Recombinant Bacillus subtilis expressing a fungal phytase as a probiotic additive in the diet of Pacific white shrimp Litopenaeus vannamei

doi:10.21203/rs.3.rs-2234500/v1

Download PDF

Research Article

Recombinant Bacillus subtilis expressing a fungal phytase as a probiotic additive in the diet of Pacific white shrimp Litopenaeus vannamei

https://doi.org/10.21203/rs.3.rs-2234500/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Phosphorus is an essential mineral present in the vegetable matter in the form of phytate, which is considered an antinutritional factor. Phytate can be degraded by phytases, which have been used in commercial feeds. However, these enzymes undergo costly isolation and purification processes. In the present study, a genetically modified (GM) Bacillus subtilis strain that expresses a fungal phytase was used as a feed additive. The GM probiotic was added to the commercial feed of shrimp Litopenaeus vannamei and its effects on zootechnical performance, proximate composition of muscle, lipid concentration in hepatopancreas and expression of genes related to digestion, amino acid metabolism and antioxidant defenses were analyzed. Although the genetically modified probiotic had no impact on growth parameters, there was a 39% increase in phosphorus content in muscle. In addition, genes related to digestion were downregulated in shrimp hepatopancreas, as well as an increase in lipids in this tissue. These results demonstrates that the GM probiotic increased the efficiency of the use of plant-derived phosphorus, which may imply a decrease in the addition of this element in the diets, as well as minimizing the impact of shrimp farms on the eutrophication of adjacent ecosystems.

Phosphorous

genetically modified probiotic

feed additive

shrimp farming

The growth of the aquaculture industry has generated a significant increase in the demand for fish meal and oil, essential components in the production of animal feed. In 2018, around 12% of world fish production was used to produce these inputs and this growing demand has generated price increases and greater pressure on fish stocks (FAO 2020). In a scenario where extractive fishing is experiencing stagnant growth, alternative sources of protein need to be established to sustain the demand arising from the growth of aquaculture, whether of animal or vegetable origin. In the case of vegetable proteins, there is an additional challenge due to the presence of anti-nutritional compounds that prevent their use at higher concentrations (Hardy 2010; Montoya-Camacho et al. 2019). Even so, vegetables such as rapeseed, lupine and even fermented cotton have been used to replace fish meal in fish and shrimp diets (Kaiser et al. 2021; Sun et al., 2016; Weiss et al. 2020).

Among the antinutritional compounds present in plant matter, phytic acid (or phytate) is one of the most limiting and represents the largest form of phosphorus storage in plants (Dersjant-Li et al. 2015). Its antinutritional characteristic comes from the electronegativity of phosphorus, which allows it to chelate and decrease the availability of minerals such as calcium, magnesium, zinc, manganese, iron and copper (Hardy 2010; Bharadwaj et al. 2014; Humer and Zebeli, 2015). Phytate can also interact with proteins, carbohydrates and lipids, forming complexes that reduce the digestibility of these biomolecules with a consequent decrease in nutrient absorption by the gastrointestinal tract of fish or non-ruminant animals (Kumar et al. 2012; Dersjant-Li et al. 2015). The formation of these complexes also makes the phosphorus present in plant matter unavailable to most monogastric animals, since these animals do not produce or produce few enzymes capable of hydrolyzing phytate during the digestive process (Kumar et al. 2012; Dersjant-Li et al. 2015). Thus, most of the plant phosphorus is excreted and ends up eutrophicating the environment which, in the case of the aquatic environment, causes the proliferation of microalgae with damaging effects to adjacent ecosystems (Kumar et al. 2012; Hung et al. 2015).

Phytate removal or degradation increases the bioavailability of many cations, and consequently, improve the nutritional value of the feed. Phytase is a phytate-specific phosphatase that catalyzes the hydrolysis of phytic acid generating inositol and phosphates (Bhavsar and Khire 2014; Lemos and Tacon 2017). The objective of phytase supplementation in diets is to hydrolyze dietary phytate into absorbable phosphorus forms. This information has been well documented in several studies with fish and shrimp, showing that the use of phytase in the diet improves growth, efficiency in absorption of nitrogen and phosphorus, macronutrient digestibility, and amino acid bioavailability (Biswas et al. 2007; Green et al. 2021; Maas et al. 2021; Qiu and Davis 2017; Rachmawati and Samidjan 2016; Shahzad et al. 2021).

Among the commercially available phytases, those belonging to the class of histidine acid phosphatases and produced by the filamentous fungus Aspergillus fumigatus are characterized for their high thermostability and activity over a wide pH range (Singh and Satyanarayana 2015; Rebello et al. 2017). Additionally, bacterial phytases produced by Bacillus species can be considered interesting alternatives to fungal phytases not only for their thermostability, but also for their resistance to protease action and greater phytate specificity (Kim et al. 2004). Cheng et al. (2012) expressed B. subtilis phytase C in Escherichia coli and used the purified recombinant enzyme as an additive in L. vannamei feed. The addition of the recombinant enzyme to a diet high in soybean meal (40%) for shrimp increased growth and feed efficiency. However, feed additives with commercial phytases have their cost significantly increased, as these enzymes need to go through costly isolation and purification processes (Dudley et al. 2014).

An interesting alternative to reduce the cost of phytase additives in commercial feeds is to use genetic engineering techniques to transform a probiotic bacterium into a biofactory of heterologous enzymes. In this scenario, the genetically modified probiotic can be added to the feed, and the secreted heterologous phytase can degrade the phytate present in plant matter, increasing the digestibility of the feed. Recently, Santos et al. (2020) evaluated the effect of adding a genetically modified strain of B. subtilis capable of secreting a fungal phytase in zebrafish (Danio rerio) feed. The authors used a feed rich in soybean meal and observed that the addition of the genetically modified probiotic improved the fish condition factor, as well as stimulating the immune system, decreasing inflammatory responses and oxidative stress in gastrointestinal tract. In the present study, the genetically modified strain of B. subtilis developed by Santos et al. (2020) was used as an additive in the feed of shrimp L. vannamei, evaluating the zootechnical performance, proximate composition of muscle, lipid vacuoles counting in hepatopancreas, and expression of genes related to digestion, amino acid metabolism and antioxidant defenses.

Ethics statement

According to Brazilian Federal Law No. 11,794/08, there is no need for permission from the Ethics Committees in Animal Experimentation to carry out experiments involving invertebrate animals. In any case, the experiments carried out here followed the main guidelines of the Declaration of Helsinki.

Preparation of feed supplemented with probiotic bacteria

The strains of B. subtilis used in this study are the same ones used by Santos et al. (2020). The KM0 strain of B. subtilis was used as a control, which is derived from the B. subtilis 168 strain and had its genome modified to generate a super-competent strain for genetic manipulation (Rahmer et al. 2015). The KM0-Phy strain was manipulated by Santos et al. (2020) to express and secrete A. fumigatus phytase. Inoculums of the probiotic strains were first cultivated for 16 h at 37 ºC in volumes of 3 mL in minimal salts medium (Anagnostopoulos and Spizizen, 1960), in a shaker incubator at 250 rpm. The next day, the cultures were added to erlenmayers (125 ml) containing 50 ml of the culture medium suggested by Riet et al. (2021), which consists of a minimal salts medium with glucose and casein hydrolyzate. The cultures followed the same protocol used for culture of inocula, but the concentration of bacteria was monitored in a spectrophotometer until reaching the stationary phase (OD₆₀₀ = 1.6). According to Santos et al. (2020), the genetic construct used to express fungal phytase has maximum yield in the stationary phase of bacterial growth. Then, cultures were centrifuged at 5,000 × g for 10 min at 4 ºC. After centrifugation, the supernatant was discarded and 2 mL of saline solution (0.9%) NaCl was added to wash the pellet, and this process was repeated twice (adapted from Zokaeifar et al. 2012). Then, the pellet was diluted in saline solution so that each gram of feed received 10¹⁰ colony-forming units (CFU) of the probiotic strains (Riet et al. 2021). The commercial feed used (Guabi, Brazil) is free of probiotics and contains 35% crude protein, 9% lipids, 15% ash and 1.5% total phosphorous.

Experimental design

Nauplii of L. vannamei were purchased from Aquatec (Rio Grande do Norte, Brazil). After hatchery and nursery were carried out at the Marine Station of Aquaculture, from Federal University of Rio Grande (FURG, Brazil). Experiment was carried out in Marine Shrimp Laboratory where 0.6 ± 0.1 g shrimp were acclimated for one week in 150 L tanks with clear water. Throughout the experiment, salinity was maintained at 30 g/L, temperature at 29°C, and dissolved oxygen close to saturation (6.0 ± 0.5 mg/L). Every day, 30% of the water was changed in order to keep ammonia, nitrites and nitrates within tolerance levels for the species. Three treatments, with four replications each, were used, in a total of 12 tanks. Each tank received 40 shrimps, totaling 480 individuals (stocking density of 266 shrimp/m³). In the control treatment (CON), the shrimps received only commercial feed moistened with saline solution (NaCl 0.9%). In the second treatment (KM0), the shrimps received commercial feed added with B. subtilis KM0. In the third treatment (KM0-Phy), the shrimps received commercial feed supplemented with genetically modified B. subtilis expressing fungal phytase. The diets were administered twice a day (early in the morning and early in the afternoon) for 45 days, at a rate of 10% of estimated biomass at the beginning and reduced to 5% at the end of the experiment.

Tissue collection

The experimental period lasted 45 days. At the end of this period, shrimps from each treatment were randomly separated for analysis of proximate composition of muscle tissue (five individuals per treatment, immediately frozen at -20°C) and gene expression (seven individuals per treatment). For gene expression analysis, hepatopancreas and muscle tissue were individually dissected and placed in 500 µL of Trizol Reagent (Invitrogen, Brazil), according to the manufacturer's protocol. Whole shrimps were also separated for histological analysis.

Zootechnical performance

To calculate weight gain, biomass gain, feed conversion ratio and survival, the following formulas were used:

- Weight gain (g) = Pf - Pi, where Pf = final weight and Pi = initial weight;
- Biomass gain = (Average Pf x number of individuals at the end) - (Average Pi x initial number of individuals);
- Feed conversion rate = feed consumption / biomass gain;
- Survival (%) = (final shrimp population × 100) / initial population.

Proximate composition

Proximate composition analysis was performed from shrimp muscle (n = 5). To assess tissue moisture, the samples were dried in an oven at 100 ^oC until constant weight. Protein levels were obtained using the Kjeldahl method and the total ether extract using the Soxhlet method, following the instructions of AOAC (2000). Ashes were quantified by muffle incineration for 6 h at 600 ^oC. To determine the phosphorus content, the method proposed by Silva and Queiroz (2002) was used, expressed in mg/100 g of fresh sample.

Gene expression analyses

Gene expression analyses were performed using quantitative PCR (qPCR), according to Livak and Schmittgen (2001). First, total RNA was extracted from tissues using Trizol reagent (Invitrogen, Brazil), as per manufacturer's instructions. The RNA obtained was treated with DNAse I, quantified spectrophotometrically, and the RNA quality was verified in 1% agarose gel electrophoresis. RNA was reverse transcribed into complementary DNA (cDNA) using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Brazil), as per the manufacturer's instructions. For each tissue a different set of genes was analyzed. In the hepatopancreas, genes related to digestion (amylase, amy; lipase, lip; trypsin, tryp; cathepsin B, cathB; chymotrypsin, chymo) and amino acid metabolism (glutamine synthetase, gs; glutamate dehydrogenase, gdh) were analyzed. In muscle, two genes related to the antioxidant defense system (glutathione peroxidase, gpx; superoxide dismutase, sod) were analyzed. The primers used in the qPCR reactions are shown in Table 1. Previously, all primers had their efficiencies calculated from serial dilutions. For all analyses, a 1:10 cDNA dilution was used. All reactions were performed on the 7300 Real-time PCR System platform (Applied Biosystems, Brazil), with the PowerUP SYBR Green Master Mix kit (Applied Biosystems, Brazil). Reactions were performed with the following schedule: 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 15 s. The reference gene ef1a was used to normalize results of gene expression data in all tissues analyzed. In addition, 60S-121 and rps3A genes were used to normalize expression data in hepatopancreas and muscle, respectively. To determine the stability of the reference genes, the geNorm VBA applet software for Microsoft Excel (Vandesompele et al. 2002) was used.

Table 1

Genes and primer sequences used in qPCR reactions.
Gene	Sense (5’-3’)	Antisense (5’-3’)	Amplicon (nt)	GenBank
amy	ctctggtagtgctgttggct	tgtcttacgtgggactggaag	116	AJ133526
lip	actgtctcctctgctcgtc	atggtttctggaataggtgttt	131	XM027365317
tryp	cggagagctgccttaccag	tcggggttgttcatgtcctc	141	X86369
chymo	ggctctcttcatcgacg	cgtgagtgaagaagtcgg	182	XM037943862
cathB	ggatgtaacggaggcttc	ctgtatgctttgcctcca	248	XM027359505
gdh	aggttgtggaggaccagttg	ccgtggatcatctcgtaggt	166	EU496492
gs	ttccgtctcctgaaataccg	aggagccttgggaatgaagt	193	JN620540
gpx	agggacttccaccagatg	caacaactccccttcggta	117	AY973252
sod	tggagtgaaaggctctggct	acggaggttcttgtactgaaggt	175	DQ005531
rps3A	ggcttgctatggtgtgctcc	tcatgctcttggctcgctg	101	XM027376915
60S-l21	gttgacttgaagggcaatg	cttcttggcttcgattctg	246	XM027359925
ef1a	ccaccctggccagattca	gcgaacttgcaggcaatg	75	DQ858921

Histological analysis

Whole shrimps were prepared for histological analysis by injection into tissues and complete submersion in Davidson's solution (11.5% acetic acid, 22% formalin, 33% ethanol) for 48 hours. Afterwards, the shrimp were removed from the fixative solution and had the hepatopancreas dissected. The tissue obtained was first placed in 70% ethanol and subjected to successive dehydration in increasing concentrations of ethanol. After this process, the hepatopancreas was clarified in xylene, embedded in Paraplast at 60 ^oC and sectioned with a thickness of 3 µm. After staining with Hematoxylin and Eosin (Bell and Lightner 1988), lipid storage cells were counted under a compound microscope at 40x magnification. Lipid vacuoles were counted from 10 random visual fields from each hepatopancreas sample. Samples from four individuals from each treatment were analyzed.

Statistical analysis

To test for possible differences among treatments, one-way analysis of variance (ANOVA) was used. Normality and heterogeneity were assessed using the Shapiro-Wilk and Levene tests, respectively. For each case, when significance was detected among treatments, a subsequent comparison of means was performed using the Tukey test. All numerical data were expressed as mean ± standard error. The other data were expressed as mean ± standard deviation. Differences were considered statistically significant when p < 0.05.

Zootechnical performance

No significant differences were observed between treatments for any of the analyzed parameters. The results are shown in Table 2.

Table 2

Zootechnical performance of *L. vannamei* fed on commercial feed (CON), commercial feed supplemented with KM0 or KM0-Phy strains of *B. subtilis*.
	Treatments
	CON	KM0	KM0-Phy
Initial weight (g)	0.61 ± 0.06	0.62 ± 0.05	0.66 ± 0.06
Final weight (g)	5.44 ± 0.49	5.09 ± 0.45	5.63 ± 0.43
Weight gain (g)	4.84 ± 0.49	4.47 ± 0.42	4.98 ± 0.43
Feed conversion ratio	1.36 ± 0.13	1.46 ± 0.15	1.31 ± 0.11
Survival (%)	100	100	100

Proximate composition of muscle tissue

Among the parameters analyzed for proximate composition of L. vannamei muscle, there was a significant decrease in the percentage of ash of shrimp that received commercial feed supplemented with probiotic strains (KM0 or KM0-Phy). Also, the phosphorus retention in shrimp muscle was higher in KM0-Phy than the control treatment (CON). No changes were detected in the other analyzed parameters. The results are shown in Table 3.

Table 3

Proximate composition (%) of *L. vannamei* muscle fed commercial feed (CON), commercial feed supplemented with KM0 or KM0-Phy strains of *B. subtilis*.
	Treatments
	CON	KM0	KM0-Phy
Moisture (%)	74.56 ± 0.63	73.97 ± 0.22	73.91 ± 0.81
Ash (%)	1.63 ± 0.27^a	1.53 ± 0.23^b	1.45 ± 0.27^b
Protein (%)	18.97 ± 1.74	19.26 ± 0.44	19.28 ± 0.08
Lipid (%)	0.75 ± 0.65	0.47 ± 0.43	0.68 ± 0.55
Phosphorus (mg/100 mg)	79.24 ± 9.03^a	98.92 ± 1.41^a,b	110.02 ± 14.13^b
Different letters represent statistically significant differences (p < 0.05).

Expression of genes related to digestion

Of five genes analyzed related to digestion (Fig. 1), only cathB and amy were not significantly altered in shrimp fed with feed supplemented with both KM0 and KM0-Phy strains. The other genes (chymo, tryp and lip) were significatively downregulated by both probiotic treatments, when compared to control group.

Expression of genes related to amino acid metabolism

Regarding genes related to amino acid metabolism (gdh and gs; Fig. 2), only gdh was downregulated in shrimp fed with feed supplemented with KM0 strain. The gs gene was not altered in any treatment.

Expression of genes related to antioxidant defense system

Genes related to antioxidant defense system (gpx and sod; Fig. 3) were not altered in any treatment.

Histological analysis

Figure 4 shows the result of lipid vacuoles counts in shrimp hepatopancreas. Shrimp fed with diet supplemented with B. subtilis KM0-Phy had a higher number of lipid vacuoles (34.47 ± 1.39) compared to the control treatment (29.28 ± 1.13). The counting of lipid vacuoles from shrimp feed with diet supplemented with B. subtilis KM0 (31.55 ± 0.74) was not statistically different from the other two treatments.

Phosphorus is a key element in the constitution of fundamental molecules for living beings, such as nucleic acids and phospholipids in cell membranes. Furthermore, it is involved in production of energy molecules such as adenosine triphosphate (ATP), which are essential for the entire cell metabolism. Taking these characteristics into account, phosphorus is a limiting mineral for the growth of all living beings. However, each organism has specific requirements regarding phosphorus levels. While phosphorus deficiency can cause serious metabolic problems related to growth, its excess can be excreted and eutrophicate the adjacent water bodies with negative consequences from an environmental point of view. It is known that only approximately 40% of the phosphorus available in feed is absorbed by farmed aquatic organisms, while the surplus is secreted and released into the water (Sugiura 2018). Thus, the rational use of phosphorus is a balance point between animal production and environmental protection.

Due to the low concentration of phosphorus in natural waters, aquatic organisms need to obtain this essential element from food (Coloso et al. 2001). In the case of cultured aquatic organisms, phosphorus must be present in the feed in its bioavailable form. However, this mineral is among the most expensive feed supplements used in aquaculture (Fox et al. 2006), and the phosphorus present in plant matter is not bioavailable to monogastric animals because it is in the form of phytate, which is considered an antinutritional factor. The addition of phytases can alleviate the problem, as these enzymes degrade phytate and release inorganic phosphorus for assimilation by the body. However, the addition of phytase to the feed represents a significant addition to its final cost. In the present study, the hypothesis that the addition of a probiotic strain of B. subtilis capable of secreting a fungal phytase (KM0-Phy) in L. vannamei feed could degrade the phytate present in plant matter and increase the bioavailability of phosphorus for the shrimp. Additionally, the impact of KM0-Phy strain on growth, survival, proximate muscle composition, lipid vacuoles in hepatopancreas and expression of genes related to digestion, amino acid metabolism and antioxidant defenses were evaluated.

After 45 days of experimentation, it was observed that the addition of the strain KM0-Phy to the shrimp diet did not change any parameters of growth or survival. The lack of growth induction observed here can be explained by the fact that probiotics may have a greater impact on the early stages of shrimp development, as suggested by Toledo et al. (2019). On the other hand, chemical composition analysis showed a significant increase of 39% in phosphorus content of muscle tissue of shrimp that had the probiotic KM0-Phy added to the feed, even if the feed used is already supplemented with 1.5% phosphorus. Interestingly, shrimp fed diet with KM0 strain also had an increase in muscle phosphorus at an intermediate level between CON and KM0-Phy groups. It is known that Bacillus species can produce Ca²⁺-dependent beta-propeller type phytases, which have high thermal stability, optimal catalytic activity at neutral pH and high specificity for the calcium-phytate complex (Fu et al. 2008). Thus, it would be expected that the presence of B. subtilis in the feed could have some effect on the bioavailability of phosphorus for shrimp. However, genetic manipulation for expression and secretion of a fungal phytase performed in KM0-Phy strain significantly enhanced this characteristic.

The increase observed in the phosphorus concentration in muscle tissue of shrimp fed diet with B. subtilis KM0-Phy additive suggests that the phytate was degraded by fungal phytase secreted by the genetically modified probiotic. Thus, it is reasonable to expect that the decrease in phytate could make more nutrients available and modulate expression of genes related to digestion in shrimp hepatopancreas. Quantification of digestion-related gene expression demonstrated a significant downregulation of proteases (chymo and tryp) and lipase (lip) transcription in both KM0 and KM0-Phy treatments. It is known that Bacillus species are capable of producing and secreting proteases and lipases. Priest (1977) already described numerous digestive exoenzymes produced by Bacillus species, especially carbohydrates, proteases and lipases. Some Bacillus proteases stand out for their high stability under adverse environmental conditions such as temperature and pH extremes, presence of organic solvents, detergents, and oxidizing agents (Contesini et al. 2018). Also, according to Eggert et al. (2003), B. subtilis can produce and secrete two types of lipases (lipA and lipB) from genes that are differentially expressed according to growth conditions. In addition, the counting of lipid vacuoles in the hepatopancreas showed that B. subtilis KM0-Phy used in the present study increased the concentration of lipids in that tissue in comparison to control group. The addition of phytases to the fish diet has been linked to an increase in lipids in the body (reviewed by Zheng et al. 2020). However, this relationship has not, to our knowledge, been established in crustaceans. Thus, the presence of a probiotic bacterium in the intestine capable of producing and secreting digestive enzymes decreases the need for the host to produce and secrete its own enzymes. This directly reflects on the regulation of genes as a way of saving the energy that is invested in the processes of absorption of nutrients from food. In fact, it has often been reported that dietary probiotic supplementation increases the activity of digestive enzymes in shrimp intestine. Recently, Wang et al. (2020) showed that probiotics such as B. subtilis and B. licheniformis can induce the activity of digestive enzymes in the gastrointestinal tract of tiger shrimp Penaeus monodon. Also, Zokaeifar et al. (2012) showed that the addition of B. subtilis strains to L. vannamei feed significantly increased digestive enzyme activity in shrimp. These studies, which only analyze the activity of digestive enzymes in the gastrointestinal tract, cannot differentiate between the action of shrimp enzymes and those secreted by probiotics.

In the present study, genes related to amino acid metabolism (gdh and gs) were also analyzed. The only difference observed was a downregulation of gdh in the group of shrimps treated with the KM0 strain. Apparently, genetic manipulation in the KM0 strain to express a fungal phytase increased the transcription of gdh to the same levels observed for the control group. The gdh gene encodes the enzyme glutamate dehydrogenase, which catalyzes the oxidative deamination of glutamate to form α-ketoglutarate in the mitochondrial matrix. This chemical reaction results in the production of a Krebs cycle intermediary and can accelerate ATP production by oxidative phosphorylation in the electron transport chain (Dawson and Storey, 2012). It is possible that the greater availability of phosphorus in the shrimp treated with the KM0-Phy strain is favoring a higher glutamate dehydrogenase expression compared to the shrimp treated with the KM0 strain. In the case of genes related to oxidative stress (gpx and sod) analyzed in muscle tissue, no difference was observed among treatments. This result shows that the increase in phosphorus availability did not imply a change in the shrimp muscle's oxidative status.

In conclusion, the use of a genetically modified strain of B. subtilis expressing a fungal phytase was able to increase the availability of phosphorus for shrimp. Although the increased availability of this mineral was not reflected in growth, it was possible to observe a downregulation in expression of genes related to digestion. Also, it is possible that the action of the phytase produced by the probiotic enables a decrease in phosphorus additives in the feed, with an impact on its cost. In addition, the greater efficiency in the use of phosphorus present in the feed will certainly imply a decrease in the excretion of this element by shrimp, with a consequent reduction in the impact of shrimp farms on adjacent ecosystems.

Acknowledgements

We thank all team members of the Laboratory of Molecular Biology (Institute of Biological Sciences, Federal University of Rio Grande - FURG, Brazil) and all team members of the Marine Shrimp Project (Marine Aquaculture Station, Federal University of Rio Grande - FURG, Brazil) who helped during all stages of the experiment.

Authors’ contribution

L.M., W.W. Jr. and L.F.M. conceived the original idea. L.M., B.F.N., R.A., A.C. V.T.R., M.B.T., V.F.P. and L.A.R. carried out the experiments. L.M., B.F.N., R.A., W.W.Jr. and L.F.M. analyzed the data. L.M. and L.F.M. wrote the manuscript. All authors discussed the results and contributed to the final manuscript.

Funding

This study was funded by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, Proc. 434259/2018-7) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Financial Code 001). L. F. Marins, M. B. Tesser, L. A. Romano and W. Wasielesky Jr. are research fellows CNPq (Proc. No. 309634/2018-0, 304474/2020-7, 301245/2016-9 and 310652/2017-0, respectively).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author (L.F.M.) upon reasonable request.

Conflict of interest

The authors declare no conflict of interests.

Anagnostopoulos C, Spizizen J (1960) Requirements for transformation in Bacillus subtilis. J Bacteriol 81:741–746. https://doi.org/10.1128/JB.81.5.741-746.1961
AOAC (2000) Official Methods of Analysis, 17th edn. AOAC (CDROM), Washington, DC
Bell TA, Lightner DV (1988) A handbook of normal penaeid shrimp histology. World Aquaculture Society, Baton Rouge, LA
Bharadwaj AS, Patnaik S, Browdy CL, Lawrence AL (2014) Comparative evaluation of an inorganic and a commercial chelated copper source in Pacific white shrimp Litopenaeus vannamei (Boone) fed diets containing phytic acid. Aquaculture 422–423:63–68. https://doi.org/10.1016/j.aquaculture.2013.11.025
Bhavsar K, Khire JM (2014) Current research and future perspectives of phytase bioprocessing. RSC Adv 4:26677–26691. https://doi.org/10.1039/c4ra03445g
Biswas P, Pal AK, Sahu NP, Reddy AK, Prusty AK, Misra S (2007) Lysine and/or phytase supplementation in the diet of Penaeus monodon (Fabricius) juveniles: Effect on growth, body composition and lipid profile. Aquaculture 265:253–260. https://doi.org/10.1016/j.aquaculture.2006.10.037
Cheng W, Chiu CS, Guu YK, Tsai ST, Liu CH (2012) Expression of recombinant phytase of Bacillus subtilis E20 in Escherichia coli HMS 174 and improving the growth performance of white shrimp, Litopenaeus vannamei, juveniles by using phytase-pretreated soybean meal-containing diet. Aquac Nutr 19:117–127. https://doi.org/10.1111/j.1365-2095.2012.00946.x
Coloso RM, Basantes SP, King K, Hendrix MA, Fletcher JW, Weis P, Ferraris RP (2001) Effect of dietary phosphorus and vitamin D on 3 phosphorus levels in effluent from the experimental culture of rainbow trout Oncorhynchus mykiss. Aquaculture 202:145–161. https://doi.org/10.1016/S0044-8486(01)00572-5
Contesini FJ, Melo RR, Sato HH (2018) An overview of Bacillus proteases: from production to application. Crit Rev Biotechnol 38(3):321–334. https://doi.org/10.1080/07388551.2017.1354354
Dawson NJ, Storey KB (2012) An enzymatic bridge between carbohydrate and amino acid metabolism: Regulation of glutamate dehydrogenase by reversible phosphorylation in a severe hypoxia-tolerant crayfish. J Comp Physiol B: Biochem Syst and Environ Physiol 182(3):331–340. https://doi.org/10.1007/s00360-011-0629-4
Dersjant-Li Y, Awati A, Schulze H, Partridge G (2015) Phytase in non-ruminant animal nutrition: A critical review on phytase activities in the gastrointestinal tract and influencing factors. J Sci Food Agric 95:878–896. https://doi.org/10.1002/jsfa.6998
Dudley QM, Karim AS, Jewet MC (2014) Cell-free metabolic engineering: Biomanufacturing beyond the cell. Biotechnol J 10:69–82. https://doi.org/10.1002/biot.201400330
Eggert T, Brockmeier U, Dröge MJ, Quax WJ, Jaeger KE (2003) Extracellular lipases from Bacillus subtilis: regulation of gene expression and enzyme activity by amino acid supply and external pH. FEMS Microbiol Lett 225(2):319–324. https://doi.org/10.1016/S0378-1097(03)00536-6
FAO (2020) The State of World Fisheries and Aquaculture 2020. Sustainability in action. Rome. https://doi.org/10.4060/ca9229en
Fox JM, Davis DD, Wilson M, Lawrence AL(2006) Current status of amino acid requirement research with marine penaeid shrimp. In LE Cruz Suárez, D Ricque Marie, M Tapia Salazar, MG Nieto López, DA Villarreal Cavazos, AC Puello Cruz and A García Ortega (Eds.). Avances em nutrición acuícola. Universidad Autónoma de Nuevo León, México. https://www.uanl.mx/utilerias/nutricion_acuicola/VIII/archivos/13Fox.pdf
Fu S, Sun J, Qian L, Li Z (2008) Bacillus phytases: present scenario and future perspectives. Appl Biochem Biotechnol 151:1–8. https://doi.org/10.1007/s12010-008-8158-7
Green BW, Rawles SD, Schrader KK, McEntire ME, Abernathy J, Ray CL, Gaylord TG, Lange MD, Webster CD (2021) Impact of dietary phytase on tilapia performance and biofloc water quality. Aquaculture 541:736845. https://doi.org/10.1016/j.aquaculture.2021.736845
Hardy RW (2010) Utilization of plant proteins in fish diets: Effects of global demand and supplies of fishmeal. Aquac Res 41:770–776. https://doi.org/10.1111/j.1365-2109.2009.02349.x
Humer E, Zebeli Q (2015) Phytate in feed ingredients and potentials for improving the utilization of phosphorus in ruminant nutrition. Anim Feed Sci Technol 209:1–15. https://doi.org/10.1016/j.anifeedsci.2015.07.028
Hung LT, Thanh NT, Pham MA, Browdy CL (2015) A comparison of the effect of dietary fungal phytase and dicalcium phosphate supplementation on growth performances, feed and phosphorus utilization of tra catfish juveniles (Pangasianodon hypophthalmus Sauvage, 1878). Aquac Nutr 21:10–17. https://doi.org/10.1111/anu.12134
Kaiser F, Harloff H, Tressel R, Kock T, Schulz C (2021) Effects of highly purified rapeseed protein isolate as fishmeal alternative on nutrient digestibility and growth performance in diets fed to rainbow trout (Oncorhynchus mykiss). Aquac Nutr 27(5):1352–1362. https://doi.org/10.1111/anu.13273
Kim Y-O, Kim H-K, Bae K-S, Yu J-H, Oh T-K (1998) Purification and properties of a thermostable phytase from Bacillus sp. DSll Enzyme Microb Technol 22(1):2–7. https://doi.org/10.1016/S0141-0229(97)00096-3
Kumar V, Sinha AK, Makkar HPS, de Boeck G, Becker K (2012) Phytate and phytase in fish nutrition. J Anim Physiol Anim Nutr 96:335–364. https://doi.org/10.1111/j.1439-0396.2011.01169.x
Lemos D, Tacon AGJ (2017) Use of phytases in fish and shrimp feeds: a review. Rev Aquac 9:266–282. https://doi.org/10.1111/raq.12138
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the double delta CT method. Methods 25(4):402–408. https://doi.org/10.1006/meth.2001.1262
Maas RM, Verdegem MCJ, Debnath S, Marchal L, Schrama JW (2021) Effect of enzymes (phytase and xylanase), probiotics (B. amyloliquefaciens) and their combination on growth performance and nutrient utilisation in Nile tilapia. Aquaculture 533:736226. https://doi.org/10.1016/j.aquaculture.2020.736226
Montoya-Camacho N, Marquez-Ríos E, Castillo-Yáñez FJ, Cárdenas López JL, López-Elías JA, Ruíz-Cruz S, Jiménez-Ruíz EI, Rivas-Vega ME, Ocaño-Higuera VM (2019) Advances in the use of alternative protein sources for tilapia feeding. Rev Aquac 11:515–526. https://doi.org/10.1111/raq.12243
Oh BC, Choi WC, Park S, Kim YO, Oh TK (2004) Biochemical properties and substrate specificities of alkaline and histidine acid phytases. Appl Microbiol Biotechnol 63:362–372. https://doi.org/10.1007/s00253-003-1345-0
Priest FG (1977) Extracellular enzyme synthesis in the genus Bacillus. Bacteriol Rev 41(3):711–753. . doi:10.1128/br.41.3.711-753.1977
Qiu X, Davis DA (2017) Effects of dietary phytase supplementation on growth performance and apparent digestibility coefficients of Pacific white shrimp Litopenaeus vannamei. Aquac Nutr 23:942–951. https://doi.org/10.1111/anu.12462
Rachmawati D, Samidjan I (2016) Effect of phytase enzyme on growth boost in the artificial feed made of plant protein to shorten production time of giant tiger prawn [Penaeus monodon, (Fabricus 1798)]. Aquat Procedia 7:46–53. https://doi.org/10.1016/j.aqpro.2016.07.006
Rahmer R, Heravi KM, Altenbuchner J (2015) Construction of a super-competent Bacillus subtilis 168 using the PmtlA-comKS inducible cassette. Front Microbiol 6:1431. https://doi.org/10.3389/fmicb.2015.01431
Rebello S, Jose L, Sindhu R, Aneesh EM (2017) Molecular advancements in the development of thermostable phytases. Appl Microbiol Biotechnol 101:2677–2689. https://doi.org/10.1007/s00253-017-8195-7
Riet J, Costa-Filho J, Dall’Agno L, Medeiros L, Azevedo R, Nogueira LF, Maggioni R, Pedrosa VF, Romano LA, Altenbuchner J, Wasielesky W Jr, Marins LF (2021) Bacillus subtilis expressing double-strand RNAs (dsRNAs) induces RNA interference mechanism (RNAi) and increases survival of WSSV-challenged Litopenaeus vannamei. Aquaculture 541:736834. https://doi.org/10.1016/J.AQUACULTURE.2021.736834
Santos KO, Costa-Filho J, Spagnol KL, Nornberg BF, Lopes FM, Tesser MB, Marins LF (2020) The inclusion of a transgenic probiotic expressing recombinant phytase in a diet with a high content of vegetable matter markedly improves growth performance and the expression of growth-related genes and other selected genes in zebrafish. Aquaculture 519:734878. https://doi.org/10.1016/j.aquaculture.2019.734878
Shahzad MM, Bashir S, Hussain SM, Javid A, Hussain M, Ahmed N, Khan MKA, Furqan M, Liaqat I, Rafique T, Khalid F (2021) Effectiveness of phytase pre-treatment on growth performance, nutrient digestibility and mineral status of common carp (Cyprinus carpio) juveniles fed Moringa by-product based diet. Saudi J Biol Sci 28:1944–1953. https://doi.org/10.1016/j.sjbs.2020.12.046
Silva JD, Queiroz AC (2002) Análise de alimentos: métodos químicos e biológicos, 3– edn. UFV, ed. MG, p 235
Singh B, Satyanarayana T (2015) Fungal phytases: Characteristics and amelioration of nutritional quality and growth of non-ruminants. J Anim Physiol Anim Nutr 99:646–660. https://doi.org/10.1111/jpn.12236
Sugiura SH (2018) Phosphorus, aquaculture, and the environment. Rev Fish Sci Aquac 26:515–521. https://doi.org/10.1080/23308249.2018.1471040
Sun H, Tang JW, Yao XH, Wu YF, Wang X, Liu Y (2016) Effects of replacement of fish meal with fermented cottonseed meal on growth performance, body composition and haemolymph indexes of Pacific white shrimp, Litopenaeus vannamei Boone, 1931. Aquac Res 47:2623–2632. https://doi.org/10.1111/are.12711
Toledo A, Frizzo L, Signorini M, Bossier P, Arena A (2019) Impact of probiotics on growth performance and shrimp survival: A meta-analysis. Aquaculture 500:196–205. https://doi.org/10.1016/j.aquaculture.2018.10.018
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3(7):research0034. https://doi.org/10.1186/gb-2002-3-7-research0034
Wang Y, Al Farraj DA, Vijayaraghavan P, Hatamleh AA, Biji GD, Rady AM (2020) Host associated mixed probiotic bacteria induced digestive enzymes in the gut of tiger shrimp Penaeus monodon. Saudi J Biol Sci 27(9):2479–2484. https://doi.org/10.1016/j.sjbs.2020.07.010
Weiss M, Rebelein A, Slater MJ (2020) Lupin kernel meal as fishmeal replacement in formulated feeds for the Whiteleg Shrimp (Litopenaeus vannamei). Aquac Nutr 26:752–762. https://doi.org/10.1111/anu.13034
Zheng CC, Wu JW, Jin ZH, Ye ZF, Yang S, Sun YQ, Fei H (2020) Exogenous enzymes as functional additives in finfish aquaculture. Aquac Nutr 26:213–224. https://doi.org/10.1111/anu.12995
Zokaeifar H, Balcázar JL, Saad CR, Kamarudin MS, Sijam K, Arshad A, Nejat N (2012) Effects of Bacillus subtilis on the growth performance, digestive enzymes, immune gene expression and disease resistance of white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol 33:683–689. https://dx.doi.org/10.1016/j.fsi.2012.05.027

No competing interests reported.

Download PDF

Editorial decision: Major revision
01 Dec, 2022
Reviews received at journal
14 Nov, 2022
Reviewers agreed at journal
09 Nov, 2022
Reviewers invited by journal
09 Nov, 2022
Editor assigned by journal
09 Nov, 2022
Submission checks completed at journal
03 Nov, 2022
First submitted to journal
03 Nov, 2022

You are reading this latest preprint version

Recombinant Bacillus subtilis expressing a fungal phytase as a probiotic additive in the diet of Pacific white shrimp Litopenaeus vannamei

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Ethics statement

Preparation of feed supplemented with probiotic bacteria

Experimental design

Tissue collection

Zootechnical performance

Proximate composition

Gene expression analyses

Histological analysis

Statistical analysis

Results

Zootechnical performance

Proximate composition of muscle tissue

Expression of genes related to digestion

Expression of genes related to amino acid metabolism

Expression of genes related to antioxidant defense system

Histological analysis

Discussion

Declarations

References

Additional Declarations

Status:

Version 1