Effect of melatonin on steroidogenesis-related enzyme expression and testosterone synthesis following CoCl 2 -induced hypoxia in TM3 Leydig cells

doi:10.21203/rs.3.rs-2227364/v1

Download PDF

Research Article

Effect of melatonin on steroidogenesis-related enzyme expression and testosterone synthesis following CoCl 2 -induced hypoxia in TM3 Leydig cells

https://doi.org/10.21203/rs.3.rs-2227364/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Hypoxia exerts detrimental effects on steroidogenesis and male fertility. Melatonin, a neuroendocrine hormone, modulates steroid production in mammals through its membrane receptors. This study examined the effects of melatonin treatment on steroidogenesis dysfunction and testosterone impairment following CoCl2-induced hypoxia in TM3 Leydig cells. The results indicated that CoCl2 treatment caused HIF1α overexpression in these cells. Moreover, CoCl2 treatment of TM3 Leydig cells led to considerable downregulation of StAR, 3β-HSD and GATA-4 as well as melatonin membrane receptors MT1 and MT2 mRNA/protein expression coupled with testosterone content repression in the cell culture medium. Melatonin administration inhibited HIF1α mRNA/protein expression, but had no significant effect on StAR, 3β-HSD, GATA-4, MT1 mRNA/protein expression or the testosterone level in the cell culture medium. Melatonin reduced the decrease in MT2 gene and protein expression following CoCl2-induced hypoxia in TM3 Leydig cells.

Melatonin

Hypoxia-inducible factor

Steroidogenesis

Leydig cells

Testosterone

It is estimated that infertility affects 8–12% of couples of reproductive age globally [1]. Reproductive disorders in men are responsible for 20–30% of infertility cases [2]. Male fertility can be influenced by structural disorders, immunological defects, molecular and chromosomal abnormality, environmental and lifestyle factors, idiopathic factors and endocrinological deficiency [3]. Low O₂ pressure (hypoxia) can cause pathological responses such as steroidogenesis inhibition through impairment of enzymatic steroid production [4, 5].

Environmental exposure to cobalt chloride (CoCl₂) can significantly affect male fertility in humans. Many animal models have confirmed the influence of acute and chronic exposure to CoCl₂ on male reproduction [6, 7]. CoCl₂ is a hypoxia-mimicking agent in vitro and is a chemical inducer of hypoxia-inducible factor1α (HIF1α) [8], a subunit of HIF1, which is a transcription factor that involves the adaptive response of the cell to hypoxia and has a novel role in testis function. HIF1 consists of two subunits, HIF1α and HIF1β. HIF1α is rapidly hydroxylated and degraded in normoxia. Under hypoxic conditions, HIF1α stabilizes and, after its transfer from the cytoplasm to the nucleus and its association with HIF1β, the active HIF1 transcription complex is formed. This activated complex then attaches to the hypoxia response element in the regulatory regions of the target genes [9–12]. It intercedes with the primary transcriptional responses to hypoxia and confers an adaptive role in proliferation, differentiation, energy metabolism, angiogenesis, metastasis, apoptosis and steroidogenesis [13, 14].

Testicular Leydig cells are located in the interstitial space of the seminiferous tubules in the testis. They are responsible for the synthesis and release of testosterone in mammals [15]. The steroidogenic acute regulatory (StAR) protein is involved in the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane and the enzyme CYP11A1 converts cholesterol to pregnenolone in the inner membrane of the mitochondria. Pregnenolone the is converted to testosterone by catalysis of the 3β-hydroxysteroid dehydrogenase (3β-HSD) enzyme in a smooth endoplasmic reticulum [16]. Melatonin (N-acetyl-5-methoxytryptamine) is an indoleamine hormone composed the amino acid tryptophan. It has been traditionally considered to be derived from the pineal gland and to interact with circadian rhythms [17–21]. Sources of melatonin include the testes, retina, cornea, thymus, respiratory epithelium, cerebellum, bone marrow, gastrointestinal tract and skin. Although melatonin can be found in many animal and plant foods, including fish, eggs, hazelnuts, coffee and corn, melatonin supplements are usually made of synthetic melatonin [22].

Recent evidence supports the role of melatonin in male reproduction. It plays a key role in mediating the influence of photoperiod on seasonal breeding in different animal species [23]. Melatonin acts as an inhibitor of hypothalamic gonadotropin-releasing hormone (GnRH) production via the suprachiasmatic nucleus of the hypothalamus. GnRH influences the secretion of pituitary gonadotropin hormones, including follicle-stimulating hormone and luteinizing hormone (LH), which directly control the function of Leydig cells. In addition, melatonin can pass through the blood-testis barrier and enter Leydig cells. This hormone also is synthesized in the testis and interacts with its receptor on Leydig cells to confer a direct regulatory effect on the function of these cells independent of the hypothalamic-pituitary-gonadal axis.

Melatonin affects male reproductive functions through a complex signaling pathway mediated by melatonin receptor 1 (MT1) and melatonin receptor 2 (MT2) that is consistent with environmental conditions and cell-specific reproductive action [24, 25]. Studies on rodents indicate that melatonin inhibits the expression of StAR and other key steroidogenic enzymes [26–30]. Melatonin treatment has been shown to upregulate the expression levels of StAR, 3β-HSD and other key steroidogenic enzymes in the Leydig cells of mice fed a high-fat diet and H₂O₂-treated TM3 cells [31].

Melatonin also has been shown to modulate reproductive functions and upregulate the expression of the StAR and GATA binding factor 4 (GATA-4) transcription factors in seasonally breeding mammals [32]. Studies report that long-term melatonin supplementation promotes StAR and GATA-4 expression levels in goats and rams and enhanced testosterone production, which resulted in improved sperm generation [33, 34]. The current study used the TM3 mouse Leydig cell line model to investigate the antagonistic or synergistic effects of combining melatonin and CoCl₂ treatments on steroidogenesis-related gene and protein expression and testosterone synthesis in TM3 Leydig cells.

2.1 Cell culture

The TM3 cell line was purchased from the Pasteur Institute of Iran and was maintained in DMEM/F-12 medium (Bio-IDEA; Iran) supplemented with 10% fetal bovine serum (FBS; Gibco; USA) in an incubator at 37°C and 5% CO₂. Cells attaining 70–80% confluency were divided into four groups in cell culture plates containing about 10⁶ cells in 3 ml of medium. The first group received no treatment. The MLT group was treated with a concentration of 0.5 mM melatonin (Sigma–Aldrich; USA). In the CoCl₂ group, 0.2 mM CoCl₂ (Merck; Germany) was added to the medium to induce HIF1α overexpression. The MLT + CoCl₂ group received 0.2 mM CoCl₂ and 0.5 mM melatonin. After 24 h, the cells and supernatants were collected and used for further determination.

2.2 MTT assay

About 5000 TM3 Leydig cells were seeded in each well of the 96-well plate. After 24 h of treatment, a final concentration of 0.5g/ml of MTT (Sigma–Aldrich; USA) solution in phosphate-buffered saline was added to each well. After incubation at 37°C for 4 h, the supernatant was removed and the formazan crystals produced in the cells were dissolved in 100 µ of dimethyl sulfoxide (DMSO; Merck; Germany), then the cells were incubated with DMSO for 15 min. The absorbance of the plate was measured at a wavelength of 570 nm using a microplate reader (reference 660 nm). Each experiment was performed in triplicate.

2.3 Real-time PCR

Purified total RNA (1 µg) was extracted using Trizol following manufacturer protocols and was converted to cDNA using the Stem Gene cDNA synthesis kit (Stem Gene; Iran). Real-time PCR was performed using the SYBR Green qPCR master mix (Stem Gene; Iran) on a Runmei-q 200 system (Runmei; China). PCR primers (Table 1) were designed for the MT1, MT2, GATA-4, StAR, HIF1α and 3β-HSD genes. GAPDH was used as an internal control. The fold-change in mRNA was determined using the 2^−ΔΔCt method. Each experiment was performed in triplicate.

Table 1

Primers used in this study
Gene	Primer sequence	Size (bp)	GeneBank ACC
Gapdh-forward	CATCACTGCCACCCAGAAGACTG	152	NM-001289726.1
Gapdh-reverse	ATGCCAGTGAGCTTCCCGTTCAG
Gata4-forward	GCCTCTATCACAAGATGAACGGC	148	NM-001310610.1
Gata4-reverse	TACAGGCTCACCCTCGGCATTA
Mtnr1a-forward	AACCTGCTGGTCATCCTGTCTG	113	NM-008639.3
Mtnr1a-reverse	GGGATAAGGGTAAACAGCCACC
Mtnr1b-forward	TCTCAGTGCTCAGGAACCGCAA	136	AB377276.1
Mtnr1b-reverse	AAGGACCCAACCGTCACGGATA
Hsd3b1-forward	AGAACTGCAGGAGGTCAGAGCT	117	NM-008293.4
Hsd3b1-reverse	GGCATCCAGAATGTCTCCTTCC
Star-forward	GTGCTTCATCCACTGGCTGGAA	112	NM-011485.5
Star-reverse	GTCTGCGATAGGACCTGGTTGA
Hif1α-forward	CCTGCACTGAATCAAGAGGTTGC	109	NM-001313919.1
Hif1α-reverse	CCATCAGAAGGACTTGCTGGCT

2.4 Western blot analysis

The total protein concentration was evaluated using the Bradford method. The protein was separated by 12% SDS-PAGE, then transferred to a nitrocellulose membrane. The membrane was blocked with 5% skim milk and incubated overnight at 4°C with mild shaking using the primary antibodies (Santa Cruz Biotech; USA). The membrane was washed using PBS buffer, followed by incubation with secondary antibodies (Santa Cruz Biotech; USA) for 60 min at room temperature. The membrane was washed using PBS buffer. Immunocomplexes were detected using ECL Western blot detection reagents according to the manufacturer instructions in an x-ray processor (LD-14; China). The band density was determined using the JS2000 system (Bonnin Tech; China). Each experiment was performed in triplicate.

2.5 Testosterone determination

The cultured cells and supernatants were collected and an ELISA assay kit was used to detect the testosterone content according to manufacturer instructions (AccuBind; USA). Each experiment was performed in triplicate.

2.6 Statistical analysis

Statistical analysis was performed in Graph Pad Prism 8 software (version 8.0; USA). Statistical significance was calculated using one-way ANOVA followed by the Tukey test and p < 0.05 was considered significant.

3.1 Cell viability of CoCl₂ and melatonin in mouse TM3 Leydig cells.

The MTT assay was performed to estimate the decrease in cell viability throughout the CoCl₂ and melatonin treatment on TM3 Leydig cells. The cells were incubated in increasing melatonin concentrations (10^− 6 to 1 mM) for 24 h. The results of the MTT assay indicated that the treatment of TM3 Leydig cells with different concentrations of melatonin did not inhibit cell viability compared to the control group (Fig. 1(a)); thus, the 1-mM melatonin concentration was selected for subsequent experiments. The cells then were incubated with increasing CoCl₂ concentrations (0.1 to 2 mM) for 24 h. It was determined that a 04-mM CoCl₂ concentration induced significant inhibition of cell viability in the cells compared to the control group (Fig. 1(b)). The 0.2-mM concentration of CoCl₂ then was selected for subsequent experiments.

3.2 Upregulation of HIF1α by CoCl₂ and protein level in TM3 Leydig cells

The mRNA and protein expression of HIF1α was upregulated after CoCl₂ treatment and compared to the control group in TM3 Leydig cells (Figs. 2(d), 3(a)-3(e)). The protein and mRNA levels of GATA-4, StAR and 3β-HSD decreased significantly compared to the control group after CoCl₂ treatment (Figs. 2(a)-2(c), 3(a)-3(d)). Melatonin treatment showed no significant effect on the expression of HIF1α, GATA-4, StAR and 3β-HSD genes compared to the control group (Fig. 2(a-d)). Similar results were obtained in the Western blot test results for the HIF1α, GATA-4, StAR and 3β-HSD protein levels (Figs. 3(a)-3(e)). Melatonin treatment caused recovery of HIF1α mRNA and protein expression accumulation following CoCl₂ treatment (Figs. 2(d), 3(a)-3(e)). The melatonin treatment showed no significant effect on the downregulation of StAR, GATA-4 and 3β-HSD mRNA and protein expression following CoCl₂ treatment (Figs. 2(a)-2(c), 3(a)-3(d)).

3.3 CoCl₂-mediated inhibition of testosterone production in TM3 Leydig cells.

CoCl₂ treatment significantly inhibited the testosterone content in the culture medium over that of the control group. In addition, melatonin showed no significant effect on testosterone content following CoCl₂ treatment (Fig. 3(h)).

3.4 Decrease of melatonin receptor expression in CoCl₂ treated mouse TM3 Leydig cells.

Real-time PCR and Western blot analysis revealed that membrane receptors MT1 and MT2 were expressed excessively in the control group and that CoCl₂ treatment decreased the mRNA and protein expression of MT2 compared to the control group (Figs. 2(e), 2(f), 3(a), 3(f), 3(g)). Melatonin treatment reduced the MT2 mRNA and protein expression deficiencies of the CoCl₂-treated cells (Figs. 2(f), 3(a), 3(g)).

Testosterone affects a multitude of physiological traits in males, including muscle protein synthesis, bone density, red blood cell formation, secondary sex characteristics, body mass, insulin resistance, lipid parameters and the immune system. Testosterone is required for the function of male reproductive organs (seminal vesicle, prostate, epididymis and vas deferens). Furthermore, a high intratesticular testosterone level is essential for the support of the blood-testis barrier, completion of germ cell meiosis and the spermatid-Sertoli cell connections that are necessary for spermiogenesis, spermiation and inhibition of germ cell apoptosis [35].

Leydig cells contain important metabolic proteins, such as StAR and 3β-HSD. These enzymes regulate cholesterol metabolism as a testosterone precursor in mitochondria and smooth the endoplasmic reticulum [17]. In vitro promotor analysis has revealed that the GATA-4 protein is involved in the regulation of target genes in the Leydig cells. GATA-4 is a novel downstream regulator of the cAMP/PKA signaling pathway in steroidogenic cells. Moreover, GATA-4 protein deficiency effects the steroidogenesis metabolic pathways. The StAR gene includes a regulatory sequence recognized by GATA-4 proteins in the testes [15]. Studies have shown that steroidogenesis is affected by HIF1α protein and disruption of HIF1α protein signaling can relate to steroidogenesis disorders and reducing male reproductive function [5, 36].

The results from the current investigation confirmed a correlation between CoCl₂-induced hypoxia and HIF1α accumulation with steroidogenesis-related gene and protein downregulation and testosterone deficiencies in TM3 Leydig cells. These results are in agreement with those of previous reports that HIF1 protein was involved in the regulation of 3β-HSD and StAR protein expression and testosterone production in a mouse TM3 Leydig cell line [36]. HIF1α have been shown to increase steroidogenic cell function, lower the O₂ levels (1%), down-regulate StAR protein expression in steroidogenic cells and decrease steroid synthesis [37]. It has been documented that overexpression of HIF1α protein in luteinized bovine granulosa cells and canine lutein cells treated with CoCl₂ exhibited similar effects on steroid synthesis.

Other signaling proteins and nuclear transcription factors also are involved in cell cycle arrest following HIF1α protein overexpression [14]. Down-regulation of basal and cAMP-induced StAR protein expression and steroidogenesis mediated by HIF1α protein in granulosa cells under hypoxia has been demonstrated [38]. Recent evidence has reported that HIF1α protein stabilization under severe hypoxia produces detrimental effects on steroidogenesis. Possible regulatory mechanisms for HIF1α protein involve cAMP production, regulating PKA activity and phosphorylation of target transcription factors [39].

It has been reported that HIF1α protein stabilization in a hypoxic environment may contribute to high intracellular reactive oxygen species (ROS) levels in Leydig cells. ROS is known to impair steroidogenesis by inducing oxidative stress, which leads to a reduction in the ratio of Bcl2/Bax, p53 gene upregulation and downregulation of the Bcl2 gene. Alterations in the ratio of Bcl2/Bax has been shown to lead to cytochrome C release, which promotes caspase-9 and activates the caspase-3 signaling cascades, leading to apoptosis [40]. Moreover, the HIF1α protein is capable of regulating transcription of the mouse 3β-HSD gene by influencing its promotor activity [41].

Melatonin is a neuroendocrine molecule that modulates endogenous patterns with photoperiod changes [25]. Melatonin signaling pathways in target cells lead to activation of MT1 and MT2, resulting in the inhibition of cAMP activity through coupling with Gi proteins. Inhibition of cAMP can help regulate PKA activity and reduce phosphorylation of cAMP response element-binding protein, its downstream effector, to reduce the expression of genes required for steroidogenesis, including StAR, 3β-HSD and GATA-4 [28, 29, 34].

The present study revealed that melatonin treatment had no significant effect on the expression of GATA-4, StAR and 3β-HSD genes and proteins in TM3 Leydig cells compared to the control group. In addition, the testosterone concentration in the cell culture medium remained unchanged in these cells. These observations are in contrast with evidence that MA-10 Leydig cell line treatment with human chorionic gonadotropin (hCG)/cAMP analogue for stimulation of testosterone synthesis alone or with the hCG/cAMP analogue plus melatonin in different dosages resulted in downregulation of the StAR protein expression and steroidogenesis.

The mechanism of testosterone production is regulated by multiple factors and hCG or LH are widely used for the stimulation of testosterone production in cells. Melatonin-attenuated StAR protein expression and testosterone synthesis is cAMP pathway-dependent and is stimulated by the hCG or cAMP analogue [27]. Other studies have reported that melatonin treatment caused a significant decrease in the expression of GATA-4 and SF-1, crucial steroidogenic enzymes and testosterone production in the TM3 Leydig cell line under LH treatment [28]. The results of the present study demonstrated that melatonin suppressed the adverse effects of CoCl₂ treatment in HIF1α RNA and protein expression. Recent evidence has demonstrated that melatonin exerts its effect on metabolic pathways and in cancer treatment by inhibiting the HIF1α protein [42]. Administration of melatonin has been shown to decrease the HIF1α protein level inside a tumor mass and prevented the growth of tumors in mice [43]. In another study, HIF1α was inhibited in HCT116 cells using melatonin under hypoxia. HIF1α protein stabilization under hypoxic conditions has been shown to reduce ROS production. The antioxidant properties of melatonin have been shown to remove intracellular ROS and destabilize the HIF1α protein [44].

The data showed that RNA and protein expression of MT2 decreased following CoCl₂-induced hypoxia in TM3 Leydig cells and that melatonin treatment reduced MT2 gene and protein deficiencies. Similar to the present study, it has been reported that MT1 gene and protein deficiencies in brain injuries of hypoxic-ischemic mice was reduced by the application of melatonin in vivo. Melatonin receptor antagonist was used to demonstrate the neuroprotective effect of melatonin in brain injuries to neonatal hypoxic-ischemic mice [45]. Another study speculated that melatonin exerts its protective effect in oxygen-induced retinopathy through the preservation of melatonin receptors [46].

In summary, the current study results were that CoCl₂ decreased TM3 cell line steroidogenesis. Melatonin destabilized the HIF1α gene and protein and reduced MT2 gene and protein deficiencies following CoCl₂ treatment. The absence of gonadotropin melatonin indicates that there was no significant effect on steroidogenesis-related genes, proteins or testosterone synthesis.

Ethical Approval

Not applicable

Competing interests

The authors declare no competing interests.

Authors' contributions

Mohammad reza gholami wrote the main manuscript text and shokooh karimi prepared figures. All authors reviewed the manuscript

Funding

Not applicable

Availability of data and materials

All of the material is owned by the authors and/or no permissions are required.

A. Agarwal, S. Baskaran, N. Parekh, C.-L. Cho, R. Henkel, S. Vij, M. Arafa, M.K.P. Selvam, R. Shah, Male infertility, The Lancet, 397 (2021) 319–333.
S. Cilio, M. Rienzo, G. Villano, B.F. Mirto, G. Giampaglia, F. Capone, G. Ferretti, E. Di Zazzo, F. Crocetto, Beneficial Effects of Antioxidants in Male Infertility Management: A Narrative Review, Oxygen, 2 (2022) 1–11.
E.T. Marzouni, H. Ilkhani, A.B. Harchegani, H. Shafaghatian, I. Layali, A. Shahriary, Epigenetic Modifications, A New Approach to Male Infertility Etiology: A Review, International Journal of Fertility & Sterility, 16 (2022) 1.
R.M.K. Yu, D.L.H. Chu, T.-f. Tan, V.W.T. Li, A.K.Y. Chan, J.P. Giesy, S.H. Cheng, R.S.S. Wu, R.Y.C. Kong, Leptin-mediated modulation of steroidogenic gene expression in hypoxic zebrafish embryos: implications for the disruption of sex steroids, Environmental science & technology, 46 (2012) 9112–9119.
R.M.K. Yu, G. Chaturvedi, S.K.H. Tong, S. Nusrin, J.P. Giesy, R.S.S. Wu, R.Y.C. Kong, Evidence for microRNA-mediated regulation of steroidogenesis by hypoxia, Environmental science & technology, 49 (2015) 1138–1147.
R. Maciejewski, E. Radzikowska-Büchner, W. Flieger, K. Kulczycka, J. Baj, A. Forma, J. Flieger, An Overview of Essential Microelements and Common Metallic Nanoparticles and Their Effects on Male Fertility, International Journal of Environmental Research and Public Health, 19 (2022) 11066.
S. Ghafouri-Fard, H. Shoorei, M. Mohaqiq, M. Tahmasebi, M. Seify, M. Taheri, Counteracting effects of heavy metals and antioxidants on male fertility, Biometals, 34 (2021) 439–491.
J. Muñoz-Sánchez, M.E. Chánez‐Cárdenas, The use of cobalt chloride as a chemical hypoxia model, Journal of Applied Toxicology, 39 (2019) 556–570.
M. Jahani, M.H. Modaressi, K. Mansouri, Hypoxia inducible factor: It’s role in angiogenesis and tumor, Tehran University Medical Journal TUMS Publications, 73 (2016) 757–766.
M. Jahani, M. Shahlaei, F. Norooznezhad, S.S. Miraghaee, L. Hosseinzadeh, N. Moasefi, R. Khodarahmi, A. Farokhi, A. Mahnam, K. Mansouri, TSGA10 over expression decreases Metastasic and metabolic activity by inhibiting HIF-1 in breast Cancer cells, Archives of medical research, 51 (2020) 41–53.
M. Amoorahim, E. Valipour, Z. Hoseinkhani, A. Mahnam, D. Rezazadeh, M. Ansari, M. Shahlaei, Y.H. Gamizgy, S. Moradi, K. Mansouri, TSGA10 overexpression inhibits angiogenesis of HUVECs: A HIF-2α biased perspective, Microvascular research, 128 (2020) 103952.
Z. Hoseinkhani, M. Rastegari-Pouyani, F. Oubari, H. Mozafari, A.B. Rahimzadeh, A. Maleki, S. Amini, K. Mansouri, Contribution and prognostic value of TSGA10 gene expression in patients with acute myeloid leukemia (AML), Pathology-Research and Practice, 215 (2019) 506–511.
D. Watts, J. Stein, A. Meneses, N. Bechmann, A. Neuwirth, D. Kaden, A. Krüger, A. Sinha, V.I. Alexaki, L.G. Perez-Rivas, HIF1α is a direct regulator of steroidogenesis in the adrenal gland, Cellular and Molecular Life Sciences, 78 (2021) 3577–3590.
V.S. Baddela, A. Sharma, M. Michaelis, J. Vanselow, HIF1 driven transcriptional activity regulates steroidogenesis and proliferation of bovine granulosa cells, Scientific reports, 10 (2020) 1–12.
K. de Mattos, R.S. Viger, J.J. Tremblay, Transcription Factors in the Regulation of Leydig Cell Gene Expression and Function, Frontiers in Endocrinology, 13 (2022).
B.R. Zirkin, V. Papadopoulos, Leydig cells: formation, function, and regulation, Biology of reproduction, 99 (2018) 101–111.
J. Cipolla-Neto, F.G. Amaral, J.M. Soares Jr, C.C. Gallo, A. Furtado, J.E. Cavaco, I. Gonçalves, C.R.A. Santos, T. Quintela, The crosstalk between melatonin and sex steroid hormones, Neuroendocrinology, 112 (2022) 115–129.
M. Gholami, S.A.Y. Ahmadi, A. Abaszadeh, A. Khaki, Protective effects of melatonin and ghrelin on spermatogenesis: A narrative review of the literature, International Journal of Reproductive Biomedicine, 15 (2017) 265.
M. Gholami, G. Saki, M. Hemadi, A. Khodadadi, Effect of melatonin on the expression of apoptotic genes in vitrified-thawed spermatogonia stem cells type A of 6-day-old mice, Iranian journal of basic medical sciences, 16 (2013) 906.
M. Gholami, G. Saki, M. Hemadi, A. Khodadadi, J. Mohammadiasl, Melatonin effect on immature mouse testicular tissues, vitrified-thawed with different cryoprotectant media, Jentashapir Journal of Health Research, 6 (2015).
M. Gholami, G. Saki, M. Hemadi, A. Khodadadi, J. Mohammadi-Asl, Melatonin improves spermatogonial stem cells transplantation efficiency in azoospermic mice, Iranian journal of basic medical sciences, 17 (2014) 93.
C.-N. Hsu, L.-T. Huang, Y.-L. Tain, Perinatal use of melatonin for offspring health: Focus on cardiovascular and neurological diseases, International journal of molecular sciences, 20 (2019) 5681.
K.M. Munley, Y. Han, M.X. Lansing, G.E. Demas, Winter madness: Melatonin as a neuroendocrine regulator of seasonal aggression, Journal of Experimental Zoology Part A: Ecological and Integrative Physiology, (2022).
Y. Gao, S. Zhao, Y. Zhang, Q. Zhang, Melatonin Receptors: A Key Mediator in Animal Reproduction, Veterinary Sciences, 9 (2022) 309.
K. Kozioł, D. Broda, M. Romerowicz-Misielak, S. Nowak, M. Koziorowski, Melatonin concentration in peripheral blood and melatonin receptors (MT1 and MT2) in the testis and epididymis of male roe deer during active spermatogenesis, Theriogenology, 149 (2020) 25–37.
Q. Zhu, L. Guo, W. An, Z. Huang, H. Liu, J. Zhao, W. Lu, J. Wang, Melatonin inhibits testosterone synthesis in Roosters Leydig cells by regulating lipolysis of lipid droplets, Theriogenology, (2022).
C.S. WU, S.F. LEU, H.Y. YANG, B.M. HUANG, Melatonin inhibits the expression of steroidogenic acute regulatory protein and steroidogenesis in MA-10 cells, Journal of andrology, 22 (2001) 245–254.
F. Qin, J. Zhang, L. Zan, W. Guo, J. Wang, L. Chen, Y. Cao, O. Shen, J. Tong, Inhibitory effect of melatonin on testosterone synthesis is mediated via GATA-4/SF-1 transcription factors, Reproductive Biomedicine Online, 31 (2015) 638–646.
K. Yu, S.-L. Deng, T.-C. Sun, Y.-Y. Li, Y.-X. Liu, Melatonin regulates the synthesis of steroid hormones on male reproduction: a review, Molecules, 23 (2018) 447.
M.B. Frungieri, A. Mayerhofer, K. Zitta, O.P. Pignataro, R.S. Calandra, S.I. Gonzalez-Calvar, Direct effect of melatonin on Syrian hamster testes: melatonin subtype 1a receptors, inhibition of androgen production, and interaction with the local corticotropin-releasing hormone system, Endocrinology, 146 (2005) 1541–1552.
C. Chen, M.y. Ling, F.h. Lin, L. Xu, Z.M. Lv, Melatonin appears to protect against steroidogenic collapse in both mice fed with high-fat diet and H2O2‐treated TM3 cells, Andrologia, 51 (2019) e13323.
M. Yang, S. Guan, J. Tao, K. Zhu, D. Lv, J. Wang, G. Li, Y. Gao, H. Wu, J. Liu, Melatonin promotes male reproductive performance and increases testosterone synthesis in mammalian Leydig cells, Biology of Reproduction, 104 (2021) 1322–1336.
S.L. Deng, S.R. Chen, Z.P. Wang, Y. Zhang, J.X. Tang, J. Li, X.X. Wang, J.M. Cheng, C. Jin, X.Y. Li, Melatonin promotes development of haploid germ cells from early developing spermatogenic cells of Suffolk sheep under in vitro condition, Journal of Pineal Research, 60 (2016) 435–447.
S.-L. Deng, Y. Zhang, K. Yu, X.-X. Wang, S.-R. Chen, D.-P. Han, C.Y. Cheng, Z.-X. Lian, Y.-X. Liu, Melatonin up-regulates the expression of the GATA-4 transcription factor and increases testosterone secretion from Leydig cells through RORα signaling in an in vitro goat spermatogonial stem cell differentiation culture system, Oncotarget, 8 (2017) 110592.
L. Witherspoon, R. Flannigan, It puts the T’s in fertility: testosterone and spermatogenesis, International Journal of Impotence Research, (2022) 1–4.
X. Wang, Z. Zou, Z. Yang, S. Jiang, Y. Lu, D. Wang, Z. Dong, S. Xu, L. Zhu, HIF 1 inhibits StAR transcription and testosterone synthesis in murine Leydig cells, Journal of molecular endocrinology, 62 (2019) 1–13.
M.P. Kowalewski, A. Gram, A. Boos, The role of hypoxia and HIF1α in the regulation of STAR-mediated steroidogenesis in granulosa cells, Molecular and cellular endocrinology, 401 (2015) 35–44.
T. Gysin, M.P. Kowalewski, G. Martin, The involvement of hypoxia-inducible factor 1α (HIF1α)-stabilising factors in steroidogenic acute regulatory (STAR) protein-dependent steroidogenesis in murine KK1 granulosa cells in vitro, Reproduction, Fertility and Development, 33 (2021) 865–880.
B. Lanfranchi, R.F. Rubia, M. Gassmann, G. Schuler, M.P. Kowalewski, Transcriptional regulation of HIF1α-mediated STAR expression in murine KK1 granulosa cell line involves cJUN, CREB and CBP-dependent pathways, General and Comparative Endocrinology, 315 (2022) 113923.
V.K. Tripathi, S.A. Subramaniyan, I. Hwang, Molecular and cellular response of co-cultured cells toward cobalt chloride (CoCl2)-induced hypoxia, ACS omega, 4 (2019) 20882–20893.
J.J. Lysiak, J.L. Kirby, J.J. Tremblay, R.I. Woodson, M.A. Reardon, L.A. Palmer, T.T. Turner, Hypoxia-inducible factor‐1α is constitutively expressed in murine Leydig cells and regulates 3β‐hydroxysteroid dehydrogenase type 1 promoter activity, Journal of andrology, 30 (2009) 146–156.
A. de Lima Mota, B.V. Jardim-Perassi, T.B. de Castro, J. Colombo, N.M. Sonehara, V.K.G. Nishiyama, V.A.G. Pierri, D.A.P. de Campos Zuccari, Melatonin modifies tumor hypoxia and metabolism by inhibiting HIF-1α and energy metabolic pathway in the in vitro and in vivo models of breast cancer, Melatonin Research, 2 (2019) 83–98.
K.J. Kim, J.S. Choi, I. Kang, K.W. Kim, C.H. Jeong, J.W. Jeong, Melatonin suppresses tumor progression by reducing angiogenesis stimulated by HIF-1 in a mouse tumor model, Journal of pineal research, 54 (2013) 264–270.
B. Victorasso Jardim-Perassi, M. Repolês Lourenço, G. Mandarini Doho, I. Helen Grígolo, G. Bottaro Gelaleti, L. Carvalho Ferreira, T. Ferraz Borin, M. Gobbe Moschetta, D. Aparecida Pires de Campos Zuccari, Melatonin regulates angiogenic factors under hypoxia in breast cancer cell lines, Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents), 16 (2016) 347–358.
B. Sinha, Q. Wu, W. Li, Y. Tu, A.C. Sirianni, Y. Chen, J. Jiang, X. Zhang, W. Chen, S. Zhou, Protection of melatonin in experimental models of newborn hypoxic-ischemic brain injury through MT 1 receptor, Journal of pineal research, 64 (2018) e12443.
R. Huang, Y. Xu, X. Lu, X. Tang, J. Lin, K. Cui, S. Yu, Y. Shi, D. Ye, Y. Liu, Melatonin protects inner retinal neurons of newborn mice after hypoxia-ischemia, Journal of Pineal Research, 71 (2021) e12716.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Effect of melatonin on steroidogenesis-related enzyme expression and testosterone synthesis following CoCl 2 -induced hypoxia in TM3 Leydig cells

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Cell culture

2.2 MTT assay

2.3 Real-time PCR

2.4 Western blot analysis

2.5 Testosterone determination

2.6 Statistical analysis

3. Results

3.1 Cell viability of CoCl₂ and melatonin in mouse TM3 Leydig cells.

3.2 Upregulation of HIF1α by CoCl₂ and protein level in TM3 Leydig cells

3.3 CoCl₂-mediated inhibition of testosterone production in TM3 Leydig cells.

3.4 Decrease of melatonin receptor expression in CoCl₂ treated mouse TM3 Leydig cells.

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1

Effect of melatonin on steroidogenesis-related enzyme expression and testosterone synthesis following CoCl 2 -induced hypoxia in TM3 Leydig cells

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Cell culture

2.2 MTT assay

2.3 Real-time PCR

2.4 Western blot analysis

2.5 Testosterone determination

2.6 Statistical analysis

3. Results

3.1 Cell viability of CoCl2 and melatonin in mouse TM3 Leydig cells.

3.2 Upregulation of HIF1α by CoCl2 and protein level in TM3 Leydig cells

3.3 CoCl2-mediated inhibition of testosterone production in TM3 Leydig cells.

3.4 Decrease of melatonin receptor expression in CoCl2 treated mouse TM3 Leydig cells.

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1

3.1 Cell viability of CoCl₂ and melatonin in mouse TM3 Leydig cells.

3.2 Upregulation of HIF1α by CoCl₂ and protein level in TM3 Leydig cells

3.3 CoCl₂-mediated inhibition of testosterone production in TM3 Leydig cells.

3.4 Decrease of melatonin receptor expression in CoCl₂ treated mouse TM3 Leydig cells.