IL-37 reduces calcification by inhibiting the oxidized low-density lipoprotein(ox-LDL)-induced toll-like receptor(TLR)/nuclear factor kappa-B(NF-κB) signaling pathway and suppressing cellular osteogenic transformation in smooth muscle cells

doi:10.21203/rs.3.rs-2229576/v1

Download PDF

Research Article

IL-37 reduces calcification by inhibiting the oxidized low-density lipoprotein(ox-LDL)-induced toll-like receptor(TLR)/nuclear factor kappa-B(NF-κB) signaling pathway and suppressing cellular osteogenic transformation in smooth muscle cells

https://doi.org/10.21203/rs.3.rs-2229576/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

[Objective] Cardiovascular disease (CVD) is one of the leading causes of high mortality worldwide, and vascular calcification (VC) increases the incidence of adverse prognostic events and mortality in CVD. Osteogenic transformation of vascular smooth muscle cells (VSMCs) and induction of inflammation could be among the mechanisms of VC. Interleukin 37 (IL-37) is an anti-inflammatory factor that protects against atherosclerosis (AS) and VC by unknown mechanisms. Thus, the present study aimed to investigate the effect and mechanism of IL-37 on calcification in human aortic smooth muscle cells (HASMCs).

[Methods] The human aortic smooth muscle cells (HA-SMC) were purchased from CTCC (Meisen, China), Alizarin red S staining was used to measure the degree of cell calcification, flow cytometry measured the level of apoptosis, cell counting kit-8 (CCK-8) measured the cell proliferation activity, and qPCR was used to measure the expression of toll-like receptor(TLR4),nuclear factor kappa-B( NF-κB), Runt-related Transcription Factor 2(RUNX2), Smooth muscle actin(SMA), smooth muscle 22 alpha (SM22α), Msh homeobox 2(MSX2)、Osteocalcin(OC) and alkaline phosphatase (ALP). Western blot measured the level of TLR4, NF-κB, RUNX2, and phosphorylated NF-κB(PP65), and immunofluorescence was used to detect the expression and location of SM22α.Differences were analyzed via Student’s t test or one-way analysis of variance

[Results] Ox-LDL induction caused HA-SMC calcification and promoted HA-SMC apoptosis and value addition. After IL-37 intervention, calcification was significantly reduced, TLR4/NF-κB/RUNX2 expression activated by ox-LDL was decreased, and cell proliferation activity was inhibited, apoptosis rate was decreased, and PP65 expression was downregulated. IL-37 inhibited P65phosphorylation by inhibiting TLR. Down-regulation of osteogenesis-related factor expression plays a protective role against cellular calcification.

[Conclusion] The current data demonstrated that IL-37 inhibits NF-κB phosphorylation by downregulating the ox-LDL-activated TLR4-NF-κ Bsignaling pathway, reduces the expression of the osteogenic transcription factor RUNX2/ALP, and inhibits VSMC osteogenic transformation, thereby reducing the level of cellular calcification. These findings provided a basis for the use of IL-37 as a novel therapeutic target.

vascular calcification

vascular smooth muscle cells

Interleukin-37

osteogenic transcription factor

Cardiovascular disease

Atherosclerosis (AS) is a pathological process of various cardiovascular diseases (CVD) and the leading cause of death worldwide. It is characterized by inflammatory cell invasion, lipid accumulation, and fatty streak (plaque) formation, accompanied by the accumulation of calcium and other minerals, leading to disturbances in the regulatory role of the vascular endothelium in arterial function[1, 2]. Vascular calcification (VC) is common in AS, diabetes, hypertension, chronic kidney disease, and other diseases. As the late pathological feature, VC is a strong prognostic indicator of CVD[3, 4].Some studies suggested that VC is associated with chronic inflammation and has characteristics similar to bone formation and metabolism[5]. Medial calcification is a major component of VC and an independent predictor of CVD mortality. It is affected by smooth muscle cells (SMCs). The process of SMC differentiation into osteoblast-like cells is similar to bone formation and associated with bone morphogenetic protein-2 (BMP2), osteoblast homologous protein (MSX2), and alkaline phosphatase (ALP), and other genes[6]. SMCs osteogenic transformation plays a major role in VC[7]. It causes VC by differentiating into osteoblast-like cells and generating stromal vesicles that act as nests for calcium phosphate deposition in the vessel wall and mineral deposits in the form of calcium phosphate complexes in the vascular system[8, 9].

In vascular smooth muscle cells (VSMCs), oxidized low-density lipoprotein(ox-LDL) stimulates proliferation, migration, and collagen synthesis[10]. Also, high concentrations of ox-LDL can increase the expression of pro-apoptotic proteins, such as B-cell lymphoma-2(Bcl-2)-associated X protein through Lectin-like oxidized low density lipoprotein receptor-1(LOX-1) upregulation, while inhibiting the expression of anti-apoptotic Bcl-2, leading to SMC apoptosis and ultimately causing AS plaque rupture[11].In addition, ox-LDL induces human VSMC calcification via the toll-like receptor4(TLR4)/nuclear factor kappa-B(NF-κB)/ceramide signaling pathway[12]. It also induces TLR2 and TLR4, upregulating the BMP2 expression.Extracellular signal-regulated kinas(ERK1/2) and NF-κB pathways are both associated with AS as well as the mechanism of calcification[13].

Interleukin-37(IL-37) is a novel anti-inflammatory factor, first discovered in 2000[14]. It is a rare anti-inflammatory factor in the IL-1 family and inhibits inflammatory responses[15], especially innate immune responses. Boraschi found that IL-37 is expressed in AS foam cells and is involved in AS formation[16]. Our previous studies have elucidated the protective effects of IL-37 during both VC and AS via animal models based on the decrease in aortic root plaque area, AS area, and plaque vulnerability after IL-37 treatment [17].Concurrently, we also found for the first time that patients with high coronary artery calcification have elevated plasma IL-37 levels, and IL-37 can inhibit the activation of NF-kB. Some studies have shown that IL-37 inhibits the TLR-4/NF-κB inflammatory response in ischemia-reperfusion (I/R) injury and the osteogenic response of aortic valve disease[18]. In vivo and in vitro studies by Liu demonstrated that IL-37 inhibits the maturation of Dendritic Cells(DCs) through the Interleukin-1 receptor 8(IL-1R8)-TLR4-NF-κB pathway[19],thereby alleviating AS. Kapelouzou demonstrated that IL-37 inhibits the osteogenic response of human vascular endothelial cells[20]. However, the mechanism underlying the protective effect of IL-37 is yet unclear. Therefore, this study aimed to clarify the effect and mechanism of IL-37 on calcification in human aortic SMCs(HA-SMC).

2.1 Experimental materials

Immortalized human aortic VSMCs (HA-VSMCs)and their complete culture medium were purchased from Meisen (Hangzhou，China）β-glycerophosphate disodium hydrate and ascorbic acid were purchased from (Sigma-Aldrich, St. Louis, MO, USA), ox-LDL was purchased from Absin （Shanghai，China） recombinant human IL-37 protein was purchased from Yiqiao Shenzhou ( Beijing,China), 1% penicillin-streptomycin and Trypsin were purchased from Gibco (NewYork,USA), pyrrolidine dithiocarboxylate (PDTC) standard products were purchased from Yuanye( Shanghai ,China) .PrimeScript™ RT reagent kit (Perfect Real-Time) was purchased from Takara (BeiJing,China), TRIzol™ was purchased from Thermo (MA,USA), GoTaq^® qPCR and RT-qPCR systems were obtained from Promega (MADISON, Wisconsin, USA.), recombinant anti-TLR4, anti-NF-kB p65, and anti-RUNX2 antibodies were purchased from Abcam (Cambridge, UK), horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) (affinity purification) was purchased from Zhongshan Jinqiao(Beijing,China). Alizarin Red S staining solution (0.2%) was purchased from Solarbio(Beijing,China)., and Annexin V-FITC apoptosis kit was procured from Biyuntian(Beijing,China)

2.2 Cell culture

HA-VSMC (T0515) were cultured in a specific medium in a 37 °C incubator with 5% CO₂. Subsequently, the cells were passaged in 1:2 to 1:3 with medium changes every 2-3 days.

Passages 3–6 were selected for follow-up experiments, and the cells were seeded in a 6-well plate at a density of 1.2×10⁶ for experimental treatment.

2.3 Experiment grouping and establishment of calcification model

Cells were grown to a confluency of 60–70% for treatment. The blank control and the ox-LDL treatment groups were set. The treatment group was treated with 50 μg/ml ox-LDL for 3 days and 14 days, respectively, to detect the expression of cytokines and establish a calcification model by cell staining. All experimental groups were treated in the presence of a calcification medium (complete medium+10 mmol/L of β-glycerophosphate+50 μmol/L of ascorbic acid).

Experimental grouping: After the successful establishment of the cell calcification model, the cells were divided into the following groups:1.blank control group.2.ox-LDL treatment group at a concentration of 50 μg/mL. 3.cells pretreated with IL-37(100 ng/mL) for 24 h and then 50 μg/mL ox-LDL was added to the co-treated cells. 4.cells pretreated with PDTC(100 μmol/L) for 24 h, and then 50 μg/mL ox-LDL was added to the co-treated cells.

2.4 Alizarin red calcification staining

After 14 days of cell treatment, Alizarin red calcification staining was used to clarify the calcification of cells. The medium in the culture plate was aspirated, and the cells were washed twice with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde for 15 min, and washed with double-distilled water (ddH₂O), followed by the addition of Alizarin Red S staining solution for 30 min. Finally, the cells were washed and images captured under the microscope(Primovert iLED).

2.5 Cell counting kit-8 (CCK-8)

A 100-μL cell suspension(1×10⁴) was seeded in a 96-well plate and incubated for 24 h. Then, 10 μL of the substance to be tested was added to the wells and incubated for 24 h/48 h/72 h. Subsequently, 10 μL of CCK-8 reagent was added to each well, incubated for 2 h, and the absorbance was measured at 450 nm on a microplate reader(BioTek). The cell viability was obtained by calculating the formula according to the instructions (Japanese Dojindo).

2.6 Flow cytometry analysis

Cells were washed with PBS, trypsinized, and collected by centrifugation at 1000 g for 5 min. The cell pellet (50,000–100,000 cells) was resuspended in PBS and 195 μL Annexin V-FITC binding solution. Then, 5 μL Annexin V-FITC and 10 μL propidium iodide staining solution were added, and the reaction was incubated at room temperature (25 °C) for 10 min in the dark, before detection by flow cytometry(BD).

2.7 Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was obtained utilizing TRIzol method. PrimeScipt Buffer and PrimeScipt RT Enzyme Mix were added sequentially and reverse transcribed into cDNA at 4 °C using a Reverse Transcription Kit . Subsequently, qPCR Master Mix, primers, and DNA were used for RT-qPCR, according to the instructions of the manufacturer. Two-step PCR cycle was performed: 1 cycle at 95 °C for 2 min, 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The corresponding fluorescence signal intensity (represented by Ct value) and the melting curve were recorded at the same time, and the expression level was calculated using the 2^-DDtmethod. Three replicate wells were set in each group, and the statistical significance was analyzed. The related primers were:

β-actin:F:CTCTTCCAGCCTTCCTTCCT-and R:AGCACTGTGTTGGCGTACAG;

TLR4:F:AGAACTGCAGGTGCTGGATT -and R:AAACTCTGGATGGGGTTTCC;

NF-KB:F:TCAAGATCTGCCGACTGAAC-and R:CCTCTTTCT GCACCTTGT CA

Runx2:F:GAACCAAGAAGGCACAGACAGA-and R:GGCGGGACACCTACTCTCATAC

MSX2:F:TGGATGCAGGAACCCGG-and R: AGGGCTCATATGTCTTGGCG

ALP:F:GTGGAGTATGAGAGTGACGAGAAA-and R:CAGATGAAGTGGGAGTGCTTGTA

OC:F:CTCACACTCCTCGCCCTATTG-and R:GCCTGGGTCTCTTCACTACC

2.8 Western blotting

Cells were lysed in RIPA (with PMSF at a concentration of 1 M) for 30 min on ice. The supernatant was collected by centrifugation of the lysate, and the protein concentration was estimated by the BCA method.10% SDS-Page prefabricated gel plates, 10 μL protein per well, 40 min electrophoresis with MES electrophoresis solution at 120 V. Fast film transfer liquid, constant current 400mA, 30 minutes to complete the mold transfer. Subsequently, the membrane was blocked with 5% milk-TBST for 1 h, cultivated overnight with primary antibodies against TLR4(ab13556,abcam),NF-κB（ab32536,abcam）,RUNX2(ab23981,abcam),β-actin(bsm-33036,bioss) at 4 °C , and horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibody for 1 h at indoor temperature. The immunoreactive bands were developed using enhanced chemiluminescence (ECL) and quantitated on the image analysis system in the dark.

2.9 Immunofluorescence

Aspirated the culture medium, added fixative for 10min, removed fixative and washed 3 times with (PBS buffer), added blocking solution(5% Goat serum) for 60min, incubated primary antibody smooth muscle 22 alpha (SM22α)(ab155272,abcam)for 60min,followed by the fluorescent secondary antibody(p0186,beyotime) in the dark for 60 min. Finally, the cells were mounted and observed under a Inverted fluorescence microscope(Leica,Germany).

2.10 Statistical analysis

All experiments were repeated three times, and each experiment was conducted in at least triplicate wells. SPSS25.0 software was used for data analysis, and quantitative data were expressed as mean±standard deviation. The statistical comparison between two groups was carried out by t-test, and data from more than two groups were used. One-way analysis of variance (ANOVA) was used for statistical comparison, and P<0.05 indicated statistical significance between the groups.

3.1 ox-LDL upregulates TLR4/NF-κB/RUNX2 expression and induces HA-SMC calcification

To verify the calcification-promoting role of ox-LDL in HA-SMC, 50 μg/mL ox-LDL was used to treat the cells for 14 days. The results of Alizarin Red S staining showed (Fig. 1A/B) orange-red calcified nodules was drastically elevated in the treatment group in comparison with control group, confirming that ox-LDL can induce HA-SMC calcification. The expressions of TLR4,NF-κB, and Runt-related Transcription Factor 2(RUNX2) were detected by RT-qPCR and Western blotting (Fig. 2/3). Next, we found that the expression levels of these factors were significantly increased in the ox-LDL treatment group in comparison with control group (P<0.05). Thus, we speculated that the expression of this signaling pathway might be related to VSMC calcification.

3.2 IL-37 inhibits ox-LDL-induced cellular proliferation and apoptosis

Since cell proliferation activity and apoptosis levels are strongly correlated with calcification, we selected gradient concentrations of ox-LDL (10, 25, 50, and 100 μg/mL) to treat VSMCs for 24, 48, and 72 h, respectively. Then, CCK-8 was added, the reaction was incubated for 2 h, and the absorbance was measured at 450 nm (Fig. 4). Compared to the control group, the cell viability in the treatment group increased in a concentration-dependent manner, among which the 50 and 100 μg/mL groups had a survival rate that was increased by 31% and 69.9%, respectively, and the difference was statistically significant (P<0.05). Conversely, the overall cell viability decreased slightly in a time-dependent manner. The absorbance of IL-37+ox-LDL-treated group and PDTC+ox-LDL-treated group were measured at the same wavelength.We observed that the cell survival rate decreased after IL-37 and PDTC treatment compared with the ox-LDL group, and the decrease was more significant in the IL-37 pretreatment than in the PDTC pretreatment (P<0.05). Next, we used the AnnexinV-PI cell apoptosis detection kit to detect the apoptosis level of the ox-LDL treatment and IL-37 +ox-LDL groups after 3 days of culture. Flow cytometry results showed that compared to the control group (Fig. 5), ox-LDL promoted cell apoptosis, while the level of apoptosis decreased after IL-37 treatment, and the qualitative results of in situ fluorescence were consistent with the quantitative results.and the difference wa s statistically significant (P<0.05). Therefore, we speculated that after ox-LDL treatment, the high levels of apoptosis and proliferation of cells might be related to their calcification status, which could be inhibited by IL-37 intervention.

3.3 IL-37 downregulates TLR4/NF-κB/RUNX2 expression and reduces calcified nodules

Because IL-37 pretreatment significantly reduced cellular calcification (Fig. 1C), we aimed to clarify the specific intervention mechanism of IL-37. Previous results have shown that ox-LDL induces calcification and upregulates TLR4/NF-κB/RUNX2 signaling. Therefore, qPCR and Western blot were also used to detect the expression of related factors (Fig. 2/3). We found that the expression of related factors (TLR4/NF-κB/RUNX2) was reduced in the IL-37+ox-LDL-treated group versus the PDTC+ox-LDL-treated group compared with the ox-LDL-treated group, and IL-37 treatment reduced the expression of these factors more than after PDTC treatment, and the data were statistically different. Therefore, we proposed that IL-37 can reduce the occurrence of calcification by inhibiting the ox-LDL-activated signaling pathways.

3.4 IL-37 inhibits NF-κB phosphorylation levels and reduces nuclear transcription factor expression

The above experimental results showed that the pretreatment with IL-37 had a trend consistent with the pretreatment with PDTC. Thus, we hypothesized that IL-37 also inhibits NF-κB(p65), whose expression is phosphorylation-dependent. After oxidative stress、inflammation stimuli，, NF-κB enters the nucleus and promotes the transcription of a series of cytokines. Therefore, we used Western blot to detect the levels of phosphorylated NF-κB(PP65) and P65 in each group (Fig. 3). Interestingly, after the cells were treated with gradient concentrations of ox-LDL, the expression of PP65 increased in a concentration-dependent manner. 50 μg/mL ox-LDL group had the highest expression level of phosphorylated protein. Thus, it could be considered that ox-LDL treatment of cells affects calcification by activating and phosphorylating NF-κB at the optimal concentration of 50 μg/ml. NF-κB phospho-protein expression was significantly decreased after IL-37 pretreatment, which was consistent with the PDTC group. The expression of nuclear transcription factors RUNX2 and ALP was significantly decreased under pretreatment conditions (Figure 4) (P<0.05). This finding suggested that IL-37 is involved in the protection against VC by inhibiting NF-κB phosphorylation and suppressing the expression of osteogenic factors.

3.5 ox-LDL promotes osteogenic transformation of SMCs

After phosphorylation, NF-κB enters the nucleus and promotes the transcription of some cytokines. Among them,RUNX2、ALP、MSX2、and Osteocalcin(OC) have been shown to be related to cell calcification.These cytokines promote the transformation of SMCs to osteoblasts and participate in calcification (Fig. 1). Conversely, VSMCs in the normal state often show a contractile phenotype and specifically express Smooth muscle actin (SMA) and SM22α. Compared to the control group, the results of SM22α expression in the treated group showed a decreasing trend, while the mRNA expression levels of osteogenesis-related factors RUNX2, ALP, MSX2, and OC were significantly increased. Also, Western blot results showed that the expression of RUNX2 in the ox-LDL treatment group was significantly higher than in the control group (P<0.05). This results suggested that ox-LDL triggers the phosphorylation of NF-κB and enters the nucleus to promote the transcription of the corresponding osteogenesis-related factors, leading to VSMCs transformation from contractile to osteoblasts and participate in calcification.

3.6 IL-37 upregulates the level of SMA/SM22α and affects the expression of osteogenic transcription factors

Herein, we confirmed the correlation between ox-LDL-induced calcification and VSMC phenotypic transformation. Since IL-37 inhibits the occurrence of calcification, we suspected that it might also reduce calcification by affecting this phenotypic transformation, which was confirmed experimentally (Fig. 2/6).The qPCR results showed that the expression of SMA was increased in the IL-37 pretreatment group compared with the ox-LDL treatment group. qPCR and immunofluorescence results indicated that the expression trend of SM22a was consistent with SMA, while the expression levels of ALP and RUNX2 were decreased, and the trend of IL-37 pretreatment group was similar to that of PDTC pretreatment group. Based on these findings, we speculated that IL-37 inhibits the osteogenic transformation of VSMCs and calcification by suppressing the phosphorylation degree of NF-κB and inhibiting the transcription of osteogenesis-related factors.

With the improvement in the economic level, aggravation of aging, and changes in dietary habits, CVD has become the leading cause of the global disease burden. Reportedly, CVD caused 18.5621 million deaths worldwide in 2019 and has become the world’s largest cause of death[21, 22]. Therefore, preventing, treating, and delaying CVD progression is imperative.

IL-37 is a member of the IL-1 family and a novel anti-inflammatory factor. Its role in suppressing inflammation and autoimmune responses has been mentioned repeatedly. Qi reported that IL-37 improves influenza pneumonia in vivo[23]. A recent study demonstrated that IL-37 alleviates systemic inflammation after a new coronavirus (COVID-19) infection, and low IL-37 plasma levels serve as a marker for the severity of the viral infection[24]. It also plays a beneficial role in CVD. Furthermore, by detecting IL-37 serum expression levels in humans,it was found that IL-37 overexpression alleviates AS, and calcified aortic valve leaflets have lower IL-37 levels than normal valve leaflets and are in a pro-inflammatory state. Thus, a protective role of IL-37 in both AS and VC was first proposed in an ApoE-deficient mouse model. The cytokine reduces the area of local calcification [25, 26].The content of their study only illustrated the dominant role of IL-37 in calcification without mentioning the specific mechanism. Therefore, the aim of the present study was to elucidate the specific protective mechanism of IL-37 against calcification at the level of HA-VSMC in vitro.

VC is a feature of normal arterial aging and is of great interest because it increases the incidence of prognostic adverse events and mortality in CVD[27]. As one of the main features of advanced CVD lesions, the pathogenesis associated with calcification is well-studied and includes various complex mechanisms, including loss inhibition, calcium-phosphorus homeostasis, cellular phenotypic transformation, apoptosis, circulating nucleation complexes/paracrine factors, and matrix degradation [28].Despite these factors, our understanding of calcification is limited. Previous studies have shown that mid-arterial calcification is the result of local inflammation and VSMC transdifferentiation into an osteoblast-like phenotype[27, 29].Thus, we aimed to demonstrate the correlation between local inflammation and phenotypic transformation of VSMCs and explore the specific mechanisms.

ox-LDL induces the proliferation level of VSMCs[30].The current results showed that after ox-LDL treatment of VSMCs, the cell proliferation level is significantly increased compared to the control group in a concentration-dependent manner, which is proportional to the time gradient in a negative correlation. This result might be related to the involvement of ox-LDL in exposing cyclins. The current study also demonstrated for the first time that cell proliferation activity is inhibited by IL-37 pretreatment of VSMCs against an optimal concentration of ox-LDL, following the same trend but better than the inhibitor group, which might be a beneficial effect for VSMC calcification.

Apoptosis is a major pathophysiological event that promotes AS[31].Some studies have shown that at the level of VSMCs, ox-LDL induces apoptosis by enhancing the sensitivity of cells to the death receptor Fas (CD95)[32]. Apoptotic VSMCs exist in the form of stromal vesicles that serve as nucleating structures for bone formation, leading to plaque microcalcification, it also induces plaque inflammation and participates in calcification[33]. The current results validated this effect of ox-LDL, and we also found that IL-37 pretreatment reduced both apoptosis and calcification levels, however, the exact mechanism needs to be further investigated.

The accumulation of ox-LDL in the vascular wall plays a major role in AS and VC and enhances the transformation of VSMCs into osteoblast-like cells [34-36].ox-LDL upregulates the level of osteogenic protein BMP-2 in endothelial cells through TLR2/TLR4, and NF-κB and ERK1/2 pathways are independently involved in ox-LDL-induced BMP-2 expression, as well as in ox-LDL-induced VC[13, 37].Concurrently, ox-LDL also increases reactive oxygen species levels, enhances cellular oxidative stress, and promotes cellular osteogenic differentiation and calcification[38].Therefore, we chose ox-LDL to treat the cells to establish a VC model and speculated that ox-LDL stimulates NF-κB by increasing the level of TLR4, thereby promoting the expression of osteogenesis-related proteins such as BMP2 and Runt-related Transcription Factor 2(RUNX2). These phenotypes would transform VSMCs into osteoblasts, thus forming a VC.

Compared to the control group, ox-LDL-treated VSMCs showed distinct orange-red calcified nodules on day 14 in the treated group after Alizarin red staining, and the expression of TLR4, NF-κB, and RUNX2 in the ox-LDL treatment group was increased significantly. After ox-LDL treatment for 3 days, immunofluorescence staining showed that the expression of SM22α was decreased and expressed in the cytoplasm in the treatment group. The qPCR results showed that the expression of SMA and SM22α decreased in the treatment group. However, the expression of osteogenesis-related factors ALP, RUNX2, MSX2, and OC increased. SMA and SM22α, as skeleton proteins of SMC, are expressed in SMC with contractile phenotype and are the most widely used SMC markers[39, 40]. Under specific environmental stimuli, contractile SMCs are transformed into other phenotypes, and the protein expression levels are altered. BMPs are osteogenesis-related factors and play a critical role in the osteogenic transformation of cells. Among these,BMP2 induced the transformation of mesenchymal cells to osteoblasts in clinical trials; also, a role in bone formation was identified[42, 43]. MSX2 synergizes with BMP2 to enhance osteogenic differentiation[44]. The transcription factor RUNX2 downstream of BMP2 is also critical for osteoblastic transformation and bone formation[45]. ALP is expressed in the cytoplasm and reflects the viability of osteoblasts[46]. It is one of the reliable indicators of osteogenic differentiation and mineralization and is of great significance in bone formation. OC is a small, 6-kDa γ-carboxylated calcium-binding protein that regulates bone formation and mineralization[47], and the expression of these osteogenesis-related genes promotes the proliferation, differentiation, and growth of rat osteoblasts in vitro[48], osteocyte mineralization, and other functions. Our findings revealed why ox-LDL-mediated calcification is related to the activation of TLR4/NF-κB pathway and cell phenotype transformation. A high expression of osteogenic transcription factors and ALP levels suggest a contractile SMC to osteoblast phenotype transformation involved in vascular calcification formation. In order to investigate whether ox-LDL affects VC through TLR activation of NF-κB and its downstream osteogenic transcription factors, such as BMP2 and RUNX2, we divided the treatment groups into ox-LDL and PDTC+ox-LDL co-culture groups. The results showed that after PDTC pretreatment, the expression of NF-κB was significantly decreased, and the expression of TLR was low, while the expression of TLR/NF-κB/RUNX2 in the ox-LDL treatment group was higher than that in the control group. Therefore, we concluded that ox-LDL upregulates TLR expression and activates the NF-κB signaling pathway, promoting the expression of downstream BMP2/RUNX2 for calcification, while PDTC is effectuated by modulating TLR expression. However, the exact mechanism needs to be investigated further.

This study aimed to clarify the role of IL-37 in the protective mechanism of vascular calcification; therefore, recombinant IL-37 was co-cultured with ox-LDL after pretreatment of VSMC for 2 h.The data showed that IL-37 reduced the expression of NF-κB signaling pathway, inhibited the expression of osteogenic markers, and reduced calcified nodules. And the trend of related factor expression was similar to PDTC but more potent. The unique role of IL-37 is that it can inhibit the osteogenic transformation of VSMCs. The immunofluorescence of SM22α in the IL-37 pretreatment group showed its expression in the cytoplasm. Compared to the ox-LDL group, the expression of SMA and SM22α was significantly higher than that of the ox-LDL group. Combined with the results of the decreased expression of bone transcription factors, we suggested that IL-37 inhibits VSMC phenotypic transformation, mainly by inhibiting VSMCs to osteoblast phenotype and thus VC. Thus, we believe that IL-37 can downregulate the activation of ox-LDL-induced TLR-NF-κB, and the reduced inflammatory factors may inhibit the transformation of VSMCs into osteoblast phenotype and reduce the occurrence of calcification. Nonetheless, how IL-37 affects the link between NF-κB and osteogenic transcription factors is yet to be elucidated.

NF-κB is phosphorylated into the nucleus under the activation of TLR and promotes the transcription and expression of osteogenesis-related factor BMP2 and its downstream RUNX2 in the nucleus, thereby transforming the cells into osteoblasts, resulting in local calcium accumulation and vascular calcification[49, 50]. So, can IL-37 also affect NF-κB phosphorylation degree? We measured the levels of phosphorylated NF-κB (p-P65) by immunoblotting the proteins extracted from different treatment groups. Herein, we found that the expression of p-P65 increased in a concentration-dependent manner after treatment with ox-LDL compared with the control group, and increased IL-37 pretreatment inhibited this phenomenon. Taken together, this study reveald for the first time that IL-37 inhibits cellular osteogenic phenotype and reduces calcification by suppressing NF-κB phosphorylation and down-regulating the expression of TLR-NF-κB signaling pathway, thereby decreasing the transcription of osteogenic-related factors.

Taken together, our data demonstrated that IL-37 decreases the expression of the osteogenic transcription factor RUNX2/ALP by inhibiting NF-κB phosphorylation, downregulating the ox-LDL-activated TLR-NF-κB signaling pathway, inhibiting VSMC osteogenic transformation, and thereby reducing the level of cellular calcification. It is also involved in the development of apoptosis-induced vascular calcification. Thus, the current results provide a basis for IL-37 as a novel therapeutic target.

Abbreviations	Full name
VSMCs	vascular smooth muscle cells
PDTC	Pyrrolidine dithiocarbamate
IL-37	Interleukin 37
AS	Atherosclerosis
VC	Vascular calcification
ALP	alkaline phosphatase
MSX2	Msh homeobox 2
CVD	cardiovascular diseases
SMCs	smooth muscle cells
BMP2	bone morphogenetic protein-2
ox-LDL	oxidized low-density lipoprotein
LOX-1	Lectin-like oxidized low density lipoprotein receptor-1
Bcl-2	B-cell lymphoma-2
TLR	toll-like receptor
NF-κB(p65)	nuclear factor kappa-B
ERK	Extracellular signal-regulated kinas
I/R	ischemia-reperfusion
DCs	Dendritic Cells
IL-1R8	Interleukin-1 receptor 8
HA-SMC	human aortic smooth muscle cells
PBS	phosphate-buffered saline
PDTC	pyrrolidine dithiocarboxylate
ddH₂O	double-distilled wate
CCK-8	Cell counting kit-8
SMA	Smooth muscle actin
SM22α	smooth muscle 22 alpha
RUNX2	Runt-related Transcription Factor 2
OC	Osteocalcin
Pp65	phosphorylated NF-κB

Ethics approval and consent to participate

All the experimental contents meet the requirements of the Ethics Committee of Anhui Medical University.

Consent for Publication statements

Not applicable.

Data Availability

All data generated or analysed during this study are included in this published article.

Conflict of Interests

There is no conflict of interest with the publication of this article.

Funding

The Youth Incubating Program of Miltary Medical technology (code:20QNPY062), Beijing Hospital Authority Incubating Program(code:PX2022023)

Authors' contributions

MA CHEN YUE mainly contributed to the conception and design of data, also completed the performance of experiments with HE QIONG YI. WANG MENG is contributed to the analysis and interpretation of data. ZHANG HAI TAO/CHAI MENG are contributed to the drafting of the manuscript and revising for important intellectual content. CAO YU KUN is contributed to the final approval of the manuscript.

Acknowledgements

I would like to thank all the authors of this article for their cooperation and the relevant researchers for their data support.

Zhu Y, Xian X, Wang Z, Bi Y, Chen Q, Han X, Tang D, Chen R: Research Progress on the Relationship between Atherosclerosis and Inflammation. Biomolecules 2018, 8(3).
Ross R: Atherosclerosis--an inflammatory disease. N Engl J Med 1999, 340(2):115-126.
Wu M, Rementer C, Giachelli CM: Vascular calcification: an update on mechanisms and challenges in treatment. Calcif Tissue Int 2013, 93(4):365-373.
Mizobuchi M, Towler D, Slatopolsky E: Vascular calcification: the killer of patients with chronic kidney disease. J AM SOC NEPHROL 2009, 20(7):1453-1464.
Chai M, Zhang HT, Zhou YJ, Ji QW, Yang Q, Liu YY, Zhao YX, Shi DM, Liu W, Yang LX et al: Elevated IL-37 levels in the plasma of patients with severe coronary artery calcification. J GERIATR CARDIOL 2017, 14(5):285-291.
Iyemere VP, Proudfoot D, Weissberg PL, Shanahan CM: Vascular smooth muscle cell phenotypic plasticity and the regulation of vascular calcification. J INTERN MED 2006, 260(3):192-210.
Durham AL, Speer MY, Scatena M, Giachelli CM, Shanahan CM: Role of smooth muscle cells in vascular calcification: implications in atherosclerosis and arterial stiffness. CARDIOVASC RES 2018, 114(4):590-600.
Lee SJ, Lee IK, Jeon JH: Vascular Calcification-New Insights Into Its Mechanism. INT J MOL SCI 2020, 21(8).
Leopold JA: Vascular calcification: Mechanisms of vascular smooth muscle cell calcification. Trends Cardiovasc Med 2015, 25(4):267-274.
Kattoor AJ, Kanuri SH, Mehta JL: Role of Ox-LDL and LOX-1 in Atherogenesis. CURR MED CHEM 2019, 26(9):1693-1700.
Kataoka H, Kume N, Miyamoto S, Minami M, Morimoto M, Hayashida K, Hashimoto N, Kita T: Oxidized LDL modulates Bax/Bcl-2 through the lectinlike Ox-LDL receptor-1 in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 2001, 21(6):955-960.
Song Y, Hou M, Li Z, Luo C, Ou JS, Yu H, Yan J, Lu L: TLR4/NF-kappaB/Ceramide signaling contributes to Ox-LDL-induced calcification of human vascular smooth muscle cells. EUR J PHARMACOL 2017, 794:45-51.
Su X, Ao L, Shi Y, Johnson TR, Fullerton DA, Meng X: Oxidized low density lipoprotein induces bone morphogenetic protein-2 in coronary artery endothelial cells via Toll-like receptors 2 and 4. J BIOL CHEM 2011, 286(14):12213-12220.
Kumar S, Hanning CR, Brigham-Burke MR, Rieman DJ, Lehr R, Khandekar S, Kirkpatrick RB, Scott GF, Lee JC, Lynch FJ et al: Interleukin-1F7B (IL-1H4/IL-1F7) is processed by caspase-1 and mature IL-1F7B binds to the IL-18 receptor but does not induce IFN-gamma production. CYTOKINE 2002, 18(2):61-71.
McCurdy S, Yap J, Irei J, Lozano J, Boisvert WA: IL-37-a putative therapeutic agent in cardiovascular diseases. QJM 2021.
Boraschi D, Lucchesi D, Hainzl S, Leitner M, Maier E, Mangelberger D, Oostingh GJ, Pfaller T, Pixner C, Posselt G et al: IL-37: a new anti-inflammatory cytokine of the IL-1 family. EUR CYTOKINE NETW 2011, 22(3):127-147.
Chai M, Ji Q, Zhang H, Zhou Y, Yang Q, Zhou Y, Guo G, Liu W, Han W, Yang L et al: The Protective Effect of Interleukin-37 on Vascular Calcification and Atherosclerosis in Apolipoprotein E-Deficient Mice with Diabetes. J Interferon Cytokine Res 2015, 35(7):530-539.
Zeng Q, Song R, Fullerton DA, Ao L, Zhai Y, Li S, Ballak DB, Cleveland JJ, Reece TB, McKinsey TA et al: Interleukin-37 suppresses the osteogenic responses of human aortic valve interstitial cells in vitro and alleviates valve lesions in mice. Proc Natl Acad Sci U S A 2017, 114(7):1631-1636.
Liu T, Liu J, Lin Y, Que B, Chang C, Zhang J, Liang Z, Gao X, Liu S, Liu L et al: IL-37 inhibits the maturation of dendritic cells through the IL-1R8-TLR4-NF-kappaB pathway. Biochim Biophys Acta Mol Cell Biol Lipids 2019, 1864(10):1338-1349.
Kapelouzou A, Kontogiannis C, Tsilimigras DI, Georgiopoulos G, Kaklamanis L, Tsourelis L, Cokkinos DV: Differential expression patterns of Toll Like Receptors and Interleukin-37 between calcific aortic and mitral valve cusps in humans. CYTOKINE 2019, 116:150-160.
Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980-2017: a systematic analysis for the Global Burden of Disease Study 2017. LANCET 2018, 392(10159):1736-1788.
Global burden of 369 diseases and injuries in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019. LANCET 2020, 396(10258):1204-1222.
Qi F, Liu M, Li F, Lv Q, Wang G, Gong S, Wang S, Xu Y, Bao L, Qin C: Interleukin-37 Ameliorates Influenza Pneumonia by Attenuating Macrophage Cytokine Production in a MAPK-Dependent Manner. FRONT MICROBIOL 2019, 10:2482.
Tokajian S, Merhi G, Al KC, Nemer G: Interleukin-37: A Link Between COVID-19, Diabetes, and the Black Fungus. FRONT MICROBIOL 2021, 12:788741.
Liu J, Lin J, He S, Wu C, Wang B, Liu J, Duan Y, Liu T, Shan S, Yang K et al: Transgenic Overexpression of IL-37 Protects Against Atherosclerosis and Strengthens Plaque Stability. CELL PHYSIOL BIOCHEM 2018, 45(3):1034-1050.
Zhou P, Li Q, Su S, Dong W, Zong S, Ma Q, Yang X, Zuo D, Zheng S, Meng X et al: Interleukin 37 Suppresses M1 Macrophage Polarization Through Inhibition of the Notch1 and Nuclear Factor Kappa B Pathways. Front Cell Dev Biol 2020, 8:56.
Abbasian N: Vascular Calcification Mechanisms: Updates and Renewed Insight into Signaling Pathways Involved in High Phosphate-Mediated Vascular Smooth Muscle Cell Calcification. Biomedicines 2021, 9(7).
Villa-Bellosta R: Vascular Calcification: Key Roles of Phosphate and Pyrophosphate. INT J MOL SCI 2021, 22(24).
Pustlauk W, Westhoff TH, Claeys L, Roch T, Geissler S, Babel N: Induced osteogenic differentiation of human smooth muscle cells as a model of vascular calcification. Sci Rep 2020, 10(1):5951.
Shen J, Wei W, Wang X, Yang J, Lu L, Lv X, Xue X: Proliferation of Vascular Smooth Muscle Cells under ox-LDL Is Regulated by Alismatis rhizoma Decoction via InhibitingERK1/2 and miR-17 approximately 92a Cluster Activation. Evid Based Complement Alternat Med 2020, 2020:7275246.
Grootaert M, Moulis M, Roth L, Martinet W, Vindis C, Bennett MR, De Meyer G: Vascular smooth muscle cell death, autophagy and senescence in atherosclerosis. CARDIOVASC RES 2018, 114(4):622-634.
Rosner D, Stoneman V, Littlewood T, McCarthy N, Figg N, Wang Y, Tellides G, Bennett M: Interferon-gamma induces Fas trafficking and sensitization to apoptosis in vascular smooth muscle cells via a PI3K- and Akt-dependent mechanism. AM J PATHOL 2006, 168(6):2054-2063.
Proudfoot D, Skepper JN, Hegyi L, Bennett MR, Shanahan CM, Weissberg PL: Apoptosis regulates human vascular calcification in vitro: evidence for initiation of vascular calcification by apoptotic bodies. CIRC RES 2000, 87(11):1055-1062.
Yan J, Stringer SE, Hamilton A, Charlton-Menys V, Gotting C, Muller B, Aeschlimann D, Alexander MY: Decorin GAG synthesis and TGF-beta signaling mediate Ox-LDL-induced mineralization of human vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 2011, 31(3):608-615.
Han R, Luo J, Wang L, Li L, Zheng H: miR-33a-5p Suppresses ox-LDL-Stimulated Calcification of Vascular Smooth Muscle Cells by Targeting METTL3. CARDIOVASC TOXICOL 2021, 21(9):737-746.
Liao L, Zhou Q, Song Y, Wu W, Yu H, Wang S, Chen Y, Ye M, Lu L: Ceramide mediates Ox-LDL-induced human vascular smooth muscle cell calcification via p38 mitogen-activated protein kinase signaling. PLOS ONE 2013, 8(12):e82379.
Miller YI, Viriyakosol S, Worrall DS, Boullier A, Butler S, Witztum JL: Toll-like receptor 4-dependent and -independent cytokine secretion induced by minimally oxidized low-density lipoprotein in macrophages. Arterioscler Thromb Vasc Biol 2005, 25(6):1213-1219.
Liang Q, Chen Y, Li C, Lu L: [Quercetin attenuates Ox-LDL-induced calcification in vascular smooth muscle cells by regulating ROS-TLR4 signaling pathway]. Nan Fang Yi Ke Da Xue Xue Bao 2018, 38(8):980-985.
Owens GK: Regulation of differentiation of vascular smooth muscle cells. PHYSIOL REV 1995, 75(3):487-517.
Owens GK, Kumar MS, Wamhoff BR: Molecular regulation of vascular smooth muscle cell differentiation in development and disease. PHYSIOL REV 2004, 84(3):767-801.
Lu W, Zhou Y, Zeng S, Zhong L, Zhou S, Song H, Ding R, Zhong G, Li Q, Hu Y et al: Loss of FoxO3a prevents aortic aneurysm formation through maintenance of VSMC homeostasis. CELL DEATH DIS 2021, 12(4):378.
Begam H, Nandi SK, Kundu B, Chanda A: Strategies for delivering bone morphogenetic protein for bone healing. Mater Sci Eng C Mater Biol Appl 2017, 70(Pt 1):856-869.
Orth M, Kruse NJ, Braun BJ, Scheuer C, Holstein JH, Khalil A, Yu X, Murphy WL, Pohlemann T, Laschke MW et al: BMP-2-coated mineral coated microparticles improve bone repair in atrophic non-unions. Eur Cell Mater 2017, 33:1-12.
Cheng SL, Shao JS, Charlton-Kachigian N, Loewy AP, Towler DA: MSX2 promotes osteogenesis and suppresses adipogenic differentiation of multipotent mesenchymal progenitors. J BIOL CHEM 2003, 278(46):45969-45977.
Rutkovskiy A, Malashicheva A, Sullivan G, Bogdanova M, Kostareva A, Stenslokken KO, Fiane A, Vaage J: Valve Interstitial Cells: The Key to Understanding the Pathophysiology of Heart Valve Calcification. J AM HEART ASSOC 2017, 6(9).
Jiang F, Shan H, Pan C, Zhou Z, Cui K, Chen Y, Zhong H, Lin Z, Wang N, Yan L et al: ATP6V1H facilitates osteogenic differentiation in MC3T3-E1 cells via Akt/GSK3beta signaling pathway. ORGANOGENESIS 2019, 15(2):43-54.
Newberry EP, Latifi T, Towler DA: Reciprocal regulation of osteocalcin transcription by the homeodomain proteins Msx2 and Dlx5. BIOCHEMISTRY-US 1998, 37(46):16360-16368.
Lu X, Lu J, Zhang L, Xu Y: Effect of ANGPTL7 on Proliferation and Differentiation of MC3T3-E1 Cells. Med Sci Monit 2019, 25:9524-9530.
Zhao MM, Xu MJ, Cai Y, Zhao G, Guan Y, Kong W, Tang C, Wang X: Mitochondrial reactive oxygen species promote p65 nuclear translocation mediating high-phosphate-induced vascular calcification in vitro and in vivo. KIDNEY INT 2011, 79(10):1071-1079.
Zhao G, Xu MJ, Zhao MM, Dai XY, Kong W, Wilson GM, Guan Y, Wang CY, Wang X: Activation of nuclear factor-kappa B accelerates vascular calcification by inhibiting ankylosis protein homolog expression. KIDNEY INT 2012, 82(1):34-44.

No competing interests reported.

WBoriginalimageSupplementaryInformation007.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

IL-37 reduces calcification by inhibiting the oxidized low-density lipoprotein(ox-LDL)-induced toll-like receptor(TLR)/nuclear factor kappa-B(NF-κB) signaling pathway and suppressing cellular osteogenic transformation in smooth muscle cells

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

3. Results

4. Discussion

5. Conclusion

Non-standard Abbreviations And Acronyms

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1