Synthetic lethality between CCNE1 hyperactivity and PARG inhibition in breast cancer

doi:10.21203/rs.3.rs-2231840/v1

Download PDF

Article

Synthetic lethality between CCNE1 hyperactivity and PARG inhibition in breast cancer

https://doi.org/10.21203/rs.3.rs-2231840/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Poly(ADP-Ribose) polymerase (PARP) inhibitors have shown wide utility in targeting cancers with defects in homologous recombination. Poly(ADP-ribose) glycohydrolase (PARG), reverses the action of PARP enzymes and may also be an anti-cancer target. Genetic mapping of cellular factors dictating response to a PARG inhibitor by siRNA and CRISPR screens revealed chemical synthetic lethality with loss of base excision repair (BER) machinery also reflected in synergies with therapeutics that induce BER-dependent DNA damage. In a pharmacogenomic screen, Cyclin E1 (CCNE1) expression predicted PARG inhibitor efficacy across a panel of breast cancer cell lines and genetic induction of CCNE1 leads to drug sensitivity. PARG inhibitors cause excessive PAR formation, resulting in loss of cellular NAD + leading to necrosis. Hence, PARG inhibitors selectively kill cells with elevated PAR turnover, by impinging on the BER pathway or CCNE1-induced replication stress, and stalling PAR recycling may lead to runaway PAR accumulation and energy dependent cell death.

Biological sciences/Cancer/Breast cancer

Biological sciences/Drug discovery/Biomarkers

synthetic lethality

PARG inhibitor

cyclin E1

PARylation

therapeutic biomarkers

New therapeutics for breast cancer are needed especially in the case of triple negative breast cancers (TNBC), occurring in 10–15% of all breast cancers and is associated with poorer outcomes¹. Due to the lack of well-defined molecular targets, treatments for advanced TNBCs are commonly with chemotherapies and immunotherapy, with limited success for either^2,3. In addition, inhibitors of Poly(ADP-ribose) polymerase (PARP) are approved to impair tumorigenesis in cancer cells deficient in BRCA1 or BRCA2 by exploiting a synthetic lethal relationship. However, for tumors that do not display any obvious HR deficiency, tumor molecularly targeted therapeutics remain lacking.

Poly(ADP-ribose) glycohydrolase or PARG counteracts the action of PARP enzymes by cleaving poly(ADP-Ribose) (PAR) chains from PARP substrates. Poly(ADP-Ribose) polymerase (PARP) is best known for its involvement in the repair of the DNA single strand break. PARP-1 binds to the single strand breaks and becomes activated by adding PAR chains (PARylation) to itself and other DNA repair factors in the base excision repair (BER) pathway⁴. PARylation is a posttranslational modification that uses NAD + as building blocks to form linear or branched chains of PAR, which catalyze new protein-protein interactions and serves as a platform for the recruitment of DNA repair complexes. PARG, which counteracts PARP by degrading the PAR polymer off the PARylated acceptor proteins, ensures that the ADP-ribose can be re-converted to NAD + and allow PARP1 and other acceptor proteins to be ready for the next round of the reaction (Fig. 1a). PARP-1 inhibitors have been demonstrated as an effective cancer therapy for cancers with the defects in the homologous recombination (HR) repair⁵. Recently, small molecular inhibitors specific for PARG (PARGi) have been developed and shown to impair cancer cell survival^6–8, however biomarkers for patient selection for their use has not been defined^9–11.

In this study we used a combination of CRISPR and RNAi-based loss of function screens to identify that BER pathway plays a central role in the synthetic lethality with the PARG inhibitor, PDD0017273. In addition, using a pharmacogenomic screen across a panel of breast cancer cell lines we found that cyclin E1 (CCNE1) hyperactivity is both necessary and sufficient to induce sensitivity to the PARG inhibitor, making it an potential therapeutic biomarker in breast cancer. The synthetic lethality exploits cells with increased PAR turnover arising from DNA damage that impinges on the BER pathway such as replication stress induced by the hyperactivity of CCNE1. In these cells PARG inhibition results in runaway PAR accumulation leading to depletion of cellular nicotinamide adenine dinucleotide (NAD+) pools, energy depletion and metabolic cell death.

Loss of function screens implicate hyperactivation of PAR synthesis in sensitivity to PARG inhibition

To gain insights into synthetic lethal targets associated with the PARG inhibitor PDD0017273 (PARGi), two loss-of-function screens were performed. We first conducted an siRNA screen in the MCF10A cell line with a customized 612-gene knockdown library containing all known human DNA repair factors, as previously described¹². In an arrayed format one gene knockdown per well was treated with either 10uM PARGi or DMSO, and the normalized ratio of cell numbers between the two plates were measured by microscopy and used as a readout to assess gene dependency (Fig. 1b and Supplementary Table S1). The top hit was DUTP pyrophosphatase (DUT), a protein involved in dTTP nucleotide biosynthesis and whose loss results in dUTP misincorporation during DNA replication. Other hits identified function in the base excision repair pathway including LIG1, XRCC1, LIG3, and PCNA. As a follow up to this focused screen, we performed a genome-scale CRISPR dropout screen in an ovarian cancer line, OVCAR3, and a breast cancer line, MDA-MB-231. There were only a few strong dropouts in each cell line (22 in MDA-MB-231, and 56 in OVCAR3 with score ≤-1) and genes with the most depleted sgRNAs were highly overlapping between the two (n = 9, Fig. 1c and Supplementary Table S2). The top hits included TYMS encoding thymidylate synthase, a key enzyme in dTTP biosynthesis, and various genes in the BER pathway such as LIG1, POLB, XRCC1, and FEN1. Hence multiple loss-of-function screens identified synthetic lethal targets from the same pathways: dTTP biosynthesis and BER. To validate the screening targets and determine generalizability, we engineered the MCF10A cells with stable knockout of the top genes identified in the CRISPR screen and tested 5 cell lines harboring independent sgRNAs for POLB, XRCC1, LIG1, FEN1 and TYMS and confirmed that they were more sensitive to PARGi compared to the non-targeting control in a synthetic lethal manner (Fig. 1d).

We next identified drugs that can impinge on factors identified by our genetic screens. And performed a drug combination study using MCF10A cells treated with or without 10uM of PARGi, a dose which has negligible impact on growth as a single agent (Supplementary Fig. S1). We found that inhibitors of DUT (DUTi, TAS-114)^15,16 or TYMS (5-FU), as well as the DNA damaging agents known to activate the BER pathway through induction of single strand breaks (MMS, TMZ and H2O2) synergized with PARGi (Fig. 2a). In contrast, camptothecin, which is known to induce DNA double stranded breaks and does not activate BER, did not sensitize to PARGi. Hence, we hypothesize that synthetic lethality with PARG inhibition can be caused by (1) the loss-of-function of key genes in dTTP biosynthesis causing dUTP misincorporation which triggers PARP activation and requires BER pathway mediated repair, (2) the loss of members of the BER pathway leaving unrepaired single strand breaks (SSBs) and persistent PARP activation, and (3) treatment with drugs known to induce SSBs, activating PARP and requiring the BER pathway for repair (Fig. 2b). In this model cellular conditions that induce high levels of PAR synthesis through elevated PARP activation are selectively sensitive to PARG inhibitors.

Cyclin E1 Hyperactivity Is A Biomarker Of Pargi In Breast Cancer

Although we identified loss of several members of the BER pathway as potential synthetic lethal partners with PARG inhibition, mutations of these genes were not prevalent in human cancers limiting their ability to guide therapeutic stratification. We next determined the sensitivity of a panel of 20 breast cancer cell lines to PDD0017273 and associated baseline genome-wide expression at the mRNA or protein levels with drug sensitivity. Cyclin E1 (CCNE1) was the top gene whose mRNA and protein expression levels were correlated with PARGi sensitivity among this collection of cell lines (Fig. 3a and 3b; Supplementary Table S3). To further validate the correlation, we assembled a cell line panel consisting of 11 breast cancer cell lines with variable expression levels of CCNE1, including 4 lines that were not included in the original screening panel, 3 of which were CCNE1 amplified. We first quantified the CCNE1 expression levels by immunoblotting and confirmed that CCNE1 is indeed differentially expressed in the panel and the expression levels are higher in the cell lines with CCNE1 amplification or copy number gain (Fig. 3c). Sensitivities to the PARGi was determined by a long term colony formation assay and dose response curves were plotted relative to DMSO treatment (Fig. 3d, e). The sensitivity to PARGi for each cell line was defined as the area under curve (AUC) calculated from the kill curves. We confirmed a strong correlation between the CCNE1 expression at protein levels and the sensitivity to the PARGi in this expanded cell line panel (Fig. 3f).

Cyclin E1 Directly Causes Synthetic Lethality With Parg Inhibition

To determine if CCNE1 over-expression is sufficient for sensitivity to PARGi, we engineered MCF10A cells to induce CCNE1 expression in response to doxycycline (Fig. 4a) and performed colony formation assays with increasing doses of PARGi (Fig. 4b). Cells with induced expression of CCNE1 were more sensitive to PARGi compared to the non-induced controls (Fig. 4c). CCNE1 over expression is a possible underlying mechanisms of resistance to CDK4/6 inhibition in breast cancer¹⁷. To test if CCNE1 mediated CDK4/6 inhibitor resistance could lead to sensitivity to PARG inhibition, we generated Palbociclib (Palbo)-resistant cells in two breast cancer cell lines, T47D and MCF7. Immunoblotting for the protein expression of CCNE1 confirmed that CCNE1 expression was upregulated in MCF7 Palbo-resistant cells but not in the T47D Palbo-resistant cells (Fig. 4d). In turn, MCF7 Palbo-resistant cells were more sensitive to the PARGi than the T47D Pablo-resistant cells (Fig. 4e), consistent with the finding that over-expression of CCNE1 induces synthetic lethality with PARG inhibition in breast cancers.

Nad + depletion And Dna Damage As Underlying Mechanism Of Pargi Sensitivity

PARG inhibition should leads to the stabilization of PAR chains and in the case of PARP hyperactivity an increase in total amount of cellular NAD + that is consumed and converted into immobilized PAR chains. To test if this process is associated with sensitivity to PARGi we tested various cellular contexts of PARGi sensitivity that we identified. First, we compared the levels of PARylation and NAD + between the MCF10A cells expressing sgPolB (PARGi-sensitive) and the non-targeting control (PARGi-resistant) by immunoblot before and following the treatment of PARGi. sgPOLB cells harbor a higher basal level of PARylation before the PARGi treatment compared to the non-targeting control cells, whereas the difference in the level of PARylation in response to PARGi treatment was less clear (Fig. 5a). Cellular NAD + levels also dropped further in sgPOLB cells than the control cells (Fig. 5b). As a second comparison, we compared the two most PARGi-sensitive (MDA-MB-157 and HCC1806) to the two most resistant (MCF7 and T47D) cell lines in our breast cancer cell line panel, and found that larger increases in cellular PARylation and reductions in NAD + levels were found in PARGi sensitive cell lines (Fig. 5c, d). Thirdly, we used the PARP inhibitor olaparib to inhibit the upstream PARylation reaction which could completely reverse sensitivity to PARGi, an indicator of the on-target specificity of PDD0017273 (Fig. 5e, f). Rescue of PARGi sensitivity with olaparib led to complete restoration of NAD + levels (Fig. 5g). Fourth, we tested if synthetic lethality due to CCNE1 overexpression was associated with a reduction in NAD + levels. Using the inducible expression in MCF10A cells where CCNE1 over-expression results in replication stress as evident by increase in phospho-CHK1 levels (Fig. 5h), PARGi treatment resulted in roughly equivalent PAR formation yet a strong decrease in cellular NAD + cells as compared to non-induced control (Fig. 5h, i). Hence in multiple scenarios of chemical-synthetic lethality, reduction of the cellular levels of NAD + is a robust and key distinguishing feature of PARGi-sensitive versus PARGi-resistant cells.

To determine if NAD + depletion is necessary for sensitivity to PARGi we tested if drug sensitivity is rescued by the supplementation of the NAD + precursor, nicotinamide mononucleotide (NMN)¹⁸. NMN supplementation rescued cell growth robustly in HCC1806 CCNE1-amplified cells (Fig. 5j), suggesting that that cell death in response to PARGi is mostly due to the depletion of cellular NAD+. Taken together these data indicate and that in the case of CCNE1-amplified cells, increase turnover of PAR due to persistent replication stress and NAD + recycling creates a vulnerability to PARG inhibitors which interrupt this process and lead to the widespread immobilization of cellular NAD + in the form of PAR chains, leading to energy depletion and cell death (Fig. 5k).

Ccne1 Expression Is Associated With Gene Amplification In Tnbc

Cyclin E1 is a known oncogene, amplified in a variety of different cancer types¹⁹. We determined the relationship between CCNE1 gene copy number and mRNA expression and different breast cancer subtypes. In the METABRIC and TCGA breast cancer cohorts, we observed CCNE1 amplification at a higher prevalence in tumors of the Basal PAM50 subtype which is also strongly associated with receptor negative cancer (ER-, HER2-) (Fig. 6a, b). Overall, CCNE1 amplification was observed in approximately 10% of Basal cancers and 6% of receptor negative tumors in a pooled analysis of both cohorts. CCNE1 expression is strongly linked with CCNE1 amplification status in both cohorts (Fig. 6c) and CCNE1 expression is significantly higher in receptor negative breast cancers than receptor positive cancers within both breast cancer cohorts (Fig. 6d). These data indicate that high CCNE1 expression and amplification is associated with receptor negative or basal-like breast cancers, indicating a subset of tumors potentially responsive to PARG inhibition.

Poly(ADP-Ribose) polymerase (PARP) inhibitors have shown wide utility in targeting cancers with defects in homologous recombination. Recently PARG, which counteracts PARP by degrading PAR polymer into the monomer, has attracted attention as a potential therapeutic target. We used parallel RNAi and CRISPR screens to identify synthetic lethal targets for PARG inhibition. The identified targets were dominated by the key genes in the base excision repair (BER) pathway which are recruited to sites of DNA single stranded breaks by PARylated PARP1. In addition, PARG inhibitor was found to synergize with DNA damaging agents and small molecule inhibitors known to induce BER mediated repair, highlighting the key role of hyperactivated PARP1 in synthetic lethality with PARG inhibition.

Conflict

ing results exist as to whether cells with HR deficiency are selectively sensitive to PARGi. For example, two studies have demonstrated that PARG inhibition is synthetic lethal with loss of HR factors such BRCA1, BRCA2 and PALB2, while another reported no sensitivity to PARGi in several BRCA1-deficient cell lines compared to BRCA1 reconstituted counterparts^20–22. We did not identify genes involved in the HR pathway, including BRCA1 and BRCA2, as synthetic lethal targets for PARGi across 3 distinct cell lines and spanning siRNA and CRISPR screens. The reasons for this are not technical since we previously identified BRCA1 and BRCA2 as synthetic lethal partners with various PARP inhibitors using this same experimental platform¹². However, as we only assayed gross gene loss effects we cannot rule out that specific variants associated with BRCA1 or BRCA2 mutation may contribute to PARG inhibitor specificity.

Genomic instability has been described as a hallmark of human cancers²³. Oncogene-induced replication stress, which is characterized by deceleration of replication fork progression and an increase in stalled and collapsed forks, has been implicated as a major source of genomic instability driving early tumorigenesis²⁴. CCNE1 overexpression is a known driver of TNBC^{19, 25–27} and associated with poor outcome^28,29. Our analyses corroborates CCNE1 as a potential tumor driver as high expression of CCNE1 is correlated with its genomic amplification, occurring in approximately 6% of receptor negative breast cancers. CCNE1 hyperactivity results in replication stress and PARP1 activation is needed to stabilize and restart the replication fork^30–32. Hence, during replication stress cells are dependent on robust turnover of PAR to maintain replication fork dynamics and we show that when this turnover is interrupted by the inhibition of PARG, the endogenous pool of NAD + is depleted, causing metabolic catastrophe and cell death.

While Cyclin-dependent kinase 4 and 6 (CDK4/6) inhibitors such as palbociclib have shown effectiveness when used in combination with hormone therapy to treat HER2-negative/hormone receptor-positive metastatic breast cancer, resistance eventually occurs almost all cases ^33,34. CCNE1 is strongly associated with de novo resistance to palbociclib in the clinic and amplification/overexpression of CCNE1 (17) as well as amplification of CCNE2 has been reported in preclinical models as well as the clinic^17,35,36. The potential for PARG inhibition in the context of both de novo and acquired cdk4/6 inhibitor resistance could be explored in future work.

Our data also identified potentially synergistic compounds with the PARG inhibitor PDD0017273 including temozolomide (TMZ) which is clinically used for treating brain tumors as well as with more experimental agents such as DUT inhibitors. In combination with PARGi these drugs could be theoretically combined in the context of CCNE1 amplification/overexpression, provided dosing can be optimizes to avoid adverse side effects due to potentially synergistic toxicity. In this study, we have provided preclinical evidence that CCNE1 could be a predictive biomarker for a response to PARGi in breast cancer. To date, no PARGi has entered the clinic and no in vivo inhibitors has been identified yet, potentially owing to poor pharamacokinetic and phamracodynamic properties in vivo including a short half-life and lack of sustained target coverage³⁷. Further work will be required to optimize this class of compounds for use in vivo and ultimately for use in the clinic.

Cell culture

All breast cancer cell lines and the human mammary epithelial cell line MCF10A were obtained from ATCC and maintained according to the recommended condition or as previously published¹². Cells were cultured in a humidified incubator with 5% CO₂ at 37°C. Cell line drug screening was performed by Eurofins Scientific and IC₅₀ determined by high content microscopy. All drugs were purchased from SelleckChem. Palbociclib resistant cells were generated by growing MCF7 and T47D cells in the culture medium with concentration of Palbociclib with stepwise increase from 10nM to final 1.0µM or 0.5µM over the course of 8 weeks.

Esirna And Crispr Screening

MCF10A cells were reverse transfected in 384-well plates (1,000 cells per well) using 5ng of pre-spotted esiRNA with RNAiMax (0.05µl per well) as a transfection reagent. Cells were transfected for 24 hours then exposed to each drug at IC₅₀ concentration or DMSO control for 72 hours using a minimum of 4 replicates and cell number counted using microscopy. Proliferation was measured by staining with Hoescht nuclear dye and cell number counted using a Thermo CellInsight high content microscope. CRISPR screening was performed by transducing the Cas9-expressing MDA-MB-231 and OVCAR3 cells with the CRISPR Human Genome 80K Knockout Library (Cellecta Inc.) at an MOI of 0.3 and a library fold-coverage of 400× (∼40 million transduced cells). 72 h post-infection (and 48 h post-puromycin selection) cells were split into two independent replicate populations. In addition, time 0 reference samples were collected (18 million cells) for genomic DNA extraction. Replicate populations were treated with or without 10µM of PDD0017273 and passaged in parallel every four days, with 18 million cells seeded over five 15 cm plates per population. Samples were collected at day 7 and 14. The gRNA target sequences cloned into the lentiCRIPRv2^13,14 for the stable knockout of the BER genes are: XRCC1 (GAATGATGGCTCAGCTTTCG); POLB (ACCTGTAAGCATTGTACTTG); LIG1 (GGGATTCCGAAGCGTCGCAC); TYMS (TGACAACCAAACGTGTGTTC); and FEN1 (AGCCCGCCGCTCACTGCGTT).

Immunoblotting And Cellular Assays

Whole cell extracts were prepared in RIPA buffer supplemented with protease inhibitor cocktail and phosphatase inhibitor cocktail (Sigma). Proteins were separated on NuPAGE Novex Bis-Tris or Tris-Acetate gels (Invitrogen) and blotted onto a PVDF. The blots were incubated with primary antibodies diluted in PBS containing 0.1% Tween-20 at 4°C overnight. Horseradish peroxidase-conjugated secondary anti-mouse or anti-rabbit antibodies (Cell Signaling, 7074 and 7076) were used at 1:10,000 dilution. Primary antibodies used in this study were: PAR (Tulip BioLabs, 1020/N), CCNE1 (Cell Signaling, 4129), phospho-CHK1(Ser345) (Cell Signaling, 2348). β-actin (Cell Signaling, 3700). NAD + quantitation was done using NAD/NADH Quantitation Kit (Sigma-Aldrich) according to the manufacturer's recommendations.

Cell Growth Assays

Cells were seeded onto 384-well plates (1,000 cells/well) 18 hours prior to treatment with drug either singly or in combination with another drug. For drug combination assay cells were treated with 10µM of PDD0017273 plus DMSO or plus drugs. After a 72 hour drug treatment, cell proliferation was determined by staining with Hoescht 33342 (5µg/ml) and cell number counted using a Thermo CellInsight High Content microscope. For colony formation assays, attached cells were seeded at varying density between 1,000 and 25,000 cells per well on 12-well plates. After 24 hours cells were treated with DMSO or PDD00017273 for 8 to 14 days. After PBS wash, cells were fixed in methanol at -20ºC for 15 min and stained with crystal violet for 30 minutes. For HCC1599 cells that grow as a suspension, cell growth was visualized by staining with nitroblue tetrazolium chloride solution. Images were scanned with Epson V600 Photo Scanner.

Study Cohorts

Cancer genomics analysis was performed by querying the online cBioPortal for Cancer Genomics (http://www.cbioportal.org/; date last accessed, March 16, 2022). The first cohort was from the Molecular Taxonomy of Breast Cancer International Consortium (METABRIC) database. We included tumors from 1904 patients of which gene expression data, copy number alteration data, and subgroup identification were all included. For the second cohort, we included 463 breast cancer tumors from the Cancer Genome Atlas (TCGA; 2012) database. The data included gene expression, copy number alteration (CNA) and subgroup identification. For both cohorts, receptor calls were determine manually using immunological histological chemistry (IHC) status for ER and HER2.

Statistical analysis

Statistical analyses were performed using R version 4.1.3 statistical software. The Mann-Whitney Wilcoxon test and the Kruskal-Wallis test were utilized to compare mRNA median expression differences between breast cancer groups. A two-sided p-value less than 0.05 was considered significant.

Acknowledgments

The authors acknowledge members of the Bandyopadhyay lab, Alan Ashworth and members of Ideaya Biosciences for insightful discussions on this work.

Author Contributions

Design of the study: H.H., M.J., S.B. Acquisition and analysis of data: H.H., M.J., S.B Writing of manuscript: H.H., M.J., S.B.

Competing Interests

S.B. has consulting and research funding relationships with Pfizer, Ideaya Biosciences and Revolution Medicines.

Dawson, S. J., Provenzano, E. & Caldas, C. Triple negative breast cancers: Clinical and prognostic implications. Eur J Cancer 45, 27–40 (2009).
Mehanna, J., Haddad, F. G. H., Eid, R., Lambertini, M. & Kourie, H. R. Triple-negative breast cancer: Current perspective on the evolving therapeutic landscape. Int J Womens Health 11, 431–437 (2019).
Lin, N. U. et al. Clinicopathologic features, patterns of recurrence, and survival among women with triple-negative breast cancer in the National Comprehensive Cancer Network. Cancer 118, 5463–5472 (2012).
Almeida, K. H. & Sobol, R. W. A unified view of base excision repair: Lesion-dependent protein complexes regulated by post-translational modification. DNA Repair 6, 695–711 (2007).
Fong, P. C. et al. Inhibition of Poly(ADP-Ribose) Polymerase in Tumors from BRCA Mutation Carriers. N Engl J Med 361, 123–134 (2009).
James, D. I. et al. First-in-class chemical probes against poly(ADP-ribose) glycohydrolase (PARG) inhibit DNA repair with differential pharmacology to olaparib. ACS Chem Biol 11, 3179–3190 (2016).
Jain, A. et al. Poly (ADP) ribose glycohydrolase can be effectively targeted in pancreatic cancer. Cancer Res 79, 4491–4502 (2019).
Pillay, N., Brady, R. M., Dey, M., Morgan, R. D. & Taylor, S. S. DNA replication stress and emerging prospects for PARG inhibitors in ovarian cancer therapy. Prog Biophys Mol Biol 163, 160–170 (2021).
Miwa, M. & Masutani, M. PolyADP-ribosylation and cancer. Cancer Sci 98, 1528–1535 (2007).
Slade, D. PARP and PARG inhibitors in cancer treatment. Genes Dev 34, 360–394 (2020).
Tanuma, S. ichi, Shibui, Y., Oyama, T., Uchiumi, F. & Abe, H. Targeting poly(ADP-ribose) glycohydrolase to draw apoptosis codes in cancer. Biochem Pharmacol 167, 163–172 (2019).
Hu, H. M. et al. A Quantitative Chemotherapy Genetic Interaction Map Reveals Factors Associated with PARP Inhibitor Resistance. Cell Rep 23, 918–929 (2018).
Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84–87 (2014).
Sanjana NE, Shalem O & Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 11, 783–784 (2014).
Yano, W. et al. TAS-114, a first-in-class dual dUTPase/DPD inhibitor, demonstrates potential to improve therapeutic efficacy of fluoropyrimidine-based chemotherapy. Mol Cancer Ther 17, 1683–1693 (2018).
Hagenkort, A. et al. dUTPase inhibition augments replication defects of 5-Fluorouracil. Oncotarget 8, 23713–23726 (2017).
Herrera-Abreu, M. T. et al. Early adaptation and acquired resistance to CDK4/6 inhibition in estrogen receptor-positive breast cancer. Cancer Res 76, 2301–2313 (2016).
Revollo, J. R., Grimm, A. A. & Imai, S. I. The NAD biosynthesis pathway mediated by nicotinamide phosphoribosyltransferase regulates Sir2 activity in mammalian cells. J. Biol Chem 279, 50754–50763 (2004).
Schraml, P. et al. Cyclin E overexpression and amplification in human tumours. J Pathol 200, 375–382 (2003).
Gravells, P., Grant, E., Smith, K. M., James, D. I. & Bryant, H. E. Specific killing of DNA damage-response deficient cells with inhibitors of poly(ADP-ribose) glycohydrolase. DNA Repair 52, 81–91 (2017).
Noll, A., Illuzzi, G., Amé, J. C., Dantzer, F. & Schreiber, V. PARG deficiency is neither synthetic lethal with BRCA1 nor PTEN deficiency. Cancer Cell Int 16, 1–13 (2016).
Fathers, C., Drayton, R. M., Solovieva, S. & Bryant, H. E. Inhibition of poly(ADP-ribose) glycohydrolase (PARG) specifically kills BRCA2-deficient tumor cells. Cell Cycle 11, 990–997 (2012).
Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell 100, 57–70 (2000).
Bartkova, J. et al. DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis. Nature 434, 864–870 (2005).
Jiang, Y. Z. et al. Genomic and Transcriptomic Landscape of Triple-Negative Breast Cancers: Subtypes and Treatment Strategies. Cancer Cell 35, 428–440 (2019).
Curtis, C. et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 486, 346–352 (2012).
The Cancer Genome Atlas Network. Comprehensive molecular portraits of human breast tumours. Nature 490, 61–70 (2012).
Zhao, H. et al. Prognostic values of CCNE1 amplification and overexpression in cancer patients: A systematic review and meta-analysis. J Cancer 9, 2397–2407 (2018).
Ayhan, A. et al. CCNE1 copy-number gain and overexpression identify ovarian clear cell carcinoma with a poor prognosis. Mod Pathol 30, 297–303 (2017).
Spruck, C. H., Won, K. A. & Reed, S. I. Deregulated cyclin E induces chromosome instability. Nature 401, 297–300 (1999).
Jones, R. M. et al. Increased replication initiation and conflicts with transcription underlie Cyclin E-induced replication stress. Oncogene 32, 3744–3753 (2013).
Bryant, H. E. et al. PARP is activated at stalled forks to mediate Mre11-dependent replication restart and recombination. EMBO J 28, 2601–2615 (2009).
Cristofanilli, M. et al. Fulvestrant plus palbociclib versus fulvestrant plus placebo for treatment of hormone-receptor-positive, HER2-negative metastatic breast cancer that progressed on previous endocrine therapy (PALOMA-3): final analysis of the multicentre, double-blind, phase 3 randomised controlled trial. Lancet Oncol 17, 425–439 (2016).
Sledge, G. W. et al. MONARCH 2: Abemaciclib in combination with fulvestrant in women with HR+/HER2-advanced breast cancer who had progressed while receiving endocrine therapy. J Clin Oncol 35, 2875–2884 (2017).
Guarducci, C. et al. Cyclin E1 and Rb modulation as common events at time of resistance to palbociclib in hormone receptor-positive breast cancer. NPJ Breast Cancer 4, 1–10 (2018).
Wander, S. A. et al. The genomic landscape of intrinsic and acquired resistance to cyclin-dependent kinase 4/6 inhibitors in patients with hormone receptor–positive metastatic breast cancer. Cancer Discov 10, 1174–1193 (2020).
Acton, B. et al. Fluoromethylcyclopropylamine derivatives as potential in vivo toxicophores – A cautionary disclosure. Bioorganic Med Chem Lett 29, 560–562 (2019).

There is a conflict of interest S.B. has consulting and research funding relationships with Pfizer, Ideaya Biosciences and Revolution Medicines.

SupplementaryFigure.docx
SupplementaryTableS1.xlsx
Supplementary Table S1
SupplementaryTableS2.xlsx
SupplementaryTableS3.xlsx
Supplementary Table S3

Download PDF

Editorial decision: revise
16 Dec, 2022
Review #3 received at journal
15 Dec, 2022
Reviewer #3 agreed at journal
06 Dec, 2022
Review #1 received at journal
05 Dec, 2022
Review #2 received at journal
30 Nov, 2022
Reviewer #2 agreed at journal
17 Nov, 2022
Reviewer #1 agreed at journal
16 Nov, 2022
Reviewers invited by journal
16 Nov, 2022
Editor assigned by journal
08 Nov, 2022
Submission checks completed at journal
08 Nov, 2022
First submitted to journal
02 Nov, 2022

You are reading this latest preprint version

Synthetic lethality between CCNE1 hyperactivity and PARG inhibition in breast cancer

Status:

Version 1

Abstract

Figures

Introduction

Results

Loss of function screens implicate hyperactivation of PAR synthesis in sensitivity to PARG inhibition

Cyclin E1 Hyperactivity Is A Biomarker Of Pargi In Breast Cancer

Cyclin E1 Directly Causes Synthetic Lethality With Parg Inhibition

Nad + depletion And Dna Damage As Underlying Mechanism Of Pargi Sensitivity

Ccne1 Expression Is Associated With Gene Amplification In Tnbc

Discussion

Methods

Cell culture

Esirna And Crispr Screening

Immunoblotting And Cellular Assays

Cell Growth Assays

Study Cohorts

Statistical analysis

Declarations

Acknowledgments

References

Additional Declarations

Supplementary Files

Status:

Version 1