Genome-Wide Identification of the CER1 Gene Family in Plants and Stress-Responsive Expression of the MdCER1 Genes

doi:10.21203/rs.3.rs-2232804/v1

Download PDF

Research Article

Genome-Wide Identification of the CER1 Gene Family in Plants and Stress-Responsive Expression of the MdCER1 Genes

https://doi.org/10.21203/rs.3.rs-2232804/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Plant cuticular wax is an important factor affecting the growth and quality of plants through protecting the plant from drought, and other diseases. It is reported that CER1 encodes a core enzyme involved in VLC alkane biosynthesis which can affect plant response to stress, but no characterization of CER1 gene and its family has been reported in apples. In this study, we identified 3 MdCER1 genes in Malus domestica and named MdCER1-1 to MdCER1-3, then we analyzed their sequences feature, expression patterns to screen highly expressed genes for cloning and functional verification. Expression analysis by real-time PCR showed that drought stress could induce MdCER1-like overexpression. The experiment of water loss showed that overexpression of MdCER1-like could effectively prevent water loss in apple calli, and the effect was more significant under drought stress. Meanwhile, the expression of wax metabolism related genes MdYPB5, MdCER3 and MdKCS1 was significantly up-regulated, GC-MS analysis of wax fraction showed that overexpression of MdCER1-like significantly increased the content of alkanes. The enzyme activities (SOD, POD) of overexpressed apple calli increased signifcantly, while the contents of malondialdehyde and proline decreased. In a word, MdCER1-like plays an important role in wax metabolism and tissue water retention, and provides a theoretical basis for exploring its role in drought stress.

apple

wax

MdCER1 gene family

expression

drought

Terrestrial plants evolved a protective barrier called cuticle that controls the movement of water between the outer cell wall of the epidermis [1]. These cuticular waxes are composed mainly of complex mixtures of very long-chain fatty acids (VLCFAs) and their derivatives, and its carbon chain ranges from C20 to C36 [2]. Among them, ultra-long-chain fatty acids are essential for plant survival and have multiple functions during plant development [3], it plays an important role in the interaction between plants and the environment and in responses to environmental stress, such as water shortage, unpredictable temperature [4]. Previous studies showed that the storage performance of fruits is also associated with the formation and structure of the wax on the fruit surface [5].

Recently, wax-related genes have been widely excavated, especially those concerned with the regulation of alkane synthesis. Arabidopsis thaliana eceriferum (CER1) gene has been reported to control VLC alkane formation and play a key role in the alkane-forming pathway [6]. The CER1 gene family was proved that it encodes aldehyde decarboxylase (AD), which is responsible for converting ultra-long chain aldehydes into ultra-long chain alkanes, which controls wax biosynthesis in plants in turn [7]. Further, recent studies have modified cuticular waxes to improve drought tolerance in plants by using genetic approaches [8]. A propose that the expression of ZxABCG11 in Arabidopsis promotes cuticular wax accumulation and thicker cuticle formation, thereby enhancing drought tolerance [9]. Ectopic expression of wax-associated genes and transcription factors in transgenic plants can increase wax deposition and confer increased tolerance to water deficiency stress in some species [10]. T-DNA insertional mutants of CER1 are devoid of VLC alkanes and their derivatives, whereas the contents of odd carbon-numbered alkanes and iso-branched alkanes are increased in the CER1-overexpressing plants [11]. Compared with wild-type plants, CER1 mutants showed smooth green stems and the content of alkanes and their derivatives was significantly reduced, indicating that the mutation of wax synthesis gene not only resulted in the change of wax crystal layer on the surface of plants, but also changed the structure of cuticle layer [12]. However, the current reports on the regulation mechanism of CER1 on adversity are extremely limited. In particular, the molecular mechanism of wax metabolism-regulating adversity requires more comprehensive research.

In the present study, we identified the MdCER1 gene family combined with the qRT-PCR, and selected the genes with the highest expression level to characterize their expression patterns under drought stress. We investigated the effect of overexpression of MdCER1-like on epidermal permeability and related physiological indexes of apple calli under drought stress. This study lays a foundation for future studies on wax metabolism and improving environmental stress tolerance.

Isolation of genes from the transcriptome

Using apple varieties with different overwintering properties (‘Miyazakifuji’ and ‘Oregon Spur delicious’) as experimental materials, branches were sampled in the initial dormancy period, deep dormancy period and freeze-thaw alternate period, and the samples were sent to Shanghai Ouyi Biomedical Technology Co Ltd for transcriptome analysis. The transcriptome report was analyzed and the CER1-related wax synthesis was selected, its transcriptome sequence was compared with the sequence obtained by NCBI, and the sequence with the highest similarity was selected for gene identification and cloning.

Genome identification of MdCER1 genes in apple

The protein sequence of CER1 family genes was obtained from Apple Genome Data (https://iris:angers.inra.fr/gddh13/), and the Arabidopsis CER1 protein data was obtained from TAIR (https://www.arabidopsis.org). Download the Hidden Markov Model from the Pfam (http://pfam.xfam.org/) website, and use the online software SMART (https://smart.embl-heidelber

g.de/) to perform preliminary screening of the candidate genes. ExPASy Proteomics Server (http://web.expasy.org/protparam) was used to analyze the molecular weight, length, isoelectric point and hydrophilicity of the apple MdCER1 amino acid sequence. Use the online website http://www.genscript. com/psort/wolf-psort.html for subcellular location prediction.

Phylogenetic analysis of MdCER1 family members

The online software MEME (http://meme-suite.org/tools/meme) was used to predict the conserved motifs of the MdCER1 gene family, and the maximum number of conserved sequence identifications was set to 10. Use TBtools to map the gene structure and conserved motifs of the apple MdCER1 gene family. Use MapChart2.2 software and TBtools for chromosome mapping. Use DNAMAN software to carry out multiple sequence alignment. Sequence identity is 100% marked with dark blue and >50% is marked with light blue.

Phylogenetic trees based on protein sequences were constructed using the Neighbor-Joining (NJ) method in MEGA7 (ver.7.0.2) based on the Poisson model and complete deletion. The reliability of the tree was tested using 1 000 bootstrap replicates. The tree was illustrated by MEGA7.

To analyze the cis-acting elements contained in the promoter region of apple MdCER1 genes, the 2 kbp upstream sequences of each gene were extracted by TBtools and submitted to the online website PlantCare (http:// bioin forma tics. psb. ugent. be/ webto ols/ plant care/ html/) for cis-acting elements prediction.

Expression characteristics of apple MdCER1 gene family under drought stress

With the tissue cultured seedlings of Begonia chinensis as the test material, the seedlings of the subsequent generation Begonia chinensis were placed on the rooting medium to induce rooting. Begonia serrata was moved into light incubators with 15% PEG for stress treatment after rooting, and the light intensity all are kept at 5000lx, each treatment contains 15 plants, 3 biological replicates after the stress treatment 0, 6, 12, 24 and 48h, the leaves are quickly frozen in liquid nitrogen, store at -80°C for use in gene tissue expression analysis.

The rooting medium of Begonia begoniasis is 1/2MS+sucrose+agar+0.5mg/L6-BA+ 0.1mg/LNAA, and the pH is 5.8-6.0.

Use the kit to extract RNA from the remaining branches for subsequent quantification. Total RNA was extracted using an RNA plant reagent (Tiangen, China). The RNA (1–7μg) was reverse-transcribed using the PrimeScript first-strand cDNA synthesis kit (TaKaRa, China). Quantitative real-time (qRT) PCR was used to detect the expression level of the MdCER1 family in different apple organs and in response to cold. MdActin (GenBank accession number: CN938024) was selected as an internal control gene. All of the primers are shown in Table 1. The results were based on the average of three parallel experiments.

Table 1 Primer sequence

Purpose		Primer	Primer sequence (5′–3')
Reference genes		MdActin-F	TGAGGGCAAGGTGAAGGGTATCTT
Reference genes		MdActin-R	TCAAGTCAACCACACGCGTACTGT
Quantitative real-time PCR	MD02G1226900	qMdCER1-1-F	AGGCTCCTTCAAGTATGTGCTGTTC
	MD02G1226900	qMdCER1-1-R	TGGTGAATTACGGCTCGAAGTATGC
	MD07G1086200	qMdCER1-2-F	GGAAGGTTGGAAGGAGCATGAGTG
	MD07G1086200	qMdCER1-2-R	ACATCGGTTGAGTGGTGACAAGTG
	MD13G1273200	qMdCER1-3-F	GATATGGTTGGTGGGTGATGGACTG
	MD13G1273200	qMdCER1-3-R	GGGTGGGAATTGTGAGAAGGGAAC
Gene clone		MdCER1-like-F	ATGGCTTCTATGCCTGGA
Gene clone		MdCER1-like-R	TTACATCGGTTGAGTGGTG
Quantitative real-time PCR		qMdKCS1-F	CCAGCGGGAAGACGACAAAGG
		qMdKCS1-R	CGGTAAACGGCAGGACGAGTG
		qMdCER3-F	AGGCTCCTTCAAGTATGTGCTGTTC
		qMdCER3-R	TGGTGAATTACGGCTCGAAGTATGC
		qMdYPB5-F	ACCCGAGATGGAAGAGAGGAAACTG
		qMdYPB5-R	GCTTGCGAGACTTGAGAACTGACC

Cloning and bioinformatics analysis of MdCER1-like

Using real-time fluorescence quantification to screen out the highly expressed gene in response to drought stress (Genbank Accession No.LOC103406883). Through multiple sequence alignment with the CER1 gene obtained from transcriptome, it was found that the similarity reached 98.1% and was named MdCER1-like. Hence, MdCER1-like was selected for cloning and functional verification.

0.1 g of leaves were measured and the total RNA of the samples was extracted by Trizol method. Reverse transcription was performed according to TAKARA's PrimeScripttMRT Reagent Kit with gDNA Eraser (Perfect Real Time). CER1 CDS sequences were retrieved from the Apple genome database, and specific primers were designed with DNAMAN software (Table 1). PCR amplification was performed. Reaction procedure: pre-denaturation at 95 ℃ for 5 min, 95 ℃ denaturations for 30 s, 58 ℃ annealings for 30 s, extension at 72 ℃ for 90 s, and repeated for 42 cycles. Extended at 72 ℃ for 10 min. The PCR product was electrophoresis with 2% Agarose gel, and the target bands were recovered. The pMD19-T clone vector (TaKaRa, Dalian, China) was attached to the PCR product for sequencing.

Agrobacterium mediated transformation of M. domestica cv Wanglin apple calli

The wild-type calli was cultured for 15 days, calli of the same culture state were immersed in infection solution with an OD value of 0.8 to 1.0 cultured in the dark (120 rpm) for 15-20 min, and then filtered. The calli were placed on solid MS medium for 2 days and then spread evenly on 250 mg/L cephalosporin and 30 mg/L kanamycin resistance medium. They were screened for about 30 days on the plate until a transgenic callus was obtained.

Determination of related physiological indexes

Healthy growing wild-type calli and three ectopic MdCER1-like calli lines were selected. Under dark conditions, the calli was wrapped in gauze and immediately placed in ddH₂O for infiltration for 1 h, and then the residual water on the surface of the material was dried with a sterile filter paper. The material was weighed every 40 min until 160 min under dark conditions to calculate the rate of water loss from the calli. The water loss rate among calli was determined by the same method and the expression of related genes was calculated by fluorescence quantitative method after drought stress. SOD, POD and Pro determination refers to Zhang [13].

0.2g lyophilized samples were weighed and added with 5ml extract (methanol: trichloromethane=2:1) and 50μL heptadecanoic acid internal standard (1mg/ml). The samples were extracted for 20min and left for 15min. 1ml potassium hydroxide methanol solution (0.4mol/l) was added, and the solution was placed in a water bath at 65℃ for 15min after filtration by 0.45μm organic filter membrane. Then 2ml boron trifluoride methanol (14%) was added to the water bath at 65℃ for 30min, and 2ml n-hexane was added for extraction. The supernatant was added to the brown sample bottle for GC-MS detection. According to the mass spectrometric data, check the results of machine inspection against the standard spectrogram, and calculate the content of each component after determining the composition.

Statistical analysis

Experimental data are presented as means ± standard error (SE) of three independent replicates. Excel 2016 was used to organize the statistical data, SPSS 22.0 (IBM, Armonk, NY, USA) was used to analyze the data, Origin 9.1 was used to draw the map, and Duncan method of single-factor ANOVA was used to compare the significant level of difference (P<0.05).

Transcriptome differential gene analysis

In the transcriptome differential gene analysis, the total number of up-down-regulated genes was not much different, and the down-regulated genes were slightly more than the up-regulated genes (Fig. 1a). The overwintering shooting shriveling rate of apples is closely related to wax synthesis and metabolism. In the wax synthesis pathway, the down-regulated genes were significantly more than the up-regulated genes, and the down-regulated genes were 1.6 times higher than the up-regulated genes (Fig. 1b). Through KEGG pathway analysis, it can be seen that the wax metabolism pathway is significantly enriched. As shown in Fig. 1c, C16 palmitic acid can form 16 by inducing the expression of CYP86A4, CYP704B1, and 1.1. -Hydroxypalmitate, 16-oxalate palmitate and hexadecanedioate, etc., can also form 10,16-dihydroxypalmitate under the action of CYP77A6. C18 oleic acid can pass 1.14.1480, 1.1.- .-Isogene expression to form Octadec-9-ene-1,1-dioic-acid.

The main components of wax are unsaturated fatty acids and their derivatives, such as alkanes, alcohols and acids, etc., and each substance can be converted by different transcription factors. As a gene for aldehyde-to-alkane conversion, CER1 plays an important role in wax metabolism (Fig. 2).

Gene identification of the MdCER1 family in apple

Using the apple genome database, a total of 3 apple MdCER1 genes were obtained through BLAST homology comparison and SMART analysis, namedly MdCER1-1 to MdCER1-3. There is no significant difference in amino acid length, the isoelectric point range is between 8.74-9.13. The molecular weight of the protein is between 71303.17-72826.61D, MdCER1 is a hydrophilic protein and has the highest fat coefficient.

Table 2 Analysis of physicochemical properties of apple MdCER1 gene family

Accession No.	Gene name	Size (aa)	Molecular weight (D)	Isoelectric point	Grand average of hydropathicity (GRAVY)	Aliphatic index
MD02G1226900	MdCER1-1	628	72826.61	8.76	-0.026	95.62
MD07G1086200	MdCER1-2	614	71303.17	8.74	-0.139	88.27
MD13G1273200	MdCER1-3	633	72165.15	9.13	0.135	100.84

Protein motif analyses of MdCER1 genes in apple

Multiple protein motifs were predicted in the MdCER1 genome, which indicated the diversification of the apple genome. MEME was used to clarify the prediction, and ten motifs were predicted. Motifs were linked with the phylogenetic tree as expected, suggesting that there were functional similarities between each identification group. Several highly conserved sequences of these motifs were then clarified by WebLogo, indicating that these sequences might have important biological functions. All genes have both CDS (translation region) and UTR (untranslated region), and the remaining genes only contain CDS (translation region).To further prove this result, use HMMER software to analyze the protein sequences of MdCER1, and find it contains fatty acid hydroxylase superfamily and waxy carbon-terminal conserved domains(Fig. 4).

Chromosomal localizations of MdCER1 genes in apple

The chromosomal location was analyzed to visualize the genetic information of the MdCER1 genes. The result showed that these genes were unequally distributed in the chromosomes of apple, concentrated on chr 02, chr 07 and chr13.

Multiple Sequence Alignment of MdCER1 genes in apple

After multiple comparisons with DNAMAN software, it is found that the protein sequences of its family members have the same conserved domains. They all have fatty acid dehydrogenase conserved domains (marked with black lines) and waxy carbon-terminal regions conserved domains ( marked with green lines), and there are two histidine clusters in the fatty acid dehydrogenase conserved domain(marked with a red rectangle), the histidine cluster structure is very important for the executive function of CER1.

Analysis of cis‑acting elements in promoter region of MdCER1 genes

To understand the cis-acting elements contained in the promoter region of MdCER1 genes, 2 kbp sequences upstream of MdCER1 genes were taken for analysis. The results showed that multiple promoter regions of MdCER1 genes enriched cis-acting elements respond to auxin, gibberellin, ABA, salicylic acid, drought, low temperature and light (Fig. 7). This indicates that the function of MdCER1s may include a series of biological processes, such as regulating plant growth and development, plant hormone signal transduction, and plant resistance to stress.

Expression of MdCER1 gene under drought stress and transcriptome sequence alignment with NCBI sequence of MdCER1

It can be seen from Fig. 8a that the three family members of MdCER1 are all up-regulated under drought stress with the extension of the stress time. Furthermore, MdCER1-1 was highly up-regulated compared with other genes under drought stress, so it was selected and used for subsequent genetic transformation analysis. Then, the CER1 protein sequence obtained from the transcriptome was compared with the MdCER1-1 protein sequence by DNAMAN. It was found that the similarity between the protein sequence of MdCER1-1 and the transcriptome sequence was as high as 98.1% (Fig. 8b), so the name in the transcriptome (MdCER1-like) was used for cloning and identification.

Protein sequence analysis of MdCER1-like gene

The CER1 protein sequences of 12 plants were downloaded from the NCBI and analyzed by multiple sequence comparison, including M.domestica, Manihot esculenta, Rosa chinensis, Mangifera indica, Solanum pennellii, Glycine max, Glycine soja. The amino acid sequence was performed by DNAMAN software, and the results showed that there are certain differences between the C-terminal and the N-terminal, but they all have the same domain (Fig. 9). The MdCER1-like and CER1 protein sequences of other species were selected to construct a phylogenetic tree with with MEGA-X soft-ware, the result showed MdCER1-like is a unique branch in the entire evolutionary tree (Fig. 10).

Analysis of cis-acting elements of MdCER1-like promoter

PlantCare was used to predict cis-acting elements in apple MdCER1-like promotors, including regulatory responsive elements related to abscisic,light, drought-inducibility, defense and stress, salicylic acid, MeJ and so on (Table 3). This indicates that MdCER1-like can respond to various external signals such as drought, light, and hormone, and participate in a series of biological processes to regulate plant growth and development.

Table 3 Cis-acting regulatory elements in the upstream regulatory sequences of MdCER1-like

cis-acting element	Sequence	Function of site	quantity
TCA-element	CCATCTTTTT	cis-acting element involved in salicylic acid responsiveness	4
CAAT-box	CAAAT	common cis-acting element in promoter and enhancer regions	14
MBS	CAACTG	MYB binding site involved in drought-inducibility	1
MRE	AACCTAA	MYB binding site involved in light responsiveness	4
TGA-element	AACGAC	auxin-responsive element	1
TGACG-motif	TGACG	cis-acting regulatory element involved in the MeJA-responsiveness	1
A-box	CCGTCC	cis-acting regulatory element	2
ABRE	TACGGTC	cis-acting element involved in the abscisic acid responsiveness	1
Box 4	ATTAAT	part of a conserved DNA module involved in light responsiveness	4
CGTCA-motif	CGTCA	cis-acting regulatory element involved in the MeJA-responsiveness	1
ARE	AAACCA	cis-acting regulatory element essential for the anaerobic induction	1
O2-site	GATGATGTGG	cis-acting regulatory element involved in zein metabolism regulation	1

Cloning of MdCER1-like genes

1864 bp band was obtained by PCR amplifcation (Fig.11). The recovered and burifed target band was connected to pMD19-T vector and transferred into Trans 5α. After selecting positive clones, samples were sent for sequencing. Sequencing analysis showed that the clones were correct and consistent with the expected size. The MdCER1-like gene of apple contained a complete open reading frame of 1864 bp.

Screening and identification of overexpression calli

The calli of overexpression calli was obtained by transplanting stalk infection. Compared with the wild-type calli, the expression level of MdCER1-like in the overexpressed calli was significantly higher than that in the wild-type plants.

Morphological characteristics and physiological indices of apple calli overexpressing MdCER1-like gene under drought stress

To further characterize the function of MdCER1-like in response to drought stress, transgenic and WT apple calli were grown under drought and normal conditions. As shown in Fig. 13,OE MdCER1-like and WT calli did not difer in fresh weight under normal conditions. However, the fresh weight of transgenic calli was signifcantly higher than that of WT controls under drought conditions.

Changes in epidermal wax-related genes often lead to changes in epidermal permeability. In order to verify this conjecture, WT and three transgenic lines were used as materials for water loss test. The results showed that compared with the three transgenic lines with ectopic expression of MdCER1-like, the calli with empty vector had a faster water loss rate (Fig. 14a), in addition, the overexpressed lines could also effectively reduce the water loss capacity of calli under drought stress, and the OE-2 line had the best effect (Fig. 14b), which further proved that ectopic expression of MdCER1-like significantly reduced the surface permeability of calli.

To further clarify the response of MdCER1-like to drought stress, WT and three transgenic calli (OE-1, OE-2, OE-3) were subjected to 20-day stress treatment respectively. The results showed that under normal conditions, there was no significant difference between WT and OE MdCER1-like, the fresh weight of transgenic calli was significantly higher than that of WT control under drought stress, the expression of MdCER1-like gradually increased with the extension of stress time, reaching the highest level at 48h (12.032)(Fig. 14c). The expression levels of wax-related synthetic genes showed that MdYPB5 and MdCER3 increased gradually, while MdKCS1 increased first and then decreased, and reached the highest level at 24h (11.0104)(Fig. 14-d).

We used GC-MS to analyze the fraction of wax in OE1-3 and WT calli after drought stress (Fig. 15a,b). The results showed that the waxy fractions in WT were mainly fatty acids, alkanes, alkenes, alcohols, aldehydes and unidentified components, among which the n-alkanes was the highest. Compared with WT, the content of n-alkanes and alkenes increased significantly in OE1-3 (Fig.15-c), indicating that the overexpression of MdCER1-like significantly promoted the accumulation of alkanes.

Additionally, relative expression of SOD, POD, Pro in OE and WT apple calli were also obtained. OE MdCER1-like calli exhibited much higher values than WT controls for all measurements under drought conditions (Fig.16), but the difference is not significant with WT under normal condition. Therefore, Overexpression of MdCER1-like remarkably increased tolerance to drought stress in apple calli.

Drought stress, as an intricate stresses, can damage cellular structures and accelerate the production of reactive oxygen species (ROS) [14], which ultimately leads to the disorder of metabolic pathways [15]. Studies have shown that the most important biological function of plant epidermal wax is to limit the non-stomata transpiration of wate [16]. In recent years, the mechanisms related to epidermal wax synthesis have been widely reported [17]. The ATP-Binding Cassette (ABC) transcription factor Os ABCG9 plays a key role in the translocation of epidermal wax in rice [18]. FAR1, FAR2 and FAR3 can be induced by drought, cold stress and ABA treatment, and drought stress can significantly increase the accumulation of epidermal wax in Brachyderma risiculosus and participate in the synthesis of primary alcohol from epidermal wax in Brachyderma disiculosus [19]. From the above studies, we can see that wax metabolism and related genes play an irreplaceable role in plant tolerance.

In Arabidopsis thaliana, the CER genes related to wax synthesis have been studied for a long time [20]. CER1 gene is a type of coding enzyme that is indispensable in the process of wax synthesis, especially the synthesis of coding alkanes [21]. In this study, three MdCER1 genes were systematically identified by bioinformatics methods and the MdCER1 protein sequence obtained has high similarity to CER1 protein sequences of other species and contains conserved domains: fatty acid hydroxylase domain and Wax2-C domain. By analyzing the physicochemical properties, the number of amino acids encoded was similar, with an average of 625 aa. The 3 MdCER1 genes were located on 3 out of 17 chromosomes in the apple genome. As predicted, common motifs were shared in the MdCER1 gene family and MdCER1-1 and MdCER1-2 share a common conservative motif, which indicated that they may have common biological functions [22]. Plants often involve complex regulatory mechanisms in response to biotic and abiotic stresses [23]. Reports found that cis-elements play a role in the promoter regions of different stress-related genes, overexpression of these genes may enhance plant tolerance to abiotic stress [24]. Analysis of cis-acting elements found that the expression of MdCER1 gene is related to drought, auxin, salicylic acid, and abscisic acid, and we can see defense and stress-responsive elements were present in the promoter region of MdCER1-like, suggesting that it may be directly regulated by stress-induced transcription factors.

Combining transcriptome and drought stress experiments, MD02G1226900, which was highly expressed under drought stress, was selected and named MdCER1-like. To verify its function in stress, it was cloned from M. domestica and sequence multiple alignments demonstrated that MdCER1-like showed a high degree of sequence identity with other species at the amino acid level. The analysis of the phylogenetic tree showed that MdCER1-like of M. domestica was closely related to Rose Chinensis, which may be due to both of them have the similar evolutionary process and biological functions [25]. In order to clarify the role of MdCER1-like in wax water preservation, the water loss test of transgenic callus was carried out. The results showed that the water loss rate of transgenic calli was significantly lower than that of wild type under normal conditions, and the same results were obtained under drought stress, indicating that CER1-like played an important role in protecting tissue water loss [26], this is consistent with the research conclusion of wax related gene MdCER1 [27]. Real-time fluorescence quantification showed that the expression of MdCER1-like increased gradually with the extension of stress time, and most wax-related genes showed a gradually increasing trend, among which MdYPB5 was the most significant under drought stress, indicating that MdCER1-like played an important role in the wax synthesis [28].

As an important wax fraction, alkanes are widely present in the epidermal waxes of various plant organs and play an important role in drought resistance and other processes. As an important model plant, studies on the functions of alkane-related genes in apple can lay a foundation for revealing the mechanism of alkane synthesis in waxes [29]. GC-MS analysis of wax fraction in this study showed that the contents of fatty acids, alkenes, aldehydes and alcohols in transgenic calli did not increase significantly compared with the WT under drought stress, these wax fractions are all important products in the alkanes anabolic pathway, but the contents of alkanes in the calli increased significantly. These results indicate that this gene plays an important role in alkane metabolism pathway and has been demonstrated in Zea mays L.[30] and Arabidopsis [31]. As a kind of osmotic substance, proline content is an important index to reflect the damage degree of plant membrane lipid peroxidation caused by stress [32]. In this study, a marked increase in the proline content under drought stress, shows that the drought stress increased the degree of cell membrane lipid peroxidation, the plasma membrane is destroyed, and accordingly [33], at the same time of membrane lipid peroxidation, plant itself start enzyme peace-making nonenzymatic two class protection system to reduce or eliminate the damage of active oxygen free radicals [34]. In our study, The SOD and POD enzyme activities of the transgenic calli were significantly lower than those of the corresponding wild-type material under drought stress, indicating that the transgenic material was less able to mobilize the protective system compared with the wild-type material, which may be due to the inhibition of antioxidant enzyme activity by overexpression of MdCER1-like, thus reducing plant tolerance to stress.

These results showed that MdCER1-like was dramatically induced by drought stress. Overexpression of MdCER1-like enhanced tolerance to drought stress in apple calli. Therefore, MdCER1-like plays a positive role in drought stress and wax metabolic, which will provide a reference for further research on waxy anabolism and related genes in the direction of stress resistance.

In this study, the transcriptome was used to screen the wax metabolism-related gene MdCER1-like and verify its function under drought stress. Real-time PCR showed that MdCER1-like was significantly up-regulated under drought stress. In addition, overexpression of MdCER1-like enhanced tolerance to drought stress in apple calli, which demonstrates that MdCER1-like is positively involved in the response to drought stress. which provides a theoretical basis for the cultivation of apple stock with effective response to drought stress.

Ethical Approval and Consent to participate Not applicable.

Human and Animal Ethics Not applicable.

Consent for publication All co-authors gave consent for publication of this manuscript.

Availability of supporting data All datasets analyzed in this study are presented in this article.

Conflict of interest The authors declare that they have no competing interests.

Funding This work was supported by National Natural Science Foundation of China (32160696).

Author contribution YLG. ZXZ. YXW and CJ wrote the main manuscript text and XLX. CLL prepared figures and tables. All authors reviewed the manuscript.

Acknowledgements The authors acknowledge Wu Yuxia, the teacher at the College of Horticulture, Gansu Agricultural University, for providing basic facilities

Authors Information

Yanlong Gao, a student of Gansu Agricultural University, whose main research interests are the effects of shooting shriveling on fruit trees.

Zhongxing Zhang, Jiao Cheng, Xulin xian and Cailong Li are also students of Gansu Agricultural University, and their research interests are in fruit tree science.

Yanxiu Wang, Professor, PhD supervisor, Gansu Agricultural University, whose main research interests are in fruit tree stress physiology.

Xu B, Taylor L, Pucker B, Feng T, Glover BJ, Brockington SF (2020) The land plant-specific MIXTA-MYB lineage is implicated in the early evolution of the plant cuticle and the colonization of land. The New phytologist 229(4):2324-2338.
Yu DM, Ranathunge K, Huang HS, Pei ZY, Franke R, Schreiber L, He CZ (2008) Wax Crystal-Sparse Leaf encodes a beta-ketoacyl CoA synthase involved in biosynthesis of cuticular waxes on rice leaf. Planta 228(4):675-685.
Zhukov AV, Shumskaya M (2020) Very-long-chain fatty acids (VLCFAs) in plant response to stress. Functional plant biology:FPB 47(8):695-703.
Batsale M, Bahammou D, Fouillen L, Mongrand S, Joubès J, Domergue F (2021) Biosynthesis and functions of very-long-chain fatty acids in the responses of plants to abiotic and biotic stresses. Cells 10(6):1284-1284.
Romero P, Lafuente MT (2021) The Combination of abscisic acid (ABA) and water stress regulates the epicuticular wax metabolism and cuticle properties of detached citrus fruit. International Journal of Molecular Sciences 22(19):10242-10242.
Pascal S, Bernard A, Deslous P, Gronnier J, Fournier GA, Domergue F, Rowland O, Joubès J (2019) Arabidopsis CER1-Like1 Functions in a cuticular very-long-chain alkane-forming complex. Plant physiology 179(2):415-432.
Wu HQ, Shi SD, Lu XL, Li TT, Wang JH, Liu TX, Zhang Q, Sun W, Li CL, Wang ZH, Chen YF, Quan L (2019) Expression Analysis and Functional Characterization of CER1 Family Genes Involved in Very-Long-Chain Alkanes Biosynthesis in Brachypodium distachyon. Frontiers in plant science 10:1389.
Ahmad HM, Rahman M, Ahmar S, Fiaz S, Azeem F, Shaheen T, Ijaz M, Anwer BS, Khan SA, Mora-Poblete F (2021) Comparative genomic analysis of MYB transcription factors for cuticular wax biosynthesis and drought stress tolerance in Helianthus annuus L. Saudi Journal of Biological Sciences 28(10):5693-5703.
Liu LB, Bai WP, Li HJ, Tian Y, Yuan HJ, Garant TM, Liu HS, Zhang J, Bao AK, Rowland O, Wang SM (2021) ZxABCG11 from the xerophyte Zygophyllum xanthoxylum enhances drought tolerance in Arabidopsis thaliana through modulating cuticular wax accumulation. Environmental and Experimental Botany 190.
Zhou XY, Matthew A, Jenks, Liu J, Liu AL, Zhang XW, Xiang JH, Zou J, Peng Y, Chen XB (2014) Overexpression of transcription factor OsWR2 regulates wax and cutin biosynthesis in rice and enhances its tolerance to water deficit. Plant Molecular Biology Reporter 32(3):719-731.
Bourdenx B, Bernard A, Domergue, Pascal S, Léger A, Roby D, Pervent M, Vile D, Haslam RP, Napier JA, Lessire R, Joubès J (2011) Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses. Plant physiology 156(1):29-45.
Busta L, Jetter R (2017) Structure and Biosynthesis of Branched Wax Compounds on Wild Type and Wax Biosynthesis Mutants of Arabidopsis thaliana. Plant & cell physiology 58(6):1059-1074.
Zhang R, Zhang ZX, Wang SC, Zhao T, Zhang D, Ma NY, Wang YX (2022) Saline-alkali stress tolerance is enhanced by MhPR1 in Malus halliana leaves as shown by transcriptomic analyses. Planta 256(3):51-51.
Vinocur B, Altman A (2005) Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations. Curr Opin Biotechnol 16(2):123-132.
Parida AK, Das AB (2005) Salt tolerance and salinity effects on plants:a review. Ecotoxicol Environ Saf 60(3):324–349.
Sampangi-Ramaiah MH; Ravishankar KV; Seetharamaiah SK; Roy TK; Hunashikatti L R; Rekha A; Shilpa P (2016) Barrier against water loss: relationship between epicuticular wax composition, gene expression and leaf water retention capacity in banana. Functional plant biology:FPB 43(6):492-501.
Lewandowska M, Keyl A, Feussner I (2020) Wax biosynthesis upon danger: its regulation upon abiotic and biotic stress. The New phytologist 227(3):698-713.
Wei XP, Mao LC, Wei XB, Guan WL, Lu WJ Xu CJ (2021)ABA stimulates wound suberization through antagonizing the MYB4-mediated transcriptional repression of CYP86A1 and FAR in postharvest kiwifruit. Postharvest Biology and Technology 172:111354-.
Sakuradani E, Zhao LF, Haslam TM, Kunst (2013) The CER22 gene required for the synthesis of cuticular wax alkanes in Arabidopsis thaliana is allelic to CER1. Planta 237(3):731-8.
Pascal S,, Bernard A, Deslous P, Gronnier J, Fournier-Goss A, Domergue F, Rowland O, Joubès J (2019) Arabidopsis CER1-LIKE1 Functions in a Cuticular Very-Long-Chain Alkane-Forming Complex. Plant physiology 179(2):415-432.
Tory A, Hendry, Joseph W, Brown, Geordan T (2010) Angiosperm phylogeny inferred from sequences of four mitochondrial genes. Journal of Systematics and Evolution 48(06):391-425.
Chen L, Sun H, Kong J, Xu HJ, Yang XY (2021) Integrated transcriptome and proteome analysis reveals complex regulatory mechanism of cotton in response to salt stress. Journal of Cotton Research 4(1).
Sakuradani E, Zhao LF, Haslam TM; Kunst (2013) The CER22 gene required for the synthesis of cuticular wax alkanes in Arabidopsis thaliana is allelic to CER1. Planta 237(3):731-8.
Kiekens R, Angenon G (2017) The role of the 4-HTHDPS gene family in symbiotic and abiotic stress responses in plants of the Fabaceae family. Journal of Microbial & Biochemical Technology 09(04).
Yang Hongbin; Zou Yunqian; Li Xin; Zhang Mingfei; Zhu Zhifeng; Xu Rangwei; Xu Juan; Deng Xiuxin; Cheng Yunjiang. QTL analysis reveals the effect of CER1-1 and CER1-3 to reduce fruit water loss by increasing cuticular wax alkanes in citrus fruit[J]. Postharvest Biology and Technology, 2022, 185
QI CH. Isolation and functional identification of apple wax related gene MdCER1 [D]. Shandong Agricultural University, 2019.
Wang WJ, Zhang Y, Xu C, Ren JJ, Liu XF, Black, K, Gai XS, Wang Q, Ren HZ (2017) Cucumber ECERIFERUM1(Cs CER1), which influences the cuticle properties and drought tolerance of cucumber, plays a key role in VLC alkanes biosynthesis. Plant Molecular Biology 87(3):219-233.
Lee SB, Suh MC (2015) Advances in the understanding of cuticular waxes in Arabidopsis thaliana and crop species. Plant cell reports 34(4):557-72.
Chai YF, Li A, Chit WS, Song CC, Zhao YY, Duan YQ, Zhang BQ, Lin Q (2020) Cuticular wax composition changes of 10 apple cultivars during postharvest storage. Food Chemistry 324(prepublish):126903.
Luo X, Bai X, Sun X, Zhu D, Liu B, Ji W, Cai H, Cao L, Wu J, Hu M, Liu X, Tang L, Zhu Y, (2013) Expression of wild soybean WRKY20 in Arabidopsis enhances drought tolerance and regulatesABA signalling. Journal of Experimental Botany (8):2155-2169.
Leide J, Hildebrandt U, Reussing K, RIEDERER M, Vogg G (2007) The developmental pattern of tomato fruit wax accumulation and its impact on cuticular transpiration barrier properties:effects of a deficiency in a β-ketoacyl-coenzyme a synthase (Le CER6). Plant Physiol 144:1667-1679.
Gohari G, Panahirad S, Sepehri N, Akbari A, Zahedi SM, Jafari H, Dadpour M R, Fotopoulos V (2021) Enhanced tolerance to salinity stress in grapevine plants through application of carbon quantum dots functionalized by proline. Environmental science and pollution research international 28(31):42877-42890.
Ben Amor N, Megdiche W, Jiménez A, Sevilla F, Abdelly C (2010) The effect of calcium on the antioxidant systems in the halophyte Cakile maritima under salt stress. Acta Physiologiae Plantarum 32(3):453-461.
Jiang D, Lu B, Liu LT, Duan WJ, Meng YJ, Li J, Zhang K, Sun HC, Zhang YJ, Dong HZ, Bai ZY, Li CD (2021) Exogenous melatonin improves the salt tolerance of cotton by removing active oxygen and protecting photosynthetic organs. BMC Plant Biology 21(1):1-19.

No competing interests reported.

Download PDF

Editorial decision: Major revision
07 Nov, 2022
Editor assigned by journal
07 Nov, 2022
Submission checks completed at journal
07 Nov, 2022
First submitted to journal
03 Nov, 2022

You are reading this latest preprint version

Genome-Wide Identification of the CER1 Gene Family in Plants and Stress-Responsive Expression of the MdCER1 Genes

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1