Cholecalciferol modulates fatty acid metabolism and calcium homeostasis in the heart

doi:10.21203/rs.3.rs-2226189/v1

Download PDF

Research Article

Cholecalciferol modulates fatty acid metabolism and calcium homeostasis in the heart

https://doi.org/10.21203/rs.3.rs-2226189/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

Besides the traditional role in regulating calcium metabolism, vitamin D regulates energy metabolism and heart function. Based on the data that cholecalciferol improved insulin signaling and glucose metabolism in the heart and reduced circulating non-esterified fatty acids, we examined the effect of this vitamin on the metabolism of fatty acids in the heart and the consequences on calcium handling responsible for regulating myocardial contraction-relaxation.

Methods

Twelve-week-old rats (n = 10 per group) were treated with cholecalciferol for six weeks. Blood lipid profile was determined. Western blot and qRT-PCR were used to examine protein and mRNA expression.

Results

Cholecalciferol did not affect the expression of proteins involved in the transport of fatty acids in plasma membranes and mitochondria of heart cells, the expression of the β-oxidation enzyme, acyl-CoA dehydrogenase long chain, and the level of peroxisome proliferator-activated receptor alfa and Lipin1 in nuclear extract of heart cells. However, cholecalciferol-treated rats had increased acetyl CoA carboxylase 2 protein expression and decreased expression of malonyl CoA decarboxylase that regulates carnitine palmitoyltransferase–1 function via malonyl-coenzyme A. In addition, the expression of uncoupling protein 3 was elevated. Also, the level of peroxisome proliferator-activated receptor-gamma coactivator in the nucleus of heart cells was increased along with the level of sarcoplasmic/endoplasmic reticulum Ca²⁺ ATPase in microsomal fraction. In parallel, the expression of L-type calcium channel and ryanodine receptor was reduced.

Conclusion

In the heart of healthy rats, cholecalciferol moderately attenuates fatty acid metabolism and fine-tunes calcium handling in terms of reducing calcium levels in the cytosol.

Vitamin D

Heart

Fatty acid metabolism

Calcium handling

Metabolic flexibility is a fundamental feature of the heart's energy metabolism, necessary to fulfill its function. It implies the existence of highly efficient metabolic machinery that allows the use of different substrates, depending on their availability [1]. Under normal conditions, the heart mainly uses energy from fatty acids (FA) oxidation. At the same time, a smaller share is made up of energy obtained by oxidation of pyruvate formed in glycolysis as well as by oxidation of lactate [1].

The heart primarily obtains FA from circulation. Upon entering the cardiomyocytes, most of the FA is esterified into fatty acyl-CoA and transported to the mitochondria [2]. Finally, in mitochondria, FAs enter β-oxidation to produce acetyl-CoA, which enters the tricarboxylic acid cycle for ATP production [2].

Continuous contractile activity of the heart requires high energy expenditure and precise regulation of intracellular Ca2 + concentration. Rhythmic contractions and relaxations of cardiomyocytes require cyclic changes in intracellular Ca2 + concentration and are regulated by ion channels and exchangers [3]. Transient increase in Ca2 + concentration in the cytosol activates cross-bridge cycling of myofilaments and muscle contraction [1, 3]. Most of the ATP produced in mitochondria is expended on these processes [1].

Agents that would act to optimize the metabolism of the substrate in the heart, while not causing adverse hemodynamic effects, are particularly interesting because they could work with existing therapies [4]. Vitamin D is best known for its role in calcium absorption and bone mineralization [5]. However, the presence of vitamin D receptors in cardiomyocytes as well as in the endothelial and vascular smooth muscle cells has indicated a role of vitamin D in the cardiovascular system [5]. Low vitamin D levels are associated with an increased risk of cardiovascular disease [6]. In addition, literature data have suggested that vitamin D plays a role in regulating energy metabolism [7]. Since maintaining a balance of energy metabolism is necessary to maintain normal heart function, vitamin D/VDR is thought to play a role in protecting cardiomyocytes by regulating the use of FA [7]. Considering all this, vitamin D seems to be a good candidate for additional therapy that would affect pathological changes in the diabetic heart.

As we recently reported, vitamin D treatment improved insulin signaling and stimulated the metabolism of glucose in the heart of healthy rats. Vitamin D also reduced the concentration of non-esterified fatty acids (NEFA) in circulation [8]. Therefore, we assumed that the observed changes strongly reflect the metabolism of FA in the heart. Meanwhile, our assumption was strongly supported by the finding that vitamin D3 reduced lipid consumption and stimulated glucose uptake in the heart of hyperlipidemic mice [7]. We hypothesize that vitamin D, in addition to the indirect effect through the availability of NEFA, has a direct effect on the regulation of energy metabolism and the contraction-relaxation process in the heart under physiological conditions.

Chemicals

Cholecalciferol, a form of vitamin D, was provided by Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Antibodies raised against sarcoplasmic/endoplasmic reticulum Ca²⁺ ATPase (SERCA2, sc-376235), Carnitine palmitoyltransferase–1 (CPT1, sc-98834), Lipin1 (sc-98450), fatty acid transport protein 1 (FATP1, sc-25541), FA translocase CD36 (sc-9154), peroxisome proliferator-activated receptor alpha (PPARα, sc-398394), Na⁺/Ca²⁺ exchanger (NCX1, sc-30304-R), L-type calcium channels (LTCC, sc-398433), and β-actin (sc-1616-R), as well as secondary horseradish peroxidase (HRP)-conjugated anti-rabbit, and anti-mouse antibodies, were also obtained from Santa Cruz Biotechnology, Inc. Anti-phospho- acetyl-CoA carboxylase (Ser79) (ACC, #3661S), and anti-ACC (#3676S) antibodies were obtained from Cell Signaling Technology Inc. (Danvers, MA, USA), while antibodies against Peroxisome proliferator-activated receptor-gamma coactivator (PGC-1, ab54481), and Calnexin (ab22595) were obtained from Abcam (Cambridge, UK). Reagents for the bicinchoninic acid (BCA) assay were purchased from SERVA Electrophoresis GmbH (Heidelberg, Germany). Electrophoretic reagents were purchased from Sigma-Aldrich Corporation (St. Louis, MO, USA).

Animals

All animal procedures were in compliance with the EU Directive (2010/63/EU) on the protection of animals used for experimental and other scientific purposes. The experimental protocol was approved by the Serbian Ministry of Agriculture and Environmental Protection after validation by the Ethical Committee of the “Vinca” Institute of Nuclear Sciences, University of Belgrade. Twelve-week-old Wistar rats were divided into the control group (n = 10) and the vitamin D group (n = 10). They were fed ad libitum with standard chow, with ad libitum access to drinking water, and maintained at 22 ± 2°C under a 12 h/ 12 h light/dark cycle. During the six weeks, rats from the vitamin D group were intraperitoneally injected with 1000IU/kg of cholecalciferol in corn oil every second day. The rats from the control group were injected with the vehicle at the same volume. According to the literature [9] and our previous work [8], the applied dose of cholecalciferol does not lead to hypercalcemia. Animals were sacrificed by decapitation 24h after the last treatment, thus avoiding the acute effect of cholecalciferol. At the time of sacrifice, blood was collected, and the hearts were isolated, measured, and stored at -80°C until the preparation of samples for the Western blot and qRT-PCR analysis.

Blood plasma preparation and biochemical measurements

Before measurement of biochemical parameters, rats fasted overnight. For the determination of triglyceride, total cholesterol, HDL, and LDL concentration, blood was collected in anticoagulant-coated tubes at decapitation, and plasma samples were obtained by centrifugation. Triglyceride, total cholesterol, HDL, and LDL concentrations were measured using the Bio Systems analyzer A25 (Barcelona, Spain).

Cell lysate

Heart tissue was homogenized in modified RIPA buffer ( 50 mmol/l Tris-HCl, pH 7.4, 150 mmol/l NaCl, 1% Triton X-100, 0.2% Na-deoxycholate, 0.2% SDS, 1 mmol/l EDTA, protease inhibitors, phosphatase inhibitors) in 1:6 (w/v) ratio, on ice with an Ultra-Turrax homogenizer (3 × 30 sec). The supernatant, representing the cell lysate, was obtained by centrifugation of the homogenate at 15000 × g for 30 minutes. After protein concentration assessment by the BCA method, samples were prepared for Western blot analysis.

Plasma membrane isolation

The plasma membrane isolation protocol was performed according to Luiken et al. [10]. Heart tissue samples were incubated for 30 minutes at 4° C in preincubation buffer (2 M NaCl, 20 mM HEPES, 5 mM NaN3, pH 7.4) and then centrifuged (5 min, 1000 × g). The resulting pellets were homogenized on ice with Ultra-Turrax homogenizer (3 × 30 sec) in TES buffer (20 mM Tris, 1 mM EDTA, 250 mM sucrose) with protease inhibitors. The homogenates were centrifuged (5 min, 1000 × g). The pellets were rehomogenized in TES buffer in a glass-glass homogenizer, after which supernatants were added. From the next centrifugation (10 min, 100 × g), the supernatants were separated and centrifuged (10 min, 5000 × g). The pellets obtained were a fraction of plasma membranes, in which the protein concentration was determined by the BCA method, and samples for the Western blot analysis were prepared.

Nuclear and microsomal extract isolation

Heart tissue samples were homogenized on ice with Ultra-Turrax homogenizer (3 × 30 sec) in TEMG buffer (50 mM Tris-HCl, 1 mM EDTA, 12 mM monothioglycerol, 10% glycerol, pH 7.5 with protease and phosphatase inhibitors) and then centrifuged (15 min, 1000 × g). Pellets (P1) were further used to obtain the nuclear fraction, while supernatants (S1) were used to obtain the microsomal fractions. P1 was washed once in TMG buffer (20 mM Tris-HCl, 12 mM monothioglycerol, 10% glycerol, pH 7.5) and twice in TMG buffer with 0.2% Triton X-100. Centrifugation (15 min, 1000 × g) was performed between each wash. The washed pellets were resuspended in lysis buffer (TEMG + 0.5 M KCl) and left on ice for 60 minutes with stirring with a glass rod every 15 minutes. After lysis, the suspensions were centrifuged (60 min, 105000 × g). The obtained supernatants were a nuclear fraction in which the protein concentration was determined by the Lowry macro method. S1 was centrifuged (30 min, 12000 × g) at 4° C, and then the supernatants were centrifuged (60 min, 100000 × g). Pellets were resuspended in TEMG buffer and represented microsomal fractions. Protein concentration was determined by the Lowry macro method. All samples were prepared for Western blot analysis.

SDS polyacrylamide electrophoresis and Western blot

Proteins were separated by SDS- polyacrylamide gel electrophoresis using 7.5% polyacrylamide gel and then transferred from the gel to a PVDF membrane. After Ponceau staining and imaging, membranes were blocked in 5% skim milk in tris-buffered saline (TBS) with 0.1% Tween 20 (TBST) and blotted with an antibody against CD36, FATP1, PPARα, Lipin1, PGC-1, phospho-ACC, CPT1, LTCC, SERCA2, and NCX1. After extensive washing, membranes were incubated with secondary HRP-conjugated antibodies and used for detection with ECL substrate. After blotting with phospho-ACC, the membrane was stripped and reprobed with an antibody against ACC. Protein loading was controlled by probing blots with the β-actin antibody for lysate samples, calnexin antibody for microsomal samples, and normalizing proteins band density to β-actin or calnexin band density, respectively. Ponceau stained membrane was the loading control for the plasma membrane and nuclear samples. Films were scanned, and band density was analyzed using ImageJ software (NIH, USA).

Quantitative real-time PCR (qRT-PCR) analysis

Total RNA was extracted from rat heart tissues using TRI Reagent (Ambion Inc., Foster City, CA, USA) following the manufacturer’s instructions. The single-stranded cDNA was synthesized from 1 µg of total RNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Warrington, UK). Real-time PCR was performed on Real-time 7500 system (Applied Biosystems, Foster City, CA, USA) using Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK). Primer sequences are listed in Table 1. A standard curve was made for all primers, and PCR efficiency values were similar. All reactions were performed in duplicates, in a total volume of 10 µL of reaction mixtures under the following conditions: initial denaturation at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 60 s. The relative mRNA expression was assayed using the 2^−ΔCt formula, where ΔCt = Ct (target gene) − Ct (housekeeping gene) and normalized to that of RPL19 mRNA.

Table 1

Primer sequences of genes used in the qRT-PCR method
Gene symbol	Forward primer (5’-3’)	Reverse primer (5’-3’)
acadl	GGAATGAAAGCCCAGGACACAG	TCAAACATGAACTCACAGGCAGAA
rpl19	TCGCCAATGCCAACTCTC	AGCCCGGGAATGGACAGT
ucp3	GACTCACAGGCAGCAAAGGAA	GAGGAGATCAGCAAAACAGGC
mlycd	ACTTCTTCTCCCACTGCTCC	GCTTTATGAGGAAGGTGCCG
spt1	CAGTGCAGCCTGCTTTGCTA	GCCTTTCGAGGATTCTTTTGATC
ryr2	GGCTTCTTCCGCATTGTCTC	TCTCCTCGCACCTCATCCT
acadl: Acyl-CoA Dehydrogenase Long Chain; rpl19: Ribosomal Protein L19; ucp3: Uncoupling protein 3; mlycd: Malonyl-CoA Decarboxylase; spt1: Serine palmitoyltransferase 1; ryr2: Ryanodine receptor 2.

Statistical analysis

All results are expressed as mean ± SD. Statistical analysis was determined by Student’s t-test (2 groups were compared: vitamin D-treated group vs. control group). P < .05 was considered significant. The number of animals used in the analysis is 10 per group and 6 per group for Western blot and qRT-PCR, respectively.

The plasma lipid profile is presented in Table 2. Vitamin D treatment did not alter plasma triglyceride (TG) or cholesterol levels.

Table 2

Effect of cholecalciferol on plasma lipid profile in rats
	Control	Vitamin D
TG	0.53 ± 0.15	0.47 ± 0.12
Total-Ch	1.47 ± 0.21	1.46 ± 0.34
HDL-Ch	0.81 ± 0.14	0.84 ± 0.16
LDL-Ch	0.17 ± 0.04	0.15 ± 0.06
All parameters were determined in the plasma. Data are presented as mean ± SD from the experiment with 10 animals per group. Abbreviations: TG- Triglycerides; Ch- cholesterol; HDL- high-density lipoprotein; LDL- low-density lipoprotein.

Effects of Vitamin D on FA transport in the heart were assessed by protein expression analysis of primary FA transporters in the plasma membrane, CD36, and FATP1. The expression of neither of these two transporters was altered upon treatment (Fig. 1). Changes in protein expression of CPT1, the key regulatory enzyme that controls the rate of FA uptake by the mitochondria, were not observed (Fig. 2a).

Regarding the metabolism of FA in the heart, the effects of vitamin D were assessed by protein or mRNA content analysis of important molecules involved in β-oxidation. Since malonyl-CoA is a key regulator of FA oxidation, we analyzed the effects of vitamin D treatment on enzymes responsible for its formation and degradation, ACC and malonyl-CoA decarboxylase (MCD). Vitamin D treatment increased the protein level of ACC (p < .01), while it did not affect the inhibitory phosphorylation of ACC on Ser79 (Fig. 2a). Also, gene expression analysis by qRT-PCR method revealed that treatment significantly decreased gene expression of MCD (p < .05, Fig. 2b).

In nuclear fraction, we determined the expression level of transcriptional regulators of FA β-oxidation. Lipin1 and PPARα protein content remained unchanged after vitamin D treatment, while PGC-1 nuclear protein level was increased (p < .01, Fig. 3a). Also, gene expression of acyl-CoA dehydrogenase long-chain (ACADL), the enzyme that catalyzes the initial step of mitochondrial β-oxidation, was not changed (Fig. 3b). We also examined uncoupling protein 3 (UCP3) protein expression. Although the role of uncoupling proteins expressed in tissues that do not have the ability of adaptive thermogenesis is mainly unknown, their expression in the heart could be related to FA metabolism. Vitamin D treatment led to an increase in UCP3 gene expression (p < .05), which was detected by the qRT-PCR method (Fig. 3c).

The protein content of Lipin1 was measured in the microsomal fraction to investigate whether vitamin D treatment affects TG synthesis in the heart. The protein expression level of Lipin1 in the microsomal fraction was similar between the two experimental groups (Fig. 4a). Another biosynthesis pathway in the heart that could be driven by FA entry is the synthesis of ceramide. Measuring gene expression of serine palmitoyltransferase 1 (SPT1), an enzyme involved in this pathway, it was demonstrated that vitamin D treatment decreased its mRNA level (p < .01, Fig. 4b).

As the metabolism of FA and the availability of nutrients can affect the functioning of Ca²⁺ handling proteins in the heart, their expression was examined. Protein expression of LTCC in the lysate was decreased (p < .001, Fig. 5a) as well as ryanodine receptor (RyR2) channel gene expression (p < .05, Fig. 5b). Regarding proteins involved in the relaxation phase, an increase in SERCA2 protein expression was observed in the microsomal fraction (p < .05), while there was no change in the protein content of NCX1 in the whole-cell lysate (Fig. 5a).

Pathological conditions lead to the disturbance of molecular processes necessary for the heart's normal functioning. As a consequence of hyperglycemia and insulin resistance in diabetes, a specific set of changes in the heart called diabetic cardiomyopathy occurs [11]. Calcium signaling is disturbed, resulting in altered relaxation-contraction dynamics [2]. On the other hand, in diabetic cardiomyopathy, insulin signal transduction and glucose uptake into the heart are characteristically reduced, resulting in a shift to excessive use of FA as an energy source [2, 12]. Since glucose is a critical substrate in conditions such as hypoxia and ischemia, this shift in balance puts the heart in a metabolically inflexible and less efficient state [12]. Increased FA utilization and oxidation in this state lead to the accumulation of toxic lipid metabolites and the formation of oxidative stress and inflammation [12].

Many studies have pointed to the role of vitamin D deficiency in the pathogenesis of diabetes [13]. Obesity, as one of the main risk factors for diabetes, is a chronic inflammatory disease associated with low levels of vitamin D, and they are a risk factor for heart disease [6].

Regulation of the use of FA as an energy source for the cardiac function is performed at various levels starting from the levels of circulating FA, through their transport across the cardiac cell membrane and esterification, to the mitochondrial entry and degradation in the oxidation process [14].

In this study, we did not observe changes in the expression of the most important cardiac transporters of FA, CD36 and FATP1. This finding is in line with the study of Yang et al. [7], which also showed that the level of CD36 transporters in the heart does not change under the action of vitamin D in hyperlipidemic mice, confirming that it does not affect the transport of FA in the heart. CPT1, a marker of mitochondrial FA uptake, was also unchanged by vitamin D administration. In contrast to our study, Yang and coworkers [7] observed that vitamin D reduced CPT1 level in the heart of hyperlipidemic mice.

Cholecalciferol did not alter the nuclear content of the most important regulators of β-oxidation in the heart or the expression of the enzymes involved in this process. However, vitamin D affected the expression of ACC/MCD that participate in the malonyl-CoA-mediated regulation of β-oxidation. Deletion of MCD is associated with increased levels of malonyl-CoA and a shift in the balance of oxidation of energy substrates from FA to glucose in the heart after ischemia/reperfusion injury [15]. Although an increase in TG levels is expected in such an experimental model, the opposite has been observed. The deletion of MCD was also accompanied by a reduction in SPT1 [15], which we also observed. This reduction suggests reduced biosynthesis of harmful ceramides in the heart in parallel with a decrease in MCD level [16]. Furthermore, downregulation of SPT1 level contributes to the improved myocardial insulin sensitivity and glucose utilization in the heart of obese mice [17], which we also recognized in healthy rats [8].

Increased UCP3 gene expression in cholecalciferol-treated rats may also be interpreted as a cardiac benefit. Namely, it is known that UCP proteins act to reduce the production of ROS, oxidative stress, and lipotoxicity but also increase the survival of heart cells [18]. We did not directly correlate the changes in UCP3 expression with the observed changes in FA metabolism. There is a possibility that UCP3 level correlates with pro-survival Akt/GSK3 pathway activity [19], which we have shown in a previous study to be stimulated in the heart of cholecalciferol-treated rats [8]. There are also data that the expression of UCP3 in the heart is reduced in the state of hyperinsulinemia [20]. As treatment with cholecalciferol showed a tendency to reduce insulin concentration in our study [8], this can be related to increased expression of the UCP3 gene.

If we assume that an increase in PGC-1level in the nuclear extract is not associated with the direct regulation of β-oxidation because the content of PGC-1 partners, PPARα and Lipin1, in the nuclear extract was not altered, perhaps this alteration may be associated with other cardiac processes. For example, this result coincided with an increase in the nuclear content of vitamin D receptor (VDR), which we observed in a previous study [8]. PGC-1 has been shown to enter a complex with VDR and participate as a coactivator in gene regulation [21].

In addition, an increase in nuclear PGC-1 may be associated with increased SERCA2 expression in the heart cells of cholecalciferol-treated rats in this study, as suggested in the study of Lv et al. [22]. This could be one of the mechanisms coupling cardiac energy metabolism with Ca²⁺ handling and myocardial contractility. The probable physiological outcome is increased calcium uptake into the SR during myocardial relaxation. In other words, these findings strongly indicate that vitamin D via PGC-1 could improve the capacity of ventricular diastole, accelerating Ca²⁺ clearance through SERCA2. Cardiac overexpression of SERCA2 improves myocardial contractility in diabetic rats and protects against the development of arrhythmias [2, 3]. Increased expression of SERCA2 protein also coincides with increased glucose metabolism [23], as we also reported in a previous paper [8]. A possible mechanism responsible for the increased presence of PGC-1 in the nucleus and SERCA2 level could be increased sirtuin 1 (SIRT1) activity [24, 25]. In addition, in the heart of rats treated with vitamin D, the expression of molecules involved in increasing the content of cytosolic Ca²⁺ during myocardial systole (LTCC and RyR2) was reduced. Although the abnormal function of LTCC and RyR2 are involved in cardiac pathologies, particularly arrhythmogenesis [3], we believe that vitamin D-induced alterations of these molecules' expression observed in this study are delicate modulations of Ca²⁺ handling inside a physiological range.

What actually connects FA metabolism and calcium transport mechanisms responsible for regulating myocardial excitation and contraction? A large part of the total ATP produced in energy metabolism is spent on heart contraction, where SERCA2 consumes about one-third [26]. In addition, it has been observed that intracellular calcium level affects the selection of cardiac energy substrate [27].

Angin and coworkers detected an association between high cytosol calcium and increased levels of GLUT4 and CD36 in sarcolemma [28]. In addition, Balu et al. observed that a high level of calcium in the cytosol stimulated the oxidation of FA [29]. Taking into account the status of proteins involved in calcium handling in our study, a decrease in cytosol calcium was indicated, which coincided with unchanged levels of GLUT4 [8] and CD36 in the plasma membrane and unchanged β-oxidation parameters.

A possible mechanism that connects the observed changes in FA metabolism with the changes in the expression of proteins involved in maintaining calcium homeostasis is proposed by Aitken-Buck et al. [30]. Namely, increased production of long-chain acylcarnitine by the CPT1 leads to increased cytosol Ca²⁺ in cardiomyocytes. Decreases in the expression of LTCC and RyR2, as well as increases in the levels of SERCA2, detected in the hearts of cholecalciferol-treated rats, may indicate decreased CPT1 activity, despite unchanged expression. This is also indicated by increased ACC expression and decreased MCD expression, which can reduce CPT1 activity through an increased level of malonyl-CoA.

To conclude, the impression is that vitamin D attained subtle attenuation of FA metabolism in the heart, which is associated with a fine-tuning effect on the heart contraction-relaxation cycle in the direction of suppressing systole and stimulating diastole (Fig. 6). In the diabetic heart uptake and oxidation of FA are increased at the expense of glucose. Agents that reduce the concentration of FA in the circulation and their β-oxidation in heart cells, such as cholecalciferol, can be considered potential pharmaceuticals in human medicine. The results obtained in this study, along with literature data on the effects of diabetes on cardiac lipid metabolism and Ca²⁺ handling, nominate cholecalciferol as potentially beneficial in optimizing the metabolism of substrates in the diabetic heart.

Author contributions

The authors’ responsibilities were as follows: GK, TI, and TC designed the protocol; TI, ST, SR, MS, MK, and JS performed the experiments and analyzed the data; GK, TI, and TC wrote the manuscript; and all the authors read and approved the manuscript.

Funding

This work was supported by the Ministry of Education, Science and Technological Development, Republic of Serbia (Grants No: 451-03-68/2022-14/200017).

Conflict of interest

The authors declare that they do not have any conflict of interest.

Ethics approval

Consent to participate

Not applicable

Consent for publication

Not applicable

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Bertero E, Maack C. Metabolic remodelling in heart failure. Nat Rev Cardiol. 2018;15:457–70.
Bayeva M, Sawicki KT, Ardehali H. Taking Diabetes to Heart—Deregulation of Myocardial Lipid Metabolism in Diabetic Cardiomyopathy. J Am Heart Assoc. 2013;2.
Hamilton S, Terentyev D. Proarrhythmic Remodeling of Calcium Homeostasis in Cardiac Disease; Implications for Diabetes and Obesity. Front Physiol. 2018;9.
Stanley WC, Recchia FA, Lopaschuk GD. Myocardial substrate metabolism in the normal and failing heart. Physiol Rev. 2005;85:1093–129.
Latic N, Erben RG. Vitamin D and Cardiovascular Disease, with Emphasis on Hypertension, Atherosclerosis, and Heart Failure. Int J Mol Sci. 2020;21:6483.
Rai V, Agrawal DK. Role of Vitamin D in Cardiovascular Diseases. Endocrinol Metab Clin North Am. 2017;46:1039–59.
Yang J, Zhang Y, Pan Y, Sun C, Liu Z, Liu N, et al. The Protective Effect of 1,25(OH)2D3 on Myocardial Function is Mediated via Sirtuin 3-Regulated Fatty Acid Metabolism. Front Cell Dev Biol. 2021;9.
Ivkovic T, Culafic T, Tepavcevic S, Romic S, Stojiljkovic M, Kostic M, et al. Cholecalciferol ameliorates insulin signalling and insulin regulation of enzymes involved in glucose metabolism in the rat heart. Arch Physiol Biochem. 2021;0:1–9.
Salum E, Kampus P, Zilmer M, Eha J, Butlin M, Avolio AP, et al. Effect of vitamin D on aortic remodeling in streptozotocin-induced diabetes. Cardiovasc Diabetol. 2012;11:58.
Luiken JJFP, Koonen DPY, Willems J, Zorzano A, Becker C, Fischer Y, et al. Insulin stimulates long-chain fatty acid utilization by rat cardiac myocytes through cellular redistribution of FAT/CD36. Diabetes. 2002;51:3113–9.
Toedebusch R, Belenchia A, Pulakat L. Diabetic Cardiomyopathy: Impact of Biological Sex on Disease Development and Molecular Signatures. Front Physiol. 2018;9.
Salvatore T, Pafundi PC, Galiero R, Albanese G, Di Martino A, Caturano A, et al. The Diabetic Cardiomyopathy: The Contributing Pathophysiological Mechanisms. Front Med. 2021;8.
Mozos I, Marginean O. Links between Vitamin D Deficiency and Cardiovascular Diseases. Biomed Res Int. 2015;2015:1–12.
Dyck JRB, Lopaschuk GD. Malonyl CoA Control of Fatty Acid Oxidation in the Ischemic Heart. J Mol Cell Cardiol. 2002;34:1099–109.
Wang W, Zhang L, Battiprolu PK, Fukushima A, Nguyen K, Milner K, et al. Malonyl CoA Decarboxylase Inhibition Improves Cardiac Function Post-Myocardial Infarction. JACC Basic to Transl Sci. 2019;4:385–400.
Samokhvalov V, Ussher JR, Fillmore N, Armstrong IKG, Keung W, Moroz D, et al. Inhibition of malonyl-CoA decarboxylase reduces the inflammatory response associated with insulin resistance. Am J Physiol Metab. 2012;303:E1459–68.
Ussher JR, Folmes CDL, Keung W, Fillmore N, Jaswal JS, Cadete VJ, et al. Inhibition of serine palmitoyl transferase I reduces cardiac ceramide levels and increases glycolysis rates following diet-induced insulin resistance. PLoS One. 2012;7.
Ruiz-Ramírez A, López-Acosta O, Barrios-Maya MA, El-Hafidi M. Cell Death and Heart Failure in Obesity: Role of Uncoupling Proteins. Oxid Med Cell Longev. 2016;2016:1–11.
Chen Y, Liu J, Zheng Y, Wang J, Wang Z, Gu S, et al. Uncoupling protein 3 mediates H2O2 preconditioning-afforded cardioprotection through the inhibition of MPTP opening. Cardiovasc Res. 2015;105:192–202.
Harmancey R, Haight DL, Watts KA, Taegtmeyer H. Chronic hyperinsulinemia causes selective insulin resistance and down-regulates uncoupling protein 3 (ucp3) through the activation of sterol regulatory element-binding protein (srebp)-1 transcription factor in the mouse heart. J Biol Chem. 2015;290:30947–61.
Savkur RS, Bramlett KS, Stayrook KR, Nagpal S, Burris TP. Coactivation of the human vitamin D receptor by the peroxisome proliferator-activated receptor γ coactivator-1 α. Mol Pharmacol. 2005;68:511–7.
Lv J, Deng C, Jiang S, Ji T, Yang Z, Wang Z, et al. Blossoming 20: The energetic regulator’s birthday unveils its versatility in cardiac diseases. Theranostics. 2019;9:466–76.
Belke DD, Swanson E, Suarez J, Scott BT, Stenbit AE, Dillmann WH. Increased expression of SERCA in the hearts of transgenic mice results in increased oxidation of glucose. Am J Physiol Circ Physiol. 2007;292:H1755–63.
Anderson RM, Barger JL, Edwards MG, Braun KH, O’connor CE, Prolla TA, et al. Dynamic regulation of PGC-1α localization and turnover implicates mitochondrial adaptation in calorie restriction and the stress response. Aging Cell. 2008;7:101–11.
Sulaiman M, Matta MJ, Sunderesan NR, Gupta MP, Periasamy M, Gupta M. Resveratrol, an activator of SIRT1, upregulates sarcoplasmic calcium ATPase and improves cardiac function in diabetic cardiomyopathy. Am J Physiol Circ Physiol. 2010;298:H833–43.
Nagoshi T, Yoshimura M, Rosano MC, Lopaschuk GD, Mochizuki G. S. Optimization of Cardiac Metabolism in Heart Failure. Curr Pharm Des. 2011;17:3846–53.
Schonekess BO, Brindley PG, Lopaschuk GD. Calcium regulation of glycolysis, glucose oxidation, and fatty acid oxidation in the aerobic and ischemic heart. Can J Physiol Pharmacol. 1995;73:1632–40.
Angin Y, Schwenk RW, Nergiz-Unal R, Hoebers N, Heemskerk JWM, Kuijpers MJ, et al. Calcium signaling recruits substrate transporters GLUT4 and CD36 to the sarcolemma without increasing cardiac substrate uptake. Am J Physiol Metab. 2014;307:E225–36.
Balu D, Ouyang J, Parakhia RA, Pitake S, Ochs RS. Ca 2 + effects on glucose transport and fatty acid oxidation in L6 skeletal muscle cell cultures. Biochem Biophys Reports. 2016;5:365–73.
Aitken-Buck HM, Krause J, Zeller T, Jones PP, Lamberts RR. Long-Chain Acylcarnitines and Cardiac Excitation-Contraction Coupling: Links to Arrhythmias. Front Physiol. 2020;11.

Download PDF

Version 1

posted

You are reading this latest preprint version

Cholecalciferol modulates fatty acid metabolism and calcium homeostasis in the heart

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Chemicals

Animals

Blood plasma preparation and biochemical measurements

Cell lysate

Plasma membrane isolation

Nuclear and microsomal extract isolation

SDS polyacrylamide electrophoresis and Western blot

Quantitative real-time PCR (qRT-PCR) analysis

Statistical analysis

Results

Discussion

Declarations

References

Status:

Version 1