membrane /Chloroplast
NhRbohF	82.55	10.20	38.28	0.457	Plasma membrane
NhRbohG	88.93	10.08	43.95	0.249	Plasma membrane
NhRbohH	96.49	8.32	36.77	0.122	Plasma membrane
NhRbohI	41.30	11.40	46.45	0.490	Plasma membrane
NhRbohJ	115.51	9.90	42.77	0.161	Plasma membrane

3.2. Chromosomal localization and genome-wide synteny analysis of Rboh genes from N. haitanensis and N. yezoensis

According to the annotation information, 10 NhRboh genes were scattered on five putative chromosomes of N. haitanensis (Fig. 1), with NhRbohF on Chr01, NhRbohA on Chr02, NhRbohD and NhRbohE on Chr03, and NhRbohB, NhRbohC, NhRbohI and NhRbohJ on Chr04 and NhRbohG and NhRbohH on Chr05. It showed that the five chromosomes of N. haitanensis exhibit global synteny with three chromosomes of N. yezoensis, indicating the close evolutionary relationship between two species. As 9 pairs of orthologous relationships were identified in our previous study (Gui et al. 2022), six ortholog genes could be validated based on the genome-wide synteny assay (as highlighted in red lines in Fig. 1), whereas other three ortholog pairs were not supported by syntenic evidence.

3.3. Cis-acting elements analysis of Rboh genes of N. haitanensis

Cis-acting elements analysis of Rboh genes indicated divers pattern of elements emerging on the 1500 bp up-stream regions of different genes. Specifically, it showed several elements related to different stresses conditions were enriched in all genes, including drought, light, salt, and low temperature response elements (Fig. 2). Besides, several plant hormone-related response elements, such as abscisic acid (ABA), methyl jasmonate (MeJA), auxin, and gibberellin, were also included (Fig. 2). In addition, some upstream sequences of Rboh genes also contained binding sites of Mybhv1 transcription factors.

3.4. qRT-PCR analysis of Rboh genes of N. haitanensis under different stresses conditions

Based on qRT-PCR analysis, different expression patterns for eight tested Rboh genes were observed (Fig. 3). NhRbohA and NhRbohC were down-regulated under dehydration, heat stresses and combination treatment of heat and dehydration. NhRbohB was significantly up-regulated under dehydration stress, but significantly down-regulated under heat stress. The expression level of NhRbohD was not changed under dehydration stress, but significantly decreased under combination treatment. The expression of NhRbohE was significantly up-regulated under heat stress, reaching about 70 times of controlled condition. Whereas under dehydration and combination treatment, the expression of NhRbohE was not changed. The NhRbohG was significantly down-regulated under three stress conditions, but the decreased extent was not same. NhRbohH and NhRbohJ showed similar trend of expression, with a significantly up-regulation under heat treatment and slightly up-regulation under dehydration treatment.

3.5 Expression profiles of Rboh genes and content of Rboh proteins of N. haitanensis based on transcriptomic and proteomic analysis

According to analysis on the transcriptomic and proteomic data of N. haitanenesis, it showed that the expression profiles of eight Rboh genes were also different (Fig. 4). Under dehydration condition, the expression of NhRbohB and NhRbohE was increased, whereas other genes were decreased or not changed. Under heat condition, expression of NhRbohC, NhRbohE, and NhRbohH were increased to different extent, but other genes were decreased or not changed. Only NhRbohH and NhRbohJ was increased under combination treatment of heat and dehydration.

The results of proteomic assay showed a generally consistent pattern with transcriptomic assay. Under dehydration condition, the protein contents for NhRbohE and NhRbohJ were increased, with other NhRbohs been decreased or slightly changed. Under heat condition, the contents of NhRbohC and NhRbohH were increased, but other NhRbohs were decreased or not changed. Only the contents of NhRbohH and NhRbohJ was increased under combination treatment.

The plant Rboh gene family has been comprehensively analyzed in several model organisms as Arabidopsis, rice, wheat, Glycine max, Brassica rapa and multiple trees (Groom et al. 1996; Kimura et al. 2020; Lin et al. 2009; Torres and Dangl 2005; Wong et al. 2007). Many studies indicated that RBOH are vital regulators of many key cellular processes including vegetative and reproductive development, stomatal movement, and responses to hormones and diverse environmental stimuli in plant (Wang et al. 2020b). However, the constituent and function of Rbohs were poorly understand in red algae, as few studies were carried out (Hervé et al. 2006; Shim et al. 2022). Recently, according to our study on genome-wide identification of Rboh genes, there are 11, 10, 8, 6, 2 and 4 members in N. yezoensis, N. haitanensis, Porphyra umbilicalis, Gracilariopsis chorda, Cyanidioschyzon merolae and Chondrus crispus, respectively (Gui et al. 2022). It is interesting that species belonging to Bangiales have more Rboh genes, suggesting these genes may be required to adapt the intertidal stress conditions. In the present study, 10 putative Rboh genes in N. haitanensis were identified and characterized.

The estimated divergence time of N. yezoensis and N. haitanensis was about 100 million years ago (Chen et al. 2022; Wang et al. 2020a), indicating long evolutionary history shape the genomic structure of two species. Nevertheless, when comparing the gene synteny in two species, long syntenic regions were identified as relatively conserved relationships (Fig. 1), probably due to their similar ecological niche in evolution. In terms of Rboh genes, we identified 9 orthologous pairs thorough phylogenetic analysis, 6 of which has been verified as in collinear regions. These results indicated the generally evolutionary dynamics of Rboh genes, and the conserved Rbohs may participate the common processes in adapting to the complex intertidal environment and regulating their own growth and development. On the other hand, there were two and one species-specific Rbohs in N. yezoensis and N. haitanensis, respectively. These genes may be related with the unique species-specific features in two species. For example, the gametophytic blades of N. yezoensis could proceed asexual reproduction via arecheospores, but P. haitanensis doesn’t possess this characteristic. And our study has confirmed the involvement of two N. yezoensis-specific Rbohs in archeospore formation, whereas the function of N. haitanensis-specific Rboh still need explore.

In this study, we found the up-stream regions of NhRboh genes contain several response elements related to abiotic stress, such as light, drought, salt, and low temperature response elements, suggesting these genes could be regulated by transcription factors related to these stress processes (Fig. 2). Also, the ABA response elements were included in several genes. As important plant hormone related to plant stress response signaling pathway (Danquah et al. 2014; Yoshida et al. 2014), the participating of NhRboh genes in the related signaling networks is worthy of investigating. Besides, based on the expression analysis, some NhRboh genes were significantly up-regulated under solo or combination stress conditions, for example, the expression of NhRbohE was specifically expressed under heat stress, indicating some genes may be involved in the process of stress tolerance in N. haitanensis.

Theoretically, the genes belonging to same gene family were originated through gene duplication, which is one of the most important mechanisms for evolutionary novelties (Ganko et al. 2007). The divergence of expression patterns following duplication events has drawn great attention in recent studies (Li et al. 2009). Among different NhRboh genes, highly divergence in cis-acting elements of the up-stream regions, and highly divergent expression profiles based on qRT-PCR and omics analysis (Figs. 3 and 4), were observed. Thus, the subfunctionalization model for duplicate gene could explain the profiles of expression divergence between genes (Lynch et al. 2001), in which the distinct physiological functions of these Rboh genes are likely to have arisen through subfunctionalization based on the specialized expression patterns.

In conclusion, 10 putative NhRboh genes were identified from the genome of Neoporphyra haitanensis, 6 of which were in the conserved syntenic regions. Expression analysis indicated that 8 NhRboh genes were divergently expressed under stress conditions of dehydration, heat stress and co-stresses of heat and dehydration, which also suggest some genes may be involved in the process of stress tolerance in N. haitanensis. This study provides valuable information direction and theoretical support for further research on Rboh genes in N. haitanensis.

Acknowledgments

The authors would like to thanks Mr. Fang-Run Yao for his help on synteny analysis.

Funding Declarations

This work was supported by the National Key Research and Development Program of China [2018YFD0900606].

Competing Interests

The authors declare no competing interests.

Availability of Data and Material

The datasets generated during the current study are available from the corresponding author on reasonable request.

Code Availability

Not applicable

Author Contribution Statement

Da-Hai Gao: Conceptualization, Methodology, Investigation, Data analysis, Writing-Original draft. Tian-Yu Gui: Sample preparation, Data analysis. Lin-Bin Huang: Funding acquisition, Investigation, Data analysis, Writing-review & editing. Xing-Hong Yan: Conceptualization, Supervision, Funding acquisition. All authors read and approved the final version of the manuscript.

Cao M, Xu KP, Yu XZ, Bi GQ, Liu Y, Kong FN, Sun PP, Tang XH, Du GY, Ge Y, Wang DM, Mao YX (2020) A chromosome-level genome assembly of Pyropia haitanensis (Bangiales, Rhodophyta). Molecular Ecology Resources 20:216–227
Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y, Xia R (2020) TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular Plant 13:1194–1202
Chen HM, Chu JS, Chen JJ, Luo QJ, Wang H, Lu R, Zhu Z, Yuan G, Yi X, Mao Y, Lu C, Wang Z, Gu D, Jin Z, Zhang C, Weng Z, Li S, Yan X, Yang R (2022) Insights into the ancient adaptation to intertidal environments by red algae based on a genomic and multiomics investigation of Neoporphyra haitanensis. Molecular Biology and Evolution 39:1–18 doi:10.1093/molbev/msab315
Danquah A, de Zelicourt A, Colcombet J, Hirt H (2014) The role of ABA and MAPK signaling pathways in plant abiotic stress responses. Biotechnology Advances 32:40–52 doi:10.1016/j.biotechadv.2013.09.006
Ding HC, Fei QJ, Zhang P, Wang TG, Yan XH (2020) Isolation and characterization of a heat-resistant strain with high yield of Pyropia haitanensis induced by Ultraviolet ray. Aquaculture 521:735050
Ganko EW, Meyers BC, Vision TJ (2007) Divergence in expression between duplicated genes in Arabidopsis. Molecular Biology and Evolution 24:2298–2309 doi:10.1093/molbev/msm158
Groom QJ, Torres MA, Fordham-Skelton AP, Hammond-Kosack KE, Robinson NJ, Jones JD (1996) RbohA, a rice homologue of the mammalian gp91^phox respiratory burst oxidase gene. Plant Jounal 10:515–522 doi:10.1046/j.1365-313x.1996.10030515.x
Gui TY, Gao DH, Ding HC, Yan XH (2022) Identification of respiratory burst oxidase homolog (Rboh) family genes from Pyropia yezoensis and their correlation with archeospore release. Frontiers in Plant Science 13:929299 doi:10.3389/fpls.2022.929299
Hervé C, Tonon T, Collén J, Corre E, Boyen C (2006) NADPH oxidases in Eukaryotes: red algae provide new hints! Current Genetics 49:190–204 doi:10.1007/s00294-005-0044-z
Huang LB, Peng LN, Yan XH (2021) Multi-omics responses of red algae Pyropia haitanensis to intertidal desiccation during low tides. Algal Research 58:102376 doi:10.1016/j.algal.2021.102376
Kimura S, Hunter K, Vaahtera L, Tran HC, Citterico M, Vaattovaara A, Rokka A, Stolze SC, Harzen A, Meißner L, Wilkens MMT, Hamann T, Toyota M, Nakagami H, Wrzaczek M (2020) CRK2 and c-terminal phosphorylation of NADPH oxidase RBOHD regulate reactive oxygen species production in Arabidopsis. Plant Cell 32:1063–1080 doi:10.1105/tpc.19.00525
Li B, Chen CS, Xu Y, Ji DH, Xie CT (2014) Validation of housekeeping genes as internal controls for studying the gene expression in Pyropia haitanensis (Bangiales, Rhodophyta) by quantitative real-time PCR. Acta Oceanologica Sinica 33:152–159
Li Z, Zhang H, Ge S, Gu X, Gao G, Luo J (2009) Expression pattern divergence of duplicated genes in rice. BMC Bioinformatics 10 Suppl 6:S8 doi:10.1186/1471-2105-10-s6-s8
Lin F, Zhang Y, Jiang MY (2009) Alternative splicing and differential expression of two transcripts of nicotine adenine dinucleotide phosphate oxidase B gene from Zea mays. Journal of Integrative Plant Biology 51:287–298 doi:10.1111/j.1744-7909.2008.00808.x
Luo QJ, Zhu ZJ, Yang R, Qian FJ, Yan XJ, Chen HM (2014) Characterization of a respiratory burst oxidase homologue from Pyropia haitanensis with unique molecular phylogeny and rapid stress response. Journal of Applied Phycology 27:945–955 doi:10.1007/s10811-014-0391-6
Lynch M, O'Hely M, Walsh B, Force A (2001) The probability of preservation of a newly arisen gene duplicate. Genetics 159:1789–1804
Shi J, Wang W, Lin Y, Xu K, Xu Y, Ji D, Chen C, Xie C (2019) Insight into transketolase of Pyropia haitanensis under desiccation stress based on integrative analysis of omics and transformation. BMC Plant Biology 19:475 doi:10.1186/s12870-019-2076-4
Shim E, Lee JW, Park H, Zuccarello GC, Kim GH (2022) Hydrogen peroxide signalling mediates fertilization and post-fertilization development in the red alga Bostrychia moritziana. Journal of Experimental Botany 73:727–741 doi:10.1093/jxb/erab453
Suzuki N, Miller G, Morales J, Shulaev V, Torres MA, Mittler R (2011) Respiratory burst oxidases: the engines of ROS signaling. Current Opinion in Plant Biology 14:691–699 doi:10.1016/j.pbi.2011.07.014
Torres MA, Dangl JL (2005) Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Current Opinion in Plant Biology 8:397–403 doi:10.1016/j.pbi.2005.05.014
Vermot A, Petit-Härtlein I, Smith SME, Fieschi F (2021) NADPH oxidases (NOX): an overview from discovery, molecular mechanisms to physiology and pathology. Antioxidants (Basel) 10:890 doi:10.3390/antiox10060890
Wang DM, Yu XZ, Xu KP, Bi GQ, Cao M, Zelzion E, Fu CX, Sun PP, Liu Y, Kong FN, Du GY, Tang XH, Yang RJ, Wang JH, Tang L, Wang L, Zhao YJ, Ge Y, Zhuang YY, Mo ZL, Chen Y, Gao T, Guan XW, Chen R, Qu WH, Sun B, Bhattacharya D, Mao YX (2020a) Pyropia yezoensis genome reveals diverse mechanisms of carbon acquisition in the intertidal environment. Nature Communications 11:4028
Wang R, He F, Ning Y, Wang GL (2020b) Fine-tuning of RBOH-mediated ROS signaling in plant immunity. Trends in Plant Science 25:1060–1062 doi:10.1016/j.tplants.2020.08.001
Wang W, Chen D, Liu D, Cheng Y, Zhang X, Song L, Hu M, Dong J, Shen F (2020c) Comprehensive analysis of the Gossypium hirsutum L. respiratory burst oxidase homolog (Ghrboh) gene family. BMC Genomics 21:91 doi:10.1186/s12864-020-6503-6
Wang W, Chen D, Zhang X, Liu D, Cheng Y, Shen F (2018) Role of plant respiratory burst oxidase homologs in stress responses. Free Radical Research 52:826–839 doi:10.1080/10715762.2018.1473572
Wong HL, Pinontoan R, Hayashi K, Tabata R, Yaeno T, Hasegawa K, Kojima C, Yoshioka H, Iba K, Kawasaki T, Shimamoto K (2007) Regulation of rice NADPH oxidase by binding of Rac GTPase to its N-terminal extension. Plant Cell 19:4022–4034 doi:10.1105/tpc.107.055624
Yan XH, Lv F, Liu CJ, Zheng YF (2010) Selection and characterization of a high-temperature tolerant strain of Porphyra haitanensis Chang et Zheng (Bangiales, Rhodophyta). Journal of Applied Phycology 22:511–516 doi:10.1007/s10811-009-9486-x
Yang XW, Huang LB, Yan XH (2022) Effects of high-temperature stress on photosynthesis of a new variety "SF-2" in Neoporphyra haitanensis. Journal of Applied Phycology doi:10.1007/s10811-022-02825-9
Yoshida T, Mogami J, Yamaguchi-Shinozaki K (2014) ABA-dependent and ABA-independent signaling in response to osmotic stress in plants. Current Opinion in Plant Biology 21:133–139 doi:10.1016/j.pbi.2014.07.009

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Identification of Rboh genes from Neoporphyra haitanensis and their expression profiling under stress conditions

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Experimental material and stress treatment

2.2. Gene identification and bioinformatics analysis

2.3. Chromosomal localization and genome-wide synteny analysis

2.4. Gene expression analysis

3. Results

3.1. Identification of Rboh genes and physicochemical characteristics of Rboh proteins in N. haitanensis

3.2. Chromosomal localization and genome-wide synteny analysis of Rboh genes from N. haitanensis and N. yezoensis

3.3. Cis-acting elements analysis of Rboh genes of N. haitanensis

3.4. qRT-PCR analysis of Rboh genes of N. haitanensis under different stresses conditions

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1