Genetic diversity of the tomato russet mite supporting oligophagy and evidencing widespread of an invasive haplotype

doi:10.21203/rs.3.rs-2238916/v1

Download PDF

Research Article

Genetic diversity of the tomato russet mite supporting oligophagy and evidencing widespread of an invasive haplotype

https://doi.org/10.21203/rs.3.rs-2238916/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 16 Feb, 2023

Read the published version in Experimental and Applied Acarology →

Version 1

posted

You are reading this latest preprint version

Worldwide, the tomato russet mite (TRM), Aculops lycopersici (Eriophyidae), is a key pest on grown tomatoes besides infesting other cultivated and wild Solanaceae; however, information on TRM basics aspects supporting effective control strategies still lacking, mainly regarding its taxonomic unit and genetic diversity and structure. As A. lycopersici is reported on different species and genera of host plants maybe, populations associated with different host plants constitute specialized cryptic species, such as showed for other eriophyids previously considered generalists. The main aims of this study were to i) confirm the TRM taxonomic unity of populations from different host plants and localities as well as the species oligophagy; ii) to advance the understanding on TRM host relationship and invasion history. For this purpose it was evaluated the genetic variability and structure of populations from different host plants along crucial areas of occurrence, including that potentially of origin and the invaded ones, based on DNA sequences of mitochondrial (Cytochrome c oxidase subunit I) and nuclear (Internal Transcribed spacer, D2 28S) genomic regions. Specimens from South America (Brazil) and Europe (France, Italy, Poland, The Netherlands) were collected from tomato and other solanaceous species from the Solanum and Physalis genera. Final TRM datasets were composed by 101, 82 and 50 sequences from the COI (672 bp), ITS (553 bp) and D2 (605 bp) regions, respectively. Distributions and frequencies of haplotypes (COI) and sequence variants (D2 and ITS1) were inferred; pairwise genetic distances, and phylogenetic analysis were performed, including Bayesian Inference (BI) combined analysis. Genetic divergences for mitochondrial and nuclear genomic regions from TRM associated with different host plants were even lower than those observed in other eriophyid taxa confirming co-specific of TRM populations and oligophagy of this eriophyid mite. Four haplotypes (cH) were identified from the COI sequences being cH1 the most frequent, representing 90% of all sequences occurring in all host plants studied (Brazil, France, The Netherlands); the other haplotypes were present exclusively in Brazilian populations. Six variants (I) were identified from the ITS sequences: I-1 was the most frequent (76.5% of all sequences), spread in all countries and associated with all host plants, except for S. nigrum. Just one D2 sequence variant was found in all studied countries. The genetic homogeneity among populations highlights occurrence of a highly invasive and not host-specific haplotype. These results also do not corroborate the hypothesis that differential symptomatology/damage intensity by tomato varieties and solanaceous host plants could be due to the genetic diversity of the associated mite populations. Even this contribution was not primarily aimed to trace TRM invasion routes, genetic evidence, jointly with the main host plant history, corroborate the hypothesis of a TRM South American origin.

Aculops lycopersici

Eriophyidae

molecular systematics

host relationship

invasion biology

Solanaceae

The tomato russet mite (TRM), Aculops lycopersici (Tryon, 1917) (Eriophyidae), was described from tomato, Solanum lycopersicum L. (Solanaceae), from Queensland, Australia by Tryon in 1917; however, its origin has not yet been determined. Some authors redescribed this taxon setting up numerous synonyms (Massee 1937, Keifer 1940, 1966). Currently, this eriophyid mite is reported with cosmopolitan distribution, in almost all areas where solanaceous crops are grown (Jeppson et al. 1975; Duso et al. 2010; CABI 2020; Amrine and de Lillo personal communication). On tomatoes, heavy infestations cause yellowish-brown coloured stems or branches, dried leaves, and rusted fruits (Haque and Kawai 2002; Royalty and Perring 1988; Kumral et al. 2014); such damages can lead to 50% crop loss and even more than 65% in production (de Oliveira et al. 1982; Daiber 1985; Celar and Valič 2003). The troubles in controlling the TRM by chemicals (Yu 2008, Khalighi et al. 2016) make urgent the improvement of nonchemical and effective control strategies (de Lillo et al. 2018). However, TRM basic information to support the development of effective control strategies is still lacking, like taxonomy, genetic diversity and structure (e.g., Guidolin et al. 2014).

The TRM has been considered an exception to the general statement that eriophyoid mites are highly specialized plant parasites; it is included in 5% minority of eriophyoids reported to infest different host plant genera (Lindquist and Oldfield 1996; Skoracka et al. 2010). In addition to tomato, the current TRM host range comprises at least ten Solanum species and six other genera of Solanaceae: Browallia, Capsicum, Datura, Nicotiana, Petunia and Physalis (Perring and Farrar 1986; Keifer et al. 1982; Duarte et al. 2020; Amrine and de Lillo personal communication); furthermore, it is reported on the genus Convolvulus, from family Polygonaceae (Rice and Strong 1962). It is possible that populations, reported as associated with different host plants constitute a few specialized cryptic species, as shown for other eriophyid species, previously considered generalists (Skoracka and Dabert 2010; Skoracka et al. 2012, 2014; Lewandowski et al. 2014; Navia et al. 2015). Further studies integrating molecular traits are still needed to confirm TRM taxonomic unit and its effective host range.

TRM infestation on different species/varieties of host plants show different symptomatology or damage severity. Tens of accessions from several species of Solanum (ex. Lycopersicon) were tested for susceptibility to TRM: among them, damage index was not correlated with mite density (Kitamura and Kawai 2006). Symptoms expressed in a host plant are closely related to herbivore-host plant interactions, which depends on reciprocal adaptations as each clade evolved in response to changes in the other (Douglas et al. 2009; Nallu et al. 2018). Therefore, the differentiated symptomatology/susceptibility presented by tomatoes and solanaceous host plants in response to TRM infestation can be due to i) genetic diversity of the mite populations/species; or ii) differences on host plant defense mechanisms. Studies are needed to test these hypotheses and, eventually, by which mechanism are corroborated.

It has been discussed that the original TRM host plant is not tomato but some other wild solanaceous plants (Oldfield 1996; Michalska et al. 2010; Navia et al. 2010). The severe damage caused by TRM to tomatoes, including the plant death (Keifer et al. 1982; Lindquist and Oldfield 1996), suggests a recent association instead of an old co-evolutionary history (Oldfield 1996; Michalska et al. 2010; Duarte et al. 2020). It is possible that TRM adopted tomato plants as an alternate host plant in areas of co-occurrence of the original wild host plant and the cultivated tomato. The currently cultivated tomato has origin in central South America (Blanca et al. 2012, 2015; Razifard et al. 2020), rendering the study of TRM genetic variability, in this area, particularly interesting. Furthermore, comparing populations of the supposed origin and invaded areas can reveal insights into the invasion process of this pest. Reconstruction of agricultural pests invasion routes can support the design of strategies to prevent new invasions and to the development of management strategies. Therefore, it allows an understanding of the environmental and evolutionary factors favouring the invasion potential (Liebhold and Tobin 2008; Estoup and Guillemaud 2010; Pautasso et al. 2010).

The specific goals of this TRM study were to: i) confirm the taxonomic unity of populations from different host plants and localities as well as the species oligophagy; ii) know the genetic variability and structure of populations along crucial areas of occurrence, including that potentially of origin and the invaded ones, in order to advance the understanding on host relationship and invasion history. For these purposes, phylogenetic and genetic diversity studies based on DNA sequences of mitochondrial and nuclear fragments from South American and European populations collected from tomato and other solanaceous species in the Solanum and Physalis genera were performed.

Sampling

TRM specimens were collected from 26 populations from Brazil, France, Italy, Poland and the Netherlands, over seven solanaceous species belonging to two genera- Solanum lycopersicum, S. muricatum Ait., S. aethiopicum L., S. nigrum L., S. sessiflorum Dunal, S. americanum Mill., and Physalis sp.. Samples of leaves and branches were collected in natural areas and/or in crops. In Brazil, surveys were conducted in the Cerrado biome or in cultivated areas, including the Germplasm Bank of Solanaceae, at Embrapa Hortaliças, and experimental areas at “Fazenda Água Limpa (FAL)”, University of Brasilia, Federal District, Brazil. Collection data and sample codes of the A. lycopersici populations studied are shown in Table 1.

Table 1

Collection data of TRM populations obtained from wild and cultivated solanaceous plants from Brazil and Europa. Abreviations of countries where samples were collected: BR- Brazil; FR- France; PL- Poland; IT- Italy; NL- The Netherlands.
Sample code	Host plant táxon	Locality	Geographical coordinates	Date	Collected by
Al1	Solanum lycopersicum	BR: Distrito Federal. Brasília (Embrapa Recursos Geneticos e Biotecnologia)	15º43'51"S. 47º54'02"W	16/11/2017	M. E. Duarte
Al2	Solanum lycopersicum	BR: Distrito Federal. Paranoá	15º58'32"S. 47º29'32"W	30/11/2017	R.S. Mendonça
Al3	Physalis sp.	BR: Distrito Federal Gama (Embrapa Hortaliças	15º56'06"S. 48º08'24"W	13/12/2017	M. E. Duarte
Al4	Solanum muricatum	BR: Distrito Federal. Gama (Embrapa Hortaliças	15º56'05"S. 48º08'24"W	13/12/2017	M. E. Duarte
Al5	Solanum aethiopicum	BR: Distrito Federal. São Sebastião	15°54'04"S. 47°45'40"W	14/12/2017	M.L.S.C.M. Alves
Al6	Solanum lycopersicum	BR: São Paulo. Piracicaba	22°42'38"S. 47°38'04"W	31/03/2017	M. D. Santos
Al7	Solanum lycopersicum	FR: Montpellier	43º40'57"N. 3°52'31"E	2015	Navia. D.
Al8	Solanum lycopersicum	BR: Distrito Federal. Gama (Embrapa Hortaliças)	15º55'58"S. 48º08'25"W	14/08/2017	M. E. Duarte
Al9	Solanum sessiliflorum	BR: Distrito Federal. Gama (Embrapa Hortaliças)	15º55'56"S. 48º08'21"W	30/08/2017	R.S. Mendonça
Al10	Solanum americanum	BR: Distrito Federal. Gama (Embrapa Hortaliças)	15º55'58"S. 48º08'25"W	30/03/2017	R.S. Mendonça
Al11	Solanum lycopersicum	BR: Distrito Federal. Núcleo rural Samambaia	15º 48'08"S. 48º10'38"W	05/09/2017	M. E. Duarte & R.S. Mendonça
MLW1	Solanum lycopersicum	PL: Warsaw	52°09'43"N. 21°02'46"E	15/09/2016	M. Lewandowski
MLW2	Solanum lycopersicum	PL: Czersk	51°57'18"N. 21°15'25"E	15/09/2016	M. Lewandowski
MLW3	Solanum lycopersicum	PL: Konstancin	52°05'51"N. 21°09'38"E	15/09/2016	M. Lewandowski
MLW4	Solanum lycopersicum	IT: Scandicci (Firenze)	43°45'14"N. 11°11'34"E	26/09/2016	S. Simoni
MLW5	Solanum lycopersicum	IT: San Felice a Ema (Firenze)	43°44'19"N. 11°14'34"E	06/10/2016	S. Simoni
MLW6	Solanum nigrum	IT: Cascine del Riccio (Firenze)	43°43"54"N. 11°15'13"E	06/10/2016	S. Simoni
MLW7	Solanum lycopersicum	NL: De Lier	51°58'19"N. 4°15'11"E	21/11/2016	M. Lewandowski
MLW8	Solanum lycopersicum	PL: Wola Hankowska	50°52'45"N. 19°05'41"E	20/12/2016	M. Lewandowski
MLW9	Solanum lycopersicum	PL: Janów	52°03'31"N. 21°16'47"E	12/10/2017	M. Lewandowski
MLW10	Solanum lycopersicum	IT: San Severo	41°40'47"N. 15°22'17"E	17/09/2018	S. Simoni
MLW11	Solanum lycopersicum	IT: Battipaglia	40°35'26"N 15°00'54"E	17/09/2018	S. Simoni
MLW12	Solanum nigrum	IT: Battipaglia	40°35'01"N. 14°58'51"E	17/09/2018	S. Simoni
MLW13	Solanum lycopersicum	IT: Sarno	40°48'46"N. 14°36'43"E	17/09/2018	S. Simoni
MLW14	Solanum nigrum	IT: Cascine del Riccio (Firenze)	43°43'54"N. 11°15'13"E	19/09/2018	S. Simoni
MLW15	Solanum lycopersicum	PL: Gatka Nowa	51°40'57"N. 19°25'48"E	25/09/2018	M. Lewandowski

Samples were transported to the laboratory for further direct examination under dissecting stereomicroscope (40×). Eriophyid mites were collected and stored in Eppendorf tubes containing absolute or 70% ethyl alcohol, for molecular and morphological studies, respectively. For morphological identification, mite specimens were then mounted on microscope slides using modified Berlese medium (Amrine and Manson 1996) and observed under a phase-contrast microscope (100x, Eclipse 80i Nikon and Olympus BX51, Tokyo, Japan).

Molecular Studies

DNA extraction, amplification, and sequencing

Genomic DNA was extracted from single specimens. For Brazilian samples, extractions were conducted using the DNeasy Blood Tissue Kit (Qiagen, Brazil). Intact mites were individually transferred from absolute ethyl alcohol to 1.5 mL microcentrifuge tubes containing 90 µL of ATL buffer (Qiagen); 10 µL of Proteinase K (Qiagen) was then added to each sample. The mixture was incubated at 56°C with shaking in a thermomixer for 18–22 h. Mites were not crushed. All other steps were following the standard Qiagen DNA extraction protocol ‘Purification of Total DNA from Animal Tissue’ by Mendonça et al. (2011). For European samples, genomic DNA was extracted using a Chelex® protocol. Individual specimens were transferred into a DNase-free 0.5 ml polyvinyl tubes containing 5 µ l of Proteinase K (20 mg/ml), crushed using a clean steel needle and 100 µl of 6% Chelex solution was added. After vortexing, the tubes were incubated initially for 30 min at 56°C and then for 8 min at 100°C. Then, the procedure adopted was according to the method described in Bouneb et al. (2014). The specimens submitted to DNA extraction, always that were found in the membrane of the extraction column, had their exoskeleton recovered and were mounted on microscope slides in modified Berlese medium. These slides were deposited as voucher specimens in the mite collection at Embrapa Genetic Resources and Biotechnology, Brasília, Brazil.

Three DNA fragments were PCR-amplified and sequenced per single mite: one mitochondrial gene - the Cytochrome c oxidase subunit I (COI) (DNA barcode region chosen by the Consortium for the Barcode of Life (http://barcoding.si.edu); two nuclear fragments: the subunit D2 region in 28S rDNA and the ITS nuclear region including ITS1 + 5.8S + ITS2.

Amplification and sequencing of the COI were performed using the degenerate primers LCO 1490 and HCO 2198 (for Brazilian samples) and bcdF01 and bcdR04 (for European samples) (Table 2). For Brazilian samples, PCR was conducted in 25 µL reaction volumes containing 2.5 µL of 10× reaction buffer supplied by the manufacturer (Qiagen), 2.5 µL MgCl₂ (25 mM), 0.25 µL dNTP mix (10 mM), 0.5 µL of each primer (10 µM), 0.12 µL U µL^− 1 (5 units) of Taq DNA polymerase for standard and specialized PCR applications (Qiagen), 14.53 µL of sterile water and 4 µL of DNA template; using a thermocycling profile of one cycle of 3 min at 95°C followed by 45 cycles of 45 s at 95°C, 30 s at 45°C, and 1.10 min at 72°C, and a final step of 10 min at 72°C. European samples were amplified in 12,5 µL reaction volumes containing 6.5 µL of Premix Ex Taq Hot Start (Takara), 0.25 µL of each primer (20 µM), 3.75 µL of sterile water and 2 µl of DNA template; using a thermocycling profile of 35 cycles of 20 s at 94°C, 30 s at 50°C, and 1.0 min at 72°C, according to the manufacturer's protocol.

Table 2

Amplified fragments and primers used in PCR reactions and DNA sequencing of TRM specimens.
Region	Primer	Sequence for the primer 5' − 3'	Lenght (bp)	Use	Reference
COI	bcd F01	CATTTTCHACTAAYCATAARGATATTGG	670 bp	PCR and sequencing	Skoracka & Dabert (2010)
COI	bcd R04	TATAAACYTCDGGATGNCCAAAAAA	670 bp	PCR and sequencing	Skoracka et al. (2012)
	LCO 1490	GGTCAACAAATCATAAAGATATTGG	~ 650bp	PCR and sequencing	Folmer et al. (1994)
	HCO 2198	TAAACTTCAGGGTGACCAAAAAATCA	~ 650bp	PCR and sequencing	Folmer et al. (1994)
ITS	18S	AGAGGAAGTAAAAGTCGTAACAAG	~ 900 bp	PCR and sequencing	Ben Ali et al. (2000)
	28SC	ATATGCTTAAATTCAGCGGG	~ 900 bp	PCR and sequencing	Navajas et al. (1998)
ITS1	MITS1	CCGTAGGTGAACCTGCGGAAGG	~ 514 bp	PCR and sequencing	Fenton et al. (1997)
	MITS4	CCACCGTTAATTGTGATTTATTTTGTC	~ 514 bp	PCR and sequencing	Fenton et al. (1997)
D2	fl230	TGAAACTTAAAGGAATTGACG	~ 2500 pb	PCR	Skoracka & Dabert (2010)
D2	D1D2 rev 04	GTTAGACTYCTTGGTCCGTG	~ 2500 pb	PCR	Skoracka & Dabert (2010)
	fw2	ACAAGTACCDRTAGGGAAAGTTG	~ 516 pb	Sequencing	Skoracka et al. (2012)
	D1D2 rev 04	GTTAGACTYCTTGGTCCGTG	~ 516 pb	Sequencing	Skoracka et al. (2012)
	D1D2fw2	ACAAGTACCDRTAGGGAAAGTTG	~ 514bp	PCR and sequencing	Skoracka et al. (2013)
	28Sr0990	CCTTGGTCCGTGTTTCAAGAC	~ 514bp	PCR and sequencing	Skoracka et al. (2013)

For Brazilian samples, the ITS nuclear region (ITS1 + 5.8S + ITS2) was amplified and sequenced using the forward and reverse primers 18S and 28SC, respectively (Table 2). PCR was conducted in 25 µL reaction volumes with 2.5 µL of 10 × buffer (Qiagen), 1 µL MgCl2 (25 mM), 0.3 µL BSA (10 mg mL − 1, Biolabs), 1 µL dNTP mix (10 mM of each base), 0.5 µL of each primer (10 µM), 0.25-µL U µL^− 1 (5 units) of Taq polymerase (Qiagen), 16.95 µL water and 2 µL of DNA template; using a thermocycling profile of one cycle of 4 min at 94°C followed by 30 cycles of 30 s at 94°C, 30 s at 53°C, and 1 min at 72°C, and a final step of 10 min at 72°C. European samples were amplified and sequenced using the primers MITS1 and MITS4 (ITS1) (Table 2). PCR was conducted in 12,5 µL reaction volumes containing 6.5 µL of Premix Ex Taq Hot Start (Takara), 0.25 µL of each primer (20 µM), 2.75 µL of sterile water, and 3 µl of DNA template, using a thermocycling profile of 35 cycles of 20 s at 94°C, 30 s at 59°C, and 1.0 min at 72°C. After amplification, 4–5 µL of the PCR reaction was analyzed by electrophoresis on a 1% agarose gel and visualized by GelRed staining (Biotum, Fremont, CA, USA) to assess the product size and concentration. Both strand directions of the amplified fragments (COI, D2 and ITS) containing visible and single bands were sequenced. Samples from Brazil were directly sequenced in both directions using an ABI 3730 XLs automated DNA sequencer (Applied Biosystems, Korea). European samples were purified using Exonuclease I and Shrimp Alkaline Phosphathase enzyme mix (Thermo Scientific, USA) and then sequenced in both strand directions using the BigDye Terminator v3.1 chemistry on an ABI3730 Genetic Analyzer (Applied Biosystems, USA) in the DNA Sequencing and Oligonucleotide Synthesis Laboratory IBB PAS (Warsaw, Poland).

For Brazilian samples, amplification of the D2 region in 28S rDNA was performed using the primers f1230 and D1D2rev04 (Table 2). PCR was conducted in 25-µL volumes enclosing 2.5 µL of 10 × reaction buffer (Qiagen), 1 µL MgCl2 (25 mM), 1 µL dNTP mix (10 mM of each base), 0.625 µL of each primer (10 µM), 0.25-µL U µL − 1 (5 units) of Taq polymerase (Qiagen), 16 µL of sterile water and 3 µL of DNA template; using a thermocycling profile of one cycle of 3 min at 96°C followed by 35 cycles of 10 s at 95°C, 1 min at 50°C, and 2 min at 72°C, and a final step of 5 min at 72°C. For sequencing of the D2 region, the primers fw2 and D1D2 rev04 were used. European samples were amplified and sequenced using the primers D1D2fw2 and 28Sr0990 (Table 2). PCR was conducted in 12,5-µL reaction volumes containing 6.5 µL of Premix Ex Taq Hot Start (Takara), 0.25 µL of each primer (20 µM), 3.75 µL of sterile water, and 2 µl of DNA template, using a thermocycling profile of 35 cycles of 20 s at 94°C, 30 s at 52°C, and 1.0 min at 72°C.

Sequences, Genetic Diversity, And Phylogenetic Analyses

The software Staden Package v.1.6.0 (Staden et al. 2000) was used for checking, editing and assembling the raw data into sequence contigs. The COI, D2 and ITS sequences were aligned using the ClustalW multiple alignment procedure (Thompson et al. 1994) implemented in BIOEDIT v.7.0.4 (Hall 1999) with default gap-weighting parameters. No manual adjustments were made to the CLUSTAL alignment. The distributions and frequencies of haplotypes (COI) and sequence variants (D2 and ITS1) of the TRM populations were inferred using the option ‘Haplotype Collapse’ in the program ALTER (Alignment Transformation Environment) available at http://sing.ei.uvigo.es/ALTER/ (Glez-Peña et al. 2010).

Different primer combinations were used to generate sequences of the ITS region, producing dissimilarities in the size of the segment sequenced. One spanning the ITS1, 5.8S and ITS2 region with about 900 bp and the other the ITS1 fragment of about 514 bp. The latter region was present in all accessions and was selected for the subsequent analysis.

Analyses of the pairwise genetic distances between and within nucleotide sequences, as well the choice of the most appropriate evolutionary models for estimation of inter- and intra-lineage genetic variation were performed using MEGA v.7 (Tamura et al. 2013). The Hasegawa-Kishino-Yano (HKY) model (Tamura et al. 2013) was applied to the COI dataset; the Kimura 2-Parameters (K2P) model (Kimura 1980) was applied to the D2 datasets; and Tamura 3-parameter (T92) was applied to the ITS datasets. Standard error estimates were obtained by a bootstrap procedure (1000 replicates).

The phylogenetic analyses were conducted using the maximum likelihood (ML) optimality criterion. The best-fit models of nucleotide substitution for the three fragments were selected using the jModeltest v.2.1.1 program (Darriba et al. 2012) based on the likelihood scores for 88 different models. The Akaike information criterion corrected (AICc) and the Bayesian information criterion (BIC) were calculated. The ML models were tested in PhyML v.3.0 (Guindon and Gascuel 2003; Guindon et al. 2010), NJ in MEGA v.7 (Kumar et al. 2016), and Bayesian inference (BI) was tested in MrBayes v.3.2.6 (Ronquist et al. 2012). This software and these procedures were used to test NJ, ML and BI phylogenies in analyses of COI, ITS and D2 sequences.

The COI A. lycopersici sequence available in GenBank was included in the analyses (JX298841) (Bouneb et al. 2014), as well as one fragment extracted from the complete genome (WNKI00000000) (Greenhalgh et al. 2020). In addition, sequences of Aculops strobilaceae Xue and Hong, 2006 (KF782528) and Aculops cajanusis Xue and Hong, 2011 (KF782527) (Li et al. 2014) were included in the D2 analyses as internal group. Sequences of Abacarus neosacchari Duarte and Navia, 2019 (belonging to the Phyllocoptinae, Anthocoptini similarly to Aculops) were included as outgroup in COI (KX892640), D2 (KX855705) and ITS (KX855740 and KX855741) analyses. Sequences were also checked against Aculops sequences retrieved from GenBank (Bouneb et al. 2014; Li et al. 2014; Duarte et al. 2019, Greenhalgh et al. 2020) and used to edit a neighbor joining tree to validate their reliability. The alignment of COI sequences was confirmed by translating the aligned DNA into amino acids using MEGA v.6. To initially identify candidate protein-coding regions in DNA sequences searching start and stop codons, an open reading frame was determined using a graphical analysis tool (ORF FINDER) available at http://www.ncbi.nlm.nih.gov/projects/gorf/. GenBank deposit accession numbers for sequences obtained in this study are in Table 3. The complete dataset is available upon request.

Table 3

Characteristics of the samples used in this study. Haplotypes/genotypes found and sequence GenBank accession numbers.
Host plant táxon	Locality	Sample code	Haplotype/genotype			Accession No
Host plant táxon	Locality	Sample code	COI	D2	ITS	COI	D2	ITS
Solanum lycopersicum	BR: Distrito Federal. Brasília (Embrapa Recursos Geneticos e Biotecnologia)	Al1_9	cH-1	-	-	MW173880	-	-
	BR: Distrito Federal. Paranoá	Al2_10	-	-	I-1	-	-	MT652098
	BR: Distrito Federal. Paranoá	Al2_9*	cH-1	-	I-1	MW173881*	-	MT652099*
	BR: Distrito Federal. Paranoá	Al2_16*	cH-1	D2-1	I-2	MW173882*	MT652179*	MT652100*
Physalis sp.	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al3_1*	cH-1	D2-1	I-1	MW173883*	MT652180*	MT652101*
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al3_2	cH-1	-	I-1	MW173884	-	MT652102
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al3_7	-	D2-1	I-1	-	MT652181	MT652103
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al3_15*	cH-2	D2-1	I-1	MW173956*	MT652182*	MT652104*
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al3_18	cH-1	-	I-1	MW173885	-	MT652105
	BR: Distrito Federal Gama (Embrapa Hortaliças	Al3_21*	cH-1	D2-1	I-1	MW173886*	MT652183*	MT652106*
Solanum muricatum	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_4	-	-	I-1	-	-	MT652107
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_6*	cH-1	D2-1	I-1	MW173887*	MT652184*	MT652108*
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_8	-	-	I-1	-	-	MT652109
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_13	cH-1	-	I-1	MW173888	-	MT652110
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_16	cH-1	D2-1	I-1	MW173889	MT652185	MT652111
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_17	cH-1	-	I-1	MW148527	-	MT652112
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_19	-	D2-1	I-1	-	MT652186	MT652113
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_21*	cH-1	D2-1	I-1	MW173890*	MT652187*	MT652114*
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_22	cH-1	-	I-1	MW173891	-	MT652115
	BR: Distrito Federal. Gama (Embrapa Hortaliças	Al4_25	cH-1	D2-1	I-1	MW173892	MT652188	MT652116
Solanum aethiopicum	BR: Distrito Federal. São Sebastião	Al5_2*	cH-1	D2-1	I-1	MW173893*	MT652189*	MT652117*
	BR: Distrito Federal. São Sebastião	Al5_10*	cH-1	D2-1	I-1	MW173894*	MT652190*	MT652118*
	BR: Distrito Federal. São Sebastião	Al5_11	cH-1	D2-1	I-1	MW148528	MT652191	MT652119
	BR: Distrito Federal. São Sebastião	Al5_12	cH-1	-	-	MW173895	-	-
	BR: Distrito Federal. São Sebastião	Al5_13	cH-1	-	I-1	MW173896	-	MT652120
	BR: Distrito Federal. São Sebastião	Al5_16*	cH-1	D2-1	I-1	MW173897*	MT652192*	MT652121*
	BR: Distrito Federal. São Sebastião	Al5_18	cH-1	-	-	MW173898	-	-
	BR: Distrito Federal. São Sebastião	Al5_19	cH-1	D2-1	I-1	MW136001	MT652193	MT652122
	BR: Distrito Federal. São Sebastião	Al5_21	-	D2-1	I-1	-	MT652194	MT652123
Solanum lycopersicum	BR: São Paulo. Piracicaba	Al6_4*	cH-1	-	I-1	MW173899*	-	MT652124*
	BR: São Paulo. Piracicaba	Al6_5	cH-1	-	I-1	MW148529	-	MT652125
	BR: São Paulo. Piracicaba	Al6_6	cH-1	-	-	MW173900	-	-
	BR: São Paulo. Piracicaba	Al6_8	cH-1	-	-	MW173901	-	-
	BR: São Paulo. Piracicaba	Al6_12	cH-1	-	I-1	MW173902	-	MT652126
	BR: São Paulo. Piracicaba	Al6_13	cH-1	-	I-1	MW173903	-	MT652127
	BR: São Paulo. Piracicaba	Al6_15	cH-1	-	I-1	MW173904	-	MT652128
	BR: São Paulo. Piracicaba	Al6_17	cH-1	-	-	MW173905	-	-
	BR: São Paulo. Piracicaba	Al6_20	-	-	I-1	-	-	MT652129
	FR: Montpellier	Al7_11	-	-	I-1	-	-	MT652130
	FR: Montpellier	Al7_16	-	-	I-1	-	-	MT652131
	FR: Montpellier	Al7_26*	cH-1	-	I-1	MW173906*	-	MT652132*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_1	cH-1	D2-1	I-1	MW148530	MT652195	MT652133
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_2	cH-1	D2-1	I-1	MW173907	MT652196	MT652134
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_3	cH-1	-	I-1	MW173908	-	MT652135
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_4	cH-1	D2-1	I-1	MW148531	MT652197	MT652136
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_5*	cH-1	D2-1	I-1	MW173909*	MT652198*	MT652137*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_6*	cH-1	D2-1	I-3	MW173910*	MT652199*	MT652138*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_7	cH-1	D2-1	I-1	MW173911	MT652200	MT652139
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_8	cH-1	D2-1	I-1	MW136002	MT652201	MT652140
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_10	cH-1	-	-	MW173912	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_11	cH-1	-	I-1	MW173913	-	MT652141
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_12	cH-1	-	I-1	MW173914	-	MT652142
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_13	cH-1	-	-	MW173915	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_14*	cH-4	D2-1	I-1	MW148536*	MT652202*	MT652143*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_15	cH-1	D2-1	I-1	MW173916	MT652203	MT652144
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_16	cH-1	D2-1	I-1	MW173917	MT652204	MT652145
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_17	-	-	I-1	-	-	MT652146
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_18*	cH-1	-	-	MW148526*	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_19	-	-	I-1	-	-	MT652147
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_20*	cH-3	-	I-1	MW173963*	-	MT652148*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al8_21	cH-1	-	I-1	MW148532	-	MT652149
Solanum sessiliflorum	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_3*	cH-1	-	I-1	MW173918*	-	MT652150*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_5*	cH-1	-	I-4	MW173919*	-	MT652151*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_6*	cH-1	-	-	MW173964*	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_10	cH-1	-	-	MW173920	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_11	cH-1	-	I-1	MW173921	-	MT652152
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_13	cH-1	-	-	MW173922	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_14	cH-1	-	I-1	MW173923	-	MT652153
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_16	cH-1	-	I-4	MW173924	-	MT652154
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al9_18	cH-1	-	I-4	MW173925	-	MT652155
Solanum americanum	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_4	cH-1	-	-	MW173926	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_6	cH-1	-	-	MW173927	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_7*	cH-1	-	I-1	MW173928*	-	MT652156*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_9*	cH-2	-	I-1	MW173957*	-	MT652157*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_10	cH-2	-	-	MW173958	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_13	cH-1	-	-	MW148533	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_14	cH-2	-	-	MW173959	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_15	cH-1	-	-	MW173929	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_16*	cH-2	-	I-1	MW173960*	-	MT652158*
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_18	cH-1	-	-	MW173930	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_19	cH-1	-	-	MW148534	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_21	cH-2	-	-	MW173961	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_22	cH-2	-	I-1	MW136003	-	MT652159
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_23	cH-1	-	-	MW148535	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_26	cH-2	-	-	MW173962	-	-
	BR: Distrito Federal. Gama (Embrapa Hortaliças)	Al10_27	cH-1	-	I-1	MW173931	-	MT652160
Solanum lycopersicum	BR: Distrito Federal. Núcleo rural Samambaia	Al11_1	-	-	I-1	-	-	MT652161
	BR: Distrito Federal. Núcleo rural Samambaia	Al11_2*	cH-1	-	I-1	MW173932*	-	MT652162*
	BR: Distrito Federal. Núcleo rural Samambaia	Al11_3	cH-1	-	-	MW173933	-	-
	BR: Distrito Federal. Núcleo rural Samambaia	Al11_4*	cH-1	-	I-1	MW173934*	-	MT652163*
	BR: Distrito Federal. Núcleo rural Samambaia	Al11_5	cH-1	-	-	MW173935	-	-
	BR: Distrito Federal. Núcleo rural Samambaia	Al11_6	-	-	I-1	-	-	MT652164
	BR: Distrito Federal. Núcleo rural Samambaia	Al11_10*	-	-	I-5	-	-	MT652165*
	PL: Warsaw	MLW690	cH-1	D2-1	-	MW173936	MT652205	-
	PL: Warsaw	MLW691	-	-	I-6	-	-	MT652166
	PL: Czersk	MLW695*	cH-1	D2-1	I-6	MW173937*	MT652206*	MT652167*
	PL: Konstancin	MLW696*	cH-1	D2-1	-	MW173938*	MT652207*	-
	PL: Konstancin	MLW697	-	-	I-6	-	-	MT652168
	IT: Scandicci (Firenze)	MLW699	cH-1	D2-1	I-6	MW173939	MT652208	MT652169
	IT: San Felice a Ema (Firenze)	MLW701	cH-1	D2-1	I-6	MW173940	MT652209	MT652170
	IT: Cascine del Riccio (Firenze)	MLW703	cH-1	D2-1	I-6	MW173941	MT652210	MT652171
Solanum sessiliflorum	IT: Cascine del Riccio (Firenze)	MLW705*	cH-1	D2-1	I-6	MW173942*	MT652211*	MT652172*
Solanum lycopersicum	NL: De Lier	MLW710*	cH-1	D2-1	-	MW173943*	MT652212*	-
	PL: Wola Hankowska	MLW713	cH-1	-	-	MW173944	-	-
	PL: Wola Hankowska	MLW714	-	D2-1	-	-	MT652213	-
	PL: Janów	MLW716	-	D2-1	-	-	MT652214	-
	IT: San Severo	MLW888	cH-1	D2-1	I-6	MW173945	MT652215	MT652173
	IT: Battipaglia	MLW889	cH-1	D2-1	I-6	MW173946	MT652216	MT652174
	IT: Battipaglia	MLW890	cH-1	-	-	MW173947	-	-
	IT: Battipaglia	MLW893	cH-1	D2-1	I-6	MW173948	MT652217	MT652175
	IT: Battipaglia	MLW894	cH-1	D2-1	-	MW173949	MT652218	-
	IT: Battipaglia	MLW896	cH-1	D2-1	I-6	MW173950	MT652219	MT652176
	IT: Battipaglia	MLW905*	cH-1	D2-1	I-6	MW173951*	MT652220*	MT652177*
	IT: Battipaglia	MLW906	cH-1	D2-1	I-6	MW173952	MT652221	MT652178
Solanum nigrum	IT: Battipaglia	MLW908	-	D2-1	-	-	MT652222	-
Solanum lycopersicum	IT: Sarno	MLW909	cH-1	-	-	MW173953	-	-
Solanum nigrum	IT: Cascine del Riccio (Firenze)	MLW910*	cH-1	D2-1	-	MW173954*	MT652223*	-
Solanum lycopersicum	PL: Gatka Nowa	MLW911	cH-1	D2-1	-	MW173955	MT652224	-

Table 4. DNA diversity indices. Intraspecific parameters based on COI barcoding region and the subunit D2 and ITS1 TRM sequences. S= total polymorphic positions; h= number of haplotypes; Hd = haplotype diversity; Hd StDev = Standard Deviation of Haplotype diversity; K = Average number of nucleotide differences.

Table 5

Estimates of average divergence (shown as percentages with standard error estimates in parentheses) for *COI* region sequence pairs within *Aculops lycopersici* haplotypes and between *A. lycopersici* haplotypes and *Abacarus neosacchari* outgroup species
	Haplotype 1		Haplotype 2		Haplotype 3		Haplotype 4		Outgroup
Haplotype 1 Aculops lycopersici	0.00	(0.00)
Haplotype 2 Aculops lycopersici	0.21	(0.20)	0.00	(0.00)
Haplotype 3 Aculops lycopersici	0.21	(0.21)	0.43	(0.29)	n/c	(n/c)
Haplotype 4 Aculops lycopersici	0.21	(0.20)	0.43	(0.28)	0.43	(0.29)	n/c	(n/c)
Outgroup A. neosacchari	26.12	(2.01)	26.34	(2.01)	26.12	(2.01)	26.34	(2.02)	n/c
Analyses were conducted using the P-distance parameter (P2) model

Table 6

Estimates of average divergence (shown as percentages with standard error estimates in parentheses) for ITS region sequence pairs within and between *A. lycopersici* variants and the *Abacarus neosacchari* outgroup species.
	Var 1		Var 2		Var 3		Var 4		Var 5		Var 6		Outgroup
A. lycopersici-var 1	0.00	(0.00)
A. lycopersici-var 2	0.56	(0.35)	n/c	(n/c)
A. lycopersici-var 3	0.28	(0.25)	0.85	(0.44)	n/c	(n/c)
A. lycopersici-var 4	0.56	(0.33)	1.13	(0.47)	0.85	(0.42)	0.00	(0.00)
A. lycopersici-var 5	0.28	(0.28)	0.28	(0.25)	0.56	(0.38)	0.85	(0.41)	n/c	(n/c)
A. lycopersici-var 6	0.28	(0.26)	0.85	(0.44)	0.56	(0.32)	0.85	(0.44)	0.56	(0.40)	0.00	(0.00)
Outgroup Abacarus neosacchari	32.9	(2.17)	32.96	(2.15)	33.24	(2.14)	33.52	(2.24)	32.68	(2.17)	32.68	(2.17)	0.00	(0.00)
Analyses were conducted using the P-distance parameter (P2) model

Table 7

Estimates of average divergence (shown as percentages with standard error estimates in parentheses) for D2 region of 28S rDNA sequence pairs within and between *Aculops* and the *Abacarus neosacchari* outgroup species
	A. lycopercsi -Var 1		A. strobilaceae		A. cajanusis		A. neosacchari
Aculops lycopercsi -Var 1	0.00	(0.00)
Aculops strobilaceae	30.53	(1.90)	n/c	(n/c)
Aculops cajanusis	36.73	(2.44)	33.63	(2.18)	n/c	(n/c)
Outgroup Abacarus neosacchari	34.51	(2.27)	25.22	(2.01)	28.98	(2.01)	n/c	(n/c)
Analyses were conducted using the P-distance parameter (P2) model

To perform the Bayesian Inference (BI) combined analysis of COI, D2 and ITS fragments, the sequence files were individually organized using MEGA v.6. Alignments of the three fragments were performed separately by the CLUSTAL W multiple alignment method (Thompson et al. 1994) implemented in the BioEdit program. The files were then concatenated in a single matrix in Mesquite v.3.0.4 (a modular system for evolutionary analysis) (Maddison and Maddison 2016), and the BI combined analysis was performed in MrBayes v.3.2. The number of categories, used to approximate the gamma distribution, was set at four, and four Markov chains were run for 10,000,000 generations; the final average standard deviation of split frequencies was less than 0.01, and the stabilization of model parameters (burn-in = 0.25) occurred at approximately 250 generations. The edition of the phylogenetic tree was performed using TreeView v.0.5.0.

Datasets and genetic diversity

COI

The final COI dataset consisted of 102 aligned sequences of 672 bps, 99 sequences representing twenty-five TRM populations associated with solanaceous plants obtained in this study (Table 3); two TRM sequences available in/extracted from the GenBank (as mentioned in M&M); ans one Abacarus mite sequence as an outgroup. No insertions or deletions were found. The translation of the mtDNA COI nucleotide sequences resulted in 230 amino acids in length. Alignment of these amino acid sequences revealed differences at four positions (variable sites), one was parsimony informative. The G+C and A+T composition of the entire data set ranged from 36.79 to 38,57% and 61.47 to 63.21%, respectively. Polymorphism indices such as the number of variable sites (S), the haplotype number (h) and diversity (Hd), the average number of differences in nucleotides (K), and the diversity of nucleotides (Pi) for mitochondrial and nuclear sequences of A. lycopersici are presented in Table 4.

The average mean divergence over all the sequence pairs (including the out-group taxa) was 13.84% (SE = 1.17), ranging from 0.21 to 26.34%. The average mean divergence over TRM sequences was 0.36% (SE = 0.29) and ranged from 0.21 to 0.43% (Table 5).

ITS1

The final ITS1 dataset consisted of 84 sequences of 553 bps, including 81 sequences of TRM populations from Brazil and Europe, obtained in this study (Table 3); one TRM genome sequence and two sequences of Ab. neosacchari (as an outgroup) recovered from the GenBank. In the alignment, five sites were parsimoniously informative, and nine sites were variable (Table 4). The average mean divergence over all sequence pairs, including the outgroup taxa, was 13.81% (SE = 1.1%) and ranged from 0.28 to 33.52%. The average mean divergence over the A. lycopersici sequences was 0.65% (SE = 0.38%) and ranged from 0.28 to 1.13% (Table 6).

The nuclear sequence data of the D2 region of the 28S rDNA comprised 49 aligned sequences of 605 bp (26 sequences from five TRM populations from Brazil and 20 sequences from Europe); one TRM genome sequence; and three outgroup sequences- two species of Aculops species and one of Ab. neosacchari (last four available in the GenBank). The D2 sequences obtained during this study are the first TRM sequences available in the GenBank for this fragment. No polymorphic sites and variable regions were detected within the TRM D2 sequences.

The average mean divergence over all sequence pairs (including the outgroup taxa) was 30.78% (SE = 2.10%) and ranged from 0.0 to 36.73%. The average mean divergence over the TRM sequences was 0.0% (SE = 0.0) (Table 7).

Haplotypes and sequence variants

Four haplotypes were identified from the TRM COI sequences (Table 5). Haplotype 1 (cH1) was the most frequent, representing 90% (91/101 sequences) of all sequences and spread in all countries and host plants considered (Figure 1). Haplotypes 2, 3 and 4 (cH2, cH3, cH4) were exclusively present among Brazilian populations: cH2 representing 7.9% (8/101 sequences) of all sequences and associated with Physalis sp. and S. americanum; cH3 and cH4, each represented in only one sequence, were both associated with S. lycopersicum (Figure 1).

Six sequence variants were identified from the TRM ITS sequences (Table 6). Sequence variant 1 (I-1) was the most frequent representing 76.5% (62/81 sequences) of all sequences occurring in Brazil, France and The Netherlands; it was associated with all host plants except for S. nigrum. Sequence variant 6 (I-6), representing 16% (13/81 sequences) of all sequences, was found exclusively in the European populations from Poland and Italy, associated with S. lycopersicum and S. nigrum. Sequence variant 4 (I-4), representing 3.7% (3/81 sequences), was found exclusively among Brazilian populations from S. sessiliflorum. Sequence variants 2, 3 and 5 (I-2. I-3. I-5), each represented by just one sequence, were found exclusively among Brazilian populations from S. lycopersicum (Figure 1).

Only one D2 sequence variant (D2-1) (46 sequences) was found among TRM populations (Table 7); it was found in all studied countries (except France since no D2 sequences were obtained from this country) and associated with all host plants (except with S. americanum since no D2 sequences were obtained from this host) (Figure 1).

Phylogenetic relationships

The general topologies of the COI phylogenetic trees inferred by the two selected models were similar by reaveling the same structure for TRM populations and the external group. Thus, only the ML model is shown (Figure 2). TRM sequences were clustered in two closely-related and low-supported clades: Clade I, which clusters sequences representing cH-1, cH-2 and cH-4 haplotypes, with sequences from all studied countries and host plants; Clade 2, which comprises the cH-3 sequence, obtained from a Brazilian tomato population. In Clade 1, cH-2 haplotype sequences obtained from Brazilian populations from Physalis and S. americanum comprise a sub-clade.

The topology of the ITS phylogenetic tree inferred by the selected model (Figure 3) also consisted in two low-supported clades: Clade 1 gathering sequences that represents I-1, I-3, I-4 and I-6 sequence variants, including sequences from all studied countries and host plants; Clade 2 comprising I-2 and I-5 sequence variants, all sequences obtained from tomato Brazilian populations. In Clade 1, I-6 haplotype sequences obtained from Italian and Polish populations from tomato and S. nigrum comprise a sub-clade.

The combined analyses (Figure 4) clustered all TRM sequences in one clade, being possible to distinguishing four closely-related sub-clades: Sub-clade 1 clustering specimens from one tomato Brazilian population; Sub-clade 2 clustering Brazilian specimens from tomato and Physalis populations; Sub-clade 3 clustering specimens from Italy and Poland populations collected from tomato and S. nigrum; and Sub-clade 4 clustering specimens from Brazilian populations collected from S. aethiopicum. S. americanum and S. sessiliflorum.

Phylogenetic analysis suggests that TRM sequences constitute one genetic lineage; the sequence diversity observed inside the three fragments was low, predominantly invariant sites. The low observed bootstrap values might account for this lack of information, i.e. due to an insufficient number of informative sites, there is a low possibility to get a tree with strong bootstrap values.

Recently, great advance in the knowledge of genetic aspects of TRM has been made with the availability of its complete genome, and that can now be explored to support the development of control strategies (Greenhalgh et al. 2020). Despite this, so far, there was not any information on the genetic variability or structure of this invasive pest along its occurrence areas. This can be crucial for pest management programs, since populations can develop different bioecological traits, such as host preference, susceptibility to biotic and abiotic stressors and cause different responses in the host plant (Porreta et al. 2007; Remais et al. 2011; Migeon et al. 2021). Furthermore, there were still doubts about the taxonomic status of the taxon as cryptic species could occur among populations associated with different host plants. For the first time, here, these crucial aspects were explored by accessing populations from different continents, and from cultivated and wild solanaceous host plants by novel approach to understanding evolutionary aspects and to support the development of TRM management practices.

TRM confirmed as an oligophagous eriophyid mite taxon

Both genetic diversity and phylogeny showed that TRM studied populations, associated with different solanaceous host plants, are co-specific. The divergence for the mithocondrial and nuclear studied genomic regions among studied populations/haplotypes was even lower than that observed for intraspecific variability in other eriophyid taxa. The highest COI divergence among haplotypes was 0.43% (i.e. < 0.5%) (Table 5). Such distance corresponded with COI intraspecific genetic levels identified by Duarte et al. (2019) for seven Abacarus species (the same tribe that Aculops) in the same gene, e.g., 0.0 to 0.7%. and close that observed by Skoracka et al. (2012) for Aceria tosichella Keifer, 1969 species complex (0.4%). The usual limits of COI intraspecific divergence in more than 13 000 congeneric pairs including representatives from 11 phyla have usually been lower than 2% (Herbert et al. 2003) and most was less than 1% (Avise 2000). Concerning interspecific distances for Prostigmata mites (Eriophyidae sub-order) it has been higher than 4.3% for species in different families (Ros and Breeuwer 2007; Matsuda et al. 2012; Duarte et al. 2019; Pérez-Sayas et al. 2022). Similar results were obtained for the ITS: the average divergence between TRM sequence variants/populations was 0.02% (Table 6), absolutely corresponding to intraspecific distances when in comparison to divergences observed for other eriophyid mites. Duarte et al. (2019) observed ITS intraspecific diversity in Abacarus species ranging from 0.1 to 0.3%, and interespecific distances ranging from 4–17.9%. ITS divergence of 2% have been interpreted as discriminating lineages within A. tosichella populations (Skoracka et al. 2012). In this study, no variability in the nuclear D2 region was observed among the TRM populations, similar to that observed in Abacarus species, which reached 0.3% (Duarte et al. 2019).

Phylogenies, inferred from the three DNA fragments separately and from the Bayesian combined analysis, emphasize the close relationship among the TRM populations studied. The low support to nodes shows that populations cannot be consistently distinguished. Therefore, the hypothesis of the occurrence of cryptic species among TRM populations associated with different host plants was not corroborated for the studied populations.

Although populations from all plants reported as TRM hosts have not been evaluated in this study, the results obtained allow us to confirm that A. lycopersici is an oligophagous eriophyid mite that can infest at least two Solanaceae genera- Solanum (with at least six species) and Physallis.

High majority of eriophyid mites inhabits a single host plant species indicating close host-relationship. According to Skoracka et al. (2010), about 80% of eriophyoid species occupy one host plant species, about 95% infest plant species belonging to one genus, and about 99% to one host family. TRM can be ascribed in 5% of Eriophyoidea mites infesting host plants in two different genera. Further studies including populations from Convolvulus (family Polygonaceae), also reported as a host, should be performed to define if TRM is among the 1% of species that can infest plants in more than one family. The evolutionary and molecular aspects that allow eriophyoid mites to adapt to different host plants could be studied by comparing TRM genome with those of eriophyid mites presenting high host specificity though considering that the whole genome of eriophyoid mites is currently available only for TRM (Greenhalgh et al. 2020).

For many years, Aceria tulipae Keifer, 1938 had been treated as one exceptionally generalist eriophyid. Keifer (1969) and Shevtchenko et al. (1970), showed, that Ac. tulipae found on Liliaceae was, both morphologically and biologically, different from Ac. tulipae inhabiting wheat. As a consequence, a monocot-infesting species Ac. tosichella has been described as a separate taxon from Ac. tulipae inhabiting Liliaceae plants. Species in the Ac. tosichella complex have different host range or preferences (Carew et al. 2009; Skoracka et al. 2012, 2018; Navia et al. 2013), and abilities to transmit plant viruses (Schiffer and Lachmuth 2009; Skoracka et al. 2014; Wosula et al. 2016). Similar observations were made on other supposed generalists inhabiting monocots: Abacarus species (Nalepa, 1896) infesting grasses (Skoracka and Dabert 2010); Trisetacus species infesting conifers (Lewandowski et al. 2014); Retracrus species infesting palm trees and heliconias (Navia et al. 2015). Therefore, many monocot-associated eriophyid mites, previously considered generalists, have showed to constitute complexes of cryptic species. However, the supposed low-specificity in eriophyid mites associated with dicotyledons plants has not been investigated. For instance, no studies investigated the occurrence of cryptic species on Calacarus citrifolii Keifer, 1955, the species with the wider host range of all superfamily reported on 21 plant families (de Lillo and Amrine - Computerized Database for Eriophyoidea, Filemaker Pro). Among species of economic importance, TRM does stand out to be an oligophagous species.

TRM genetic homogeneity in Europe revealing a highly invasive haplotype

Analysis of the diversity of sequences of the COI mitochondrial region showed that haplotype 1 (cH1) is dominant in Brazil, is associated with all host plants considered, and that it is the only one present in European populations (France, Italy, Poland and The Netherlands). The genetic homogeneity among TRM European populations highlights that cH1 is a highly invasive and not host-specific haplotype. This adaptation to infest a high number of plants, which enhances the range of pathways in mites’ transport, certainly has favored TRM invasiveness and wide distribution.

A new introduced population can be composed of a sub-sample of genotypes, from one or several populations in the origin range. No intraspecific variation in the invaded range suggests i) single small initial invasive population, ii) multiple invasions of the same source, or iii) adaptative selection of the haplotype that has been established. The relationship between the success of invasive populations and their genetic diversity has been discussed for a long (Lee 2002; Estoup et al. 2016), by assessing genetic diversity as positive factor influencing survival and adaptation in invaded areas (Lee 2002; Petit et al. 2004; Puillandre et al. 2008). However, absence or low genetic diversity, caused by a population bottleneck, has been reported for many invasive species (Le Page et al. 2000; Sax and Brown 2000; Martel et al. 2004; Novak and Mack 2005; Puillandre et al. 2008), including mites (Navia et al. 2005; Soulignac et al. 2005; Boubou et al. 2012; Dowling et al. 2012) similarly to observed to TRM in this study. These studies suggested that even genetically homogeneous founder populations may retain the ability to respond to natural selection, adapt and expand in the invaded area. In such cases, the success of the invasion has been considered as the ‘genetic paradox of invasions’ (Sax and Brown 2000). For some invasive species, the paradox has showed to be spurious, as seen in introduced populations with low diversity in neutral markers that maintain high genetic variation in ecologically relevant traits. However, in other cases, it can be considered genuine (see Estoup et al. 2016): compensatory mechanisms maybe acting to counter the loss of genetic variation and unique aspects of the species’ biology, as well as environmental interactions that could allow an invasive population to thrive, have been showed or proposed (Estoup et al. 2016; Schrieber and Lachmuth 2016; Eyer et al. 2018; Marin et al. 2019). Further studies need to be conducted to confirm genuine genetic paradox in TRM invasion and to better understanding evolutionary strategies that allowed its invasion success with no genetic variability.

The genetic homogeneity evidenced among TRM European populations do not primarily corroborate the hypothesis that a differentiated host response observed on different host plant species/varieties could be due to the genetic diversity of the associated mite pest. The results suggest that the differentiated symptomatology and damage intensity caused by TRM infestation is due to other biotic or associated abiotic factors related to host plant physiology- e.g. metabolic pathways and mechanisms in plant defense in different hosts (see Glas et al. 2014; Kant et al. 2015), or host response to drought stress, that in some cases can promotes the colonization success of eriophyid mites (Ximénez-Embún et al. 2017).

Towards TRM origin, host adaptation and invasion process

Most of the knowledge about the introduction routes of invasive species is derived from historical and observational data, which are often sparse, incomplete and, sometimes, misleading (Estoup and Guillemaud 2010). This difficulty is remarkable for the tiny eriophyoid mites, for which relevant historical records sometimes are scarce and often incomplete, since they can go unnoticed for a long time and be reported, out of time, when outbreaks occur and in taxonomical confused context (Navia et al. 2010). One such case is A. lycopersici, for which worldwide historical reports and taxonomic mistakes have not been allowed to timely and thoroughly understand its geographic expansion. The mite was described from Australia in 1917 (Tryon 1917); then it was erroneously described as new in 1937 in North Africa (Morocco) (Massee 1937); in 1940s it was for first reported in North America (USA) (Keifer 1940) and in Europe (Spain) (Planes 1941); in 1950s in the Middle East (Lebanon) (Talholk 1950) and in Asia (Georgia) (Tukalevskii and Rogachev 1959) and in the 1960s in South America (Brazil) (Costa and Carvalho 1962) and South Africa (Ryke and Meyer 1960). Another junior synonym of A. lycopersici was described in 2005 in China as Tetra lycopersici Xue and Hong, 2005 (Amrine and de Lillo, personal communication). In this context of historical untraceability patterns genetic data can be explored for tracing invasion routes (Estoup and Guillemaud 2010).

Although the objective of this work was not to trace invasion routes, since a better representation of populations worldwide would be necessary for this purpose, genetic diversity and a phylogeographical analysis based on both mitochondrial and nuclear markers analyzed jointly with the main host plant history corroborate the hypothesis of a South American origin for TRM. In general, the highest genetic diversity for a species occurs in its area of origin. Our results showed a highest TRM genetic diversity in Central Brazil; four haplotypes and five sequence variants were present in the only studied area of Central Brazil while just one haplotype and two ITS sequence variants were present in populations of four European countries. Also, it is interesting to note that the haplotype cH2 was found exclusively associated with non-tomato solanaceous- S. americanum and Physalis- in Brazil.

Under the assumption that tomato does not constitute the original TRM host plant, but some other wild solanaceous plants (Oldfield 1996; Michalska et al. 2010; Navia et al. 2010) and that currently this mite presents a worldwide distribution (CABI 2022) the most likely is that TRM adopted tomato as an alternate host plant in areas of co-occurrence of the original wild host plant and the cultivated tomato ant that this host adaptation occurred before expansion of tomato as a cultivated crop in the 16^th century. The cultivated tomato has its origin in central South America (Blanca et al. 2012, 2015; Razifard et al. 2020), and then it presented a complex domestication history in South America and Mesoamerica (Razifard et al. 2020); by 500 BC, it was already being cultivated in southern Mexico (Smith 1994), and Aztecs raised several varieties of tomato (Townsend 2000). However, expansion of tomato cultivation to other colonies in the Caribbean and to the old continent (firstly Asia and Europe) only occurred at the beginning of the 16th century by Spanish colonizers (Smith 1994). The results of this first study support with genetic data the Neotropical origin of TRM however, it is not possible to know whether the mite was disseminated during the colonization period or afterwards, through the exchange of plant material. Phylogenomic analysis, including populations along wide tomato range in South and Central America from as many wild host plants as possible will enable to enlighten evolutionary history of this intriguing eriophyid mite that became a tomato and solanaceous pest. It is possible that the tomato domestication and breeding process may have unintentionally selected materials with higher susceptible to TRM. Determination of the original TRM host plant, supposedly better adapted to TRM herbivory, may be useful for revisiting breeding programs focusing in resistance.

Acknowledgements

We sincerely thank Mr. José Lindorico de Mendonça, engineer at “Embrapa Hortaliças” (Distrito Federal, Brazil) and manager of the solanaceous bank germplasm, for their valuable contribution with sampling and for providing identification of solanaceous plants collected in the germplasm bank. To João Felipe M. Roriz and Marselle R. Cappssa for their help in the acarological inspection and specimens’ preservation.

Ethical Approval

not applicable

Competing interests

Authors' contributions

D.N, M.E.D, R.S.M conducted field collections in Brazil and M.L and S.S. in Europe; M.E.D conducted laboratory analysis in Brazil; and M.L. in Europe; R.S.M and M.E.D conducted data analysis. D.N, M.E.D, R.S.M and M.L, wrote the main manuscript text; M.E.D and R.S.M prepared figures 1-4. All authors reviewed the manuscript.

Funding

To Foundation for Research Support of the Federal District (FAPDF), Brazil for the fellowship to the first author (MED) (PDJ. Process N°. 193.001.418./2016). To the National Council for Scientific and Technological Development (CNPq), Brazil, for granting the fellowship to the first author (PDJ. Process N°. 158161/2018-1; DTI-A. Process N°. 380382/2020-2 and Process N°. 381542/2020-3 and DCR. Process Nº. 313349/2022-3) and last author (DN) (PP. Process N°. 3121322017-4). To the Brazilian Coordination for the Improvement of Higher Education Personnel (CAPES), National Program of Post-Doctoral in Agronomy, Brazil for the financial support of RSM (CAPES-PNPD/Agronomy Proc. No. 88882.305808/2018-1). To Ministry of Agricultural, Food and Forestry Policies (MIPAAF) and Council for Agricultural Research and Economics (CREA), Italy, for funding RETIBIO (Ministerial Decree 92606, 22/12/2014) and RETIBIO II (Ministerial Decree 95785, 22/12/16).

Availability of data and materials

GenBank https://www.ncbi.nlm.nih.gov/genbank/

Amrine JW Jr, Manson DCM (1996) Preparation. mounting and descriptive study of eriophyoid mites. In: Lindquist EE, Sabelis MW, Bruin J (eds) Eriophyoid mites: their biology. natural enemies and control. World Crop Pests, vol 6. Elsevier, Amsterdam, pp 383–396
Avise JC (2000) Phylogeography. The history and formation of species. Harvard University Press, Cambridge
Blanca J, Canizares J, Cordero L, Pascual L, Diez MJ, Nuez F (2012) Variation revealed by SNP genotyping and morphology provides insight into the origin of the tomato. PLoS ONE 7(10):e48198. https://doi.org/10.1371/journal.pone.0048198
Blanca J, Montero-Pau J, Sauvage C, Bauchet G, Illa E, Díez MJ, Francis D, Causse M, van der Knaap E, Canizares J (2015) Genomic variation in tomato. from wild ancestors to contemporary breeding accessions. BMC Genomi 16(257):1–19. https://doi.org/10.1186/s12864-015-1444-1
Boubou S, Migeon A, Roderick GK, Auger P, Cornuet J-M, Magalhães S, Navajas M (2012) Test of colonisation scenarios reveals complex invasion history of the red tomato spider mite Tetranychus evansi. PLoS ONE 6(4):e35601. https://doi.org/10.1371/journal.pone.0035601
Bouneb M, de Lillo E, Roversi PF, Simoni S (2014) Molecular detection assay of the bud mite Trisetacus juniperinus on Cupressus sempervirens in nurseries of central Italy. Exp Appl Acarol 62:161–170. https://doi.org/10.1007/s10493-013-9733-3
Cabi (2020) Aculops lycopersici (tomato russet mite). Invasive Species Compendium. https://www.cabi.org/isc/datasheet/56111. Accessed 26 June 2007
Celar F, Valič N (2003) Tomato russet mite (Aculops lycopersici) (Tryon. 1917) (Eriophydae) in Slovenia. Anthology of Papers 6th Slovenian Conference on Plant Protection. Zreče. Slovenian. pp 489–492
Carew M, Schiffer M, Umina P, Weeks A, Hoffmann A (2009) Molecular markers indicate that the wheat curl mite, Aceria tosichella Keifer, may be a species complex in Australia. Bull Entomol Res 99:479–486. https://doi.org/10.1017/S0007485308006512
Costa AS, Carvalho AMB (1962) Bronzeado e acronecrose do tomateiro causados por ácaro eriofiídio. Bragantia 21(14):87–89. https://doi.org/10.1590/S0006-87051962000100069
Daiber KC (1985) Tomato pests in South Africa. their potential damage and their control. Horti Sci Ser 200:1–5
Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: more models, new heuristics and parallel computing. Nat Methods 9(8):772
de Lillo E, Craemer C, Amrine JW Jr, Nuzzaci G (2010) Recommended procedures and techniques for morphological studies of Eriophyoidea (Acari: Prostigmata). Exp Appl Acarol 51:283–307. https://doi.org/10.1007/s10493-009-9311-x
de Lillo E, Pozzebon A, Valenzano D, Duso C (2018) An Intimate Relationship Between Eriophyoid Mites and Their Host Plants – A Review. Front Plant Sci 9:1786. http://doi.org/10.3389/fpls.2018.01786
de Oliveira CAL, Eschiapapti D, Velho D, Sponchiado OJ (1982) Quantitative losses caused by the tomato russet mite, Aculops lycopersici (Massee) in field tomato crop. Ecossistema 7:14–18
Douglas AE (2009) The microbial dimension in insect nutritional ecology. Funct Ecol 23:38–47
Dowling AP, Ochoa R, Beard JJ, Welbourn WC, Ueckermann EA (2012) Phylogenetic investigation of the genus Raoiella (Prostigmata: Tenuipalpidae): diversity, distribution, and world invasions. Exp Appl Acarol 57(3–4):257–269. http://doi.org/10.1007/s10493-011-9483-z
Duarte ME, Mendonça RS, Skoracka A, Silva ES, Navia D (2019) Integrative taxonomy of Abacarus mites (Eriophyidae) associated with hybrid sugarcane plants. including description of a new species. Exp Appl Acarol 78:373–401. https://doi.org/10.1007/s10493-019-00388-y
Duarte ME, Mendonça RS, Navia D (2020) Eriophyoid mites (Acariformes) from wild and cultivated Solanaceae plants from Brazil⁠- new taxa, supplementary descriptions, a first report and new host plants of the tomato russet mite. Syst Appl Acarol 25(7):1215–1246. https://doi.org/10.11158/saa.25.7.6
Duso C, Castagnoli M, Simoni S, Angeli G (2010) The impact of eriophyoids on crops: recent issues on Aculus schlechtendali, Calepitrimerus vitis and Aculops lycopersici. Exp Appl Acarol 51:151–168. https://doi.org/10.1007/s10493-009-9300-0
Estoup A, Guillemaud T (2010) Reconstructing the routes of invasion: what for. how and so what. Mol Ecol 19(19):4113–4130. https://doi.org/10.1111/j.1365-294X.2010.04773.xff. ffhal-02667095
Estoup A, Ravigné V, Hufbauer R, Vitalis R, Gautier M, Facon B (2016) Is there a genetic paradox of biological invasion? Annu Rev Ecol Evol Syst 47:51–72. https://doi.org/10.1146/annurev-ecolsys-121415–032116
Eyer P-A, Matsuura K, Vargo EL et al (2018) Inbreeding tolerance as a pre‐adapted trait for invasion success in the invasive ant Brachyponera chinensis. Mol Ecol 27(23):4711–4724. https://doi.org/10.1111/mec.14910
Fenton B, Malloch G, Moxey E (1997) Analysis of eriophyid mite rDNA internal transcribed spacer sequences reveals variable simple sequence repeats. Insect Mol Biol 6:23–32
Glas JJ, Alba JM, Simoni S et al (2014) Defense suppression benefits herbivores that have a monopoly on their feeding site but can backfire within natural communities. BMC Biol 12(98):1–14
Glez-Peña D, Gómez-Blanco D, Reboiro-Jato M, Fdez-Riverola F, Posada D (2010) ALTER: program-oriented conversion of DNA and protein alignments. Nucleic Acids Res 38:14–18. https://doi.org/10.1093/nar/gkq321
Greenhalgh R, Dermauw W et al (2020) Genome streamlining in a minute herbivore that manipulates its host plant. Elife 9:1–45. https://doi.org/10.7554/eLife.56689
Guidolin AS, Fresia P, Cônsoli FL (2014) The Genetic Structure of an Invasive Pest. the Asian Citrus Psyllid Diaphorina citri (Hemiptera: Liviidae). PLoS ONE 9(12):e115749. https://doi.org/10.1371/journal.pone.0115749
Guindon S, Gascuel O (2003) A simple, fast and accurate algorithm to estimate large phylogenies by maxi-mum likelihood. Syst Biol 52:696–704
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and meth-ods to estimate maximum-likelihood phylogenies: assessing the performance of Phyml 3. 0. Syst Biol 59(3):307–321
Hall TA (1999) BioEdit: a user-friendly biological sequence alingnment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98
Haque MM, Kawai A (2002) Population growth of tomato russet mite, Aculops lycopersici (Acari: Eriophyidae) and its injury effect on the growth of tomato plants. J Acarol Soc 11:1–10. https://doi.org/10.2300/acari.11.1
Hebert PDN, Ratnasingham S, de Waard JR (2003) Barcoding animal life: cytochrome c oxidase subunit I divergences among closely related species. Proc R Soc Lond B Biol Sci 270:S96–S99. https://doi.org/10.1098/rsbl.2003.0025
Jeppson LR, Keifer HH, Baker EW (1975) Mites Injurious to Economic Plants. University of California Press, Berkely
Kant MR, Jonckheere W, Knegt B, Lemos F et al (2015) Mechanisms and ecological consequences of plant defence induction and suppression in herbivore communities. Ann Bot 115:1015–1051. https://doi.org/10.1093/aob/mcv054
Keifer HH (1940) Eriophyid studies X. Bull Calif Dept Agr 29:160–179
Keifer HH (1955) Eriophyid Studies B-21. Bull Calif Dept Agr 3:126–130
Keifer HH (1966) Eriophyid Studies B-21.Bull Calif Dept Agr1–20
Kifer HH (1969) Eriophyid Studies C-3. Agric Res Serv US Dep Agric -USDA 1–24
Keifer HH, Baker EW, Kono T, Delfinado M, Styer WE (1982) An illustrated guide to plant abnormalities caused by eriophyid mites in North America. Agric Res Serv US Dep Agric -USDA 573:1–178
Khalighi M, Dermauw W, Wybouw N, Bajda S, Osakabe M, Tirry L, Van Leeuwen T (2016) Molecular analysis of cyenopyrafen resistance in the two-spotted spider mite Tetranychus urticae. Pest Manag Sci 72(1):103–112. http://doi.org/10.1002/ps.4071
Kimura M (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120
Kitamura T, Kawai A (2006) Difference of susceptibility to damage from tomato russet mite Aculops lycopersici (Massee) (Acari: Eriophidae), among varieties within and between species in genus Lycopersicon. Jpn J Appl Entomol Zool 50:57–61
Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33(7):1870–1874. https://doi.org/10.1093/molbev/msw054
Kumral NA, Çobanoğlu S, Tiedt L, Ueckermann E (2014) Domates pas akarının taramalı elektron mikroskobuyla dış morfolojisi ve domatesteki zarar belirtileri. Bitki Koruma Kongresi 5:3–5
Le Page SL, Livermore RA, Cooper DW et al (2000) Genetic analysis of a documented population bottleneck: intro Bennett’s wallabies (Macropus rufogriseus rufo) in New Zealand. Mol Ecol 9:753–763
Lee CE (2002) Evolutionary genetics of invasive species. Trends Ecol Evol 17:386–391
Lewandowski M, Skoracka A, Szydło W, Kozak M, Druciarek T, Griffiths DA (2014) Genetic and morphological diversity of Trisetacus species (Eriophyoidea: Phytoptidae) associated with coniferous trees in Poland: phylogeny. barcoding. host and habitat specialization. Exp Appl Acarol 63:497–520. https://doi.org/10.1007/s10493-014-9805-z
Li HS, Xue XF, Hong XY (2014) Cryptic diversity in host-associated populations of Tetra pinnatifidae (Acari: Eriophyoidea): what do morphometric. mitochondrial and nuclear data reveal and conceal? Bull Entomol Res 104:221–232. https://doi.org/10.1017/S0007485313000746
Liebhold AM, Tobin PC (2008) Population ecology of insect invasions and their management. Annu Rev Entomol 53:387–408
Lindquist EE, Oldfield GN (1996) Evolution of Eriphyoid mites in relation to their host plants. In: Lindquist EE, Sabelis MW, Bruin J (eds) Eriophyoid mites: Their biology. natural enemies and control. World Crop Pests, vol 6. Elsevier, Amsterdam, pp 297–300
Maddison WP, Maddison DR (2016) Mesquite: a modular system for evolutionary analysis Version 3.11. http://mesquiteproject.org. Page RDM. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:357–358
Marin P, Genitoni J, Barloy D, Maury S et al (2019) Biological invasion: the influence of the hidden side of the (epi) genome. Funct Ecol 34(2):385–400. https://doi.org/10.1111/1365-2435.13317ff.. ffhal-02063295f
Martel C, Viard F, Bourguet D et al (2004) Invasion by the marine gastropod Ocinebrellus inornatus in France: I. Scenario for the source of introduction. J Exp Mar Biol Ecol 305:155–170
Massee AM (1937) An Eriophyid mite injurious to tomato. Bull Entomol Res 28(3):403
Matsuda T, Hinomoto N, Singh RN, Gotoh T (2012) Molecular-based identification and phylogeny of Oligonychus species (Acari: Tetranychidae). J Econ Entomol 105:1043–1050
de Mendonça RS, Navia D, Diniz IR, Auger P, Navajas M (2011) A critical review on some closely related species of Tetranychus sensu strict (Acari: Tetranychidae) in the public DNA sequences database. Exp Appl Acarol 55(1):1–23. https://doi.org/10.1007/s10493-011-9453-5
Michalska K, Skoracka A, Navia D, Amrine JW Jr (2010) Behavioural studies on eriophyoid mites- an overview. Exp Appl Acarol 51:31–59. https://doi.org/10.1007/s10493-009-9319-2
Migeon A, Auger P, Fossati O, Hufbauer RA, Miranda M, Zriki G, Navajas M (2021) Can intraspecific variation in an herbivorous mite alter responses to drought-stressed host plant? A common garden experiment in the context of climate change. bio Rxiv. 10.21.465244
.. https://doi.org/10.1101/2021.10.21.465244
Nallu S, Hill JA, Don K et al (2018) The molecular genetic basis of herbivory between butterflies and their host plants. Nat Ecol Evol 2:1418–1427. https://doi.org/10.1038/s41559-018-0629-9
Nalepa A (1896) Neue Gallmilben. (13 Fort.). Anz kais Akad Wiss. Math-Nat Kl 33(10):108–110
Navia D, de Moraes GJ, Roderick G et al (2005) The invasive coconut mite Aceria guerreronis (Acari: Eriophyidae): origin and invasion sources inferred from mitochondrial (16S) and nuclear (ITS) sequences. Bull Entomol Res 95:505–516
Navia D, Ochoa R, Welbourn C, Ferragut F (2010) Adventive eriophyoid mites: a global review of their impact. pathways. prevention and challenges. Exp Appl Acarol 51:225–255. https://doi.org/10.1007/s10493-009-9327-2
Navia D, Mendonça RS, Skoracka A et al (2013) Wheat curl mite,Aceria tosichella, and transmitted viruses: an expanding pest complex affecting cereal crops. Exp Appl Acarol 59(1–2):95–143
Navia D, Ferreira CB, Reis AC, Gondim MGJ (2015) Traditional and geometric morphometrics supporting the differentiation of two new Retracrus (Phytoptidae) species associated with heliconias. Exp Appl Acarol 67:87–121. https://doi.org/10.1007/s10493-015-9934-z
Navajas M, Lagnel J, Gutierrez J, Boursot P (1998) Species-wide homogeneity of nuclear ribosomal ITS2 sequences in the spider mite Tetranychus urticae contrasts with extensive mitochondrial COI polymorphism. Heredity 80:742–752
Novak SJ, Mack RN (2005) Genetic bottlenecks in alien plant species: influences of mating systems and introduction dynamics. In: Sax DF, Stachowicz JJ, Gaines SD (eds) Species invasions: insights into ecology, evolution, and biogeography. Sinauer, Sunderland, pp 201–228
Oldfield G (1996) Diversity and host plant specificity. In: Lindquist EE, Sabelis MW, Bruin J (eds) Eriophyoid mites-their biology, natural enemies and control. World crop pests, vol 6. Elsevier, Amsterdam, pp 199–216
Pautasso M, Dehnen-Schmutz K, Holdenrieder O, Pietravalle S, Salama N et al (2010) Plant health and global change - some implications for landscape management. Biol Rev 85:729–755
Pérez-Sayas C, Pina T, Sabater-Muñoz B, Gómez-Martínez MA, Jaques JA, Hurtado-Ruiz MA (2022) DNA Barcoding and Phylogeny of Acari Species Based on ITS and COI Markers. J Zoolog Syst Evol 22(5317995):1–13. https://doi.org/10.1155/2022/5317995
Perring TM, Farrar CA (1986) Historical perspective and current world status of the Tomato Russet mite (Acari: Eriophyidae). Misc Publ Entomol Soc Am 63:1–19
Petanović R, Kielkiewicz M (2010) Plant-eriophyoid mite interactions: cellular biochemistry and metabolic responses induced in mite-injured plants. Exp Appl Acarol 51(1–3):61–80. http//doi.org/10.1007/s10493-010-9351-2
Petit RJ, Bialozyt R, Garnier-Géré P et al (2004) Ecology and genetics of tree invasions: from recent introductions to quaternary migrations. For Ecol Manage 197:117–137
Planes S (1941) Grave enfermedad del tomate producida por un acaro del genero Phyllocoptes. Bol Patol Veget 10:148–156
Porretta D, Canestrelli D, Bellini R, Celli G, Urbanelli S (2007) Improving Insect pest management through population genetic data: a case study of the mosquito Ochlerotatus caspius (Pallas). J App Ecol 44:682–691
Puillandre N, Dupas S, Dangles O, Zeddam JL, Capdevielle-Dulac C et al (2008) Genetic bottleneck in invasive species: the potato tuber moth adds to the list. Biol Invasions 10:319–333
Razifard H, Ramos A, Valle ALD, Bodary C, Goetz E, Manser EJ, Li X, Zhang L, Visa S, Tieman D, van der Knaap E, Caicedo AL (2020) Genomic evidence for complex domestication history of the cultivated tomato in Latin America. Mol Biol Evol 37(4):1118–1132. https://doi.org/10.1093/molbev/msz297
Remais JV, Xiao N, Akullian A, Qiu DC, Blair D (2011) Genetic assignment methods for gaining insight into the management of infectious disease by understanding pathogen, vector, and host movement. Plos path 7:4
Rice RE, Strong FE (1962) Bionomics of the Tomato Russet Mite Vasates lycopersici (Massee). Ann Entomol Soc Am 55:431–435
Ronquist F, Teslenko M, Van der Mark P et al (2012) MrBayes 3.2: efficient bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61(3):539–542. https://doi.org/10.1093/sysbio/sys029
Ros VID, Breeuwer JAJ (2007) Spider mite (Acari: Tetranychidae) mitochondrial COI phylogeny reviewed: host plant relationships, phylogeography, reproductive parasites and barcoding. Exp Appl Acarol 42:239–262. https://doi.org/10.1007/s10493-007-9092-z
Royalty RN, Perring TM (1988) Morphological analysis of damage to tomato leaflets by tomato russet mite (Acari: Eriophyidae). J Econ Entomol 81(3):816–820
Ryke PAJ, Meyer MKP (1960) South African gall mites, rust mites and bud mites (Acarina: Eriophyidae) of economic importance. S Afr J Agric Sci 3:231–242
Sax DF, Brown JH (2000) The paradox of invasion. Glob Ecol Biogeogr 9:363–371
Schiffer M, Umina P, Carew M, Hoffmann A, Rodoni B, Miller A (2009) The distribution of wheat curl mite (Aceria tosichella) lineages in Australia and their potential to transmit wheat streak mosaic virus. Ann Appl Biol 155(3):371–379. https://doi.org/10.1111/j.1744-7348.2009.00349.x
Schrieber K, Lachmuth S (2016) The Genetic Paradox of Invasions revisited: the potential role of inbreeding × environment interactions in invasion success. Biol Rev 92(2):939–952. https://doi.org/10.1111/brv.12263
Shevtchenko VG, Demillo AP, Razviaskina GM, Kapkova EA (1970) Taxonomic separation of similar species of eriophyid mites, Aceria tulipae Keif. and A. tritici sp. n. (Acarina, Eriophyoidea) - vectors of the viruses of onions and wheat. Zool. Zh. 49: 224–235. In: Internat J Acarol 22(2):149–160 (translated by Amrine Jr. JW 1996)
Skoracka A, Dabert M (2010) The cereal rust mite Abacarus hystrix (Acari: Eriophyoidea) is a complex of species: evidence from mitochondrial and nuclear DNA sequences. Bull Entomol Res 100(3):263–272. https://doi.org/10.1017/S0007485309990216
Skoracka A, Smith L, Oldfield G, Cristofaro M, Amrine JW Jr (2010) Host-plant specificity and specializa-tion in eriophyoid mites and their importance for the use of eriophyoid mites as biocontrol agents ofweeds. Exp Appl Acarol 51:93–113
Skoracka A, Kuczyński L, de Mendonça RS et al (2012) Cryptic species within the wheat curl mite Aceria tosichella (Keifer) (Acari: Eriophyoidea). revealed by mitochondrial. nuclear and morphometric data. Invertebr Syst 26:417–433. https://doi.org/10.1071/IS110 37
Skoracka A, Kuczyński L, SzydłoW, Rector B (2013) The wheat curl mite Aceria tosichella (Acari: Eriophyoidea) is a complex of cryptic lineages with divergent host ranges: evidence from molecular and plant bioassay data. Biol J Linnean Soc 109(1):165–180
Skoracka A, Kuczyński L, Rector B, Amrine JW (2014) Wheat curl mite and dry bulb mite: untangling a taxonomic conundrum through a multidisciplinary approach. Biol J Linn Soc 111(2):421–436. https://doi.org/10.1111/bij.12213
Skoracka A, Rector B, Kuczyński L, Szydło W, Hein G, French R (2014) Global spread of wheat curl mite by its most polyphagous and pestiferous lineages. Ann Appl Biol 165(2):222–235. https://doi.org/10.1111/aab.12130
Skoracka A, Lopes LF, Alves MJ et al (2018) Genetics of lineage diversification and the evolution of hostusage in the economically important wheat curl mite, Aceria tosichella Keifer, 1969. BCM Evol Biol 18(122):1–15. https://doi.org/10.1186/s12862-018-1234-x
Smith AF (1994) The tomato in America: early history, culture, and cookery. University of South Carolina Press, Columbia
Solignac M, Cornuet JM, Vautrin D et al (2005) The invasive Korea and Japan types of Varroa destructor. ectoparasitic mites of the Western honeybee Apis mellifera. are two partly isolated clones. Proc R Soc B Biol Sci 272:411–419
Song Z-W, Xue X-F, Hong X-Y (2011) Eriophyid mite fauna (Acari: Eriophyoidea) of the Tibet Autonomous Region. southwestern China with descriptions of six new species. Internat J Acarol 37(5):367–390. https://doi.org/10.1080/01647954.2010.519723
Staden R, Beal KF, Bonfield JK (2000) The Staden package, 1998. Methods Mol Biol 132:115–130
Stout MJ, Workman KV, Duffey SS (1996) Identity, spatial distribution, and variability of induced chemical responses in tomato plants. Entomol Exp Appl 79:255–271. http//doi.org/10.1111/j.1570-7458.1996.tb00834
Talhouk AS (1950) A list of insects observed on economically important plants and plant products in Lebanon. Bul Soc Fouad Entomol 34:133–141
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30(12):2725–2729. https://doi.org/10.1093/molbe v/mst19 7
Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting. position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22(22):4673–4680
Townsend RF (2000) The Aztecs. Thames and Hudson, London
Tryon H (1917) Report of the Entomologist and Vegetable Pathologist.Queensl Dep Agric St Rep49–63
Tukalevskii IM, Rogachev VL (1959) A new pest of tomato and potato in the south of the Ukraine. Zashch Past Vredit Bolezn 5:54
Wosula EN, McMechan AJ, Oliveira-Hofman C, Wegulo SN, Hein G (2016) Differential transmission of two isolates of Wheat streak mosaic virus by five wheat curl mite populations. Plant Dis 100(1):154–158. https://doi.org/10.1094/PDIS-03-15-0342-RE
Ximénez-Embún MG, Glas JJ, Ortego F, Alba JM, Castañera P, Kant MR (2017) Drought stress promotes the colonization success of a herbivorous mite that manipulates plant defenses. Exp Appl Acarol 73:297–315. https://doi.org/10.1007/s10493-017-0200-4
Xue X-F, Hong X-Y (2005) Five new species of the genus Tetra Keifer (Acari: Eriophyoidea) from China. Zootaxa 1067:46–47
Xue X-F, Hong X-Y (2006) Eriophyoid mite fauna from Henan Province. central China (Acari: Eriophyoidea) with descriptions of five new species. Zootaxa 1204:1–30. https://doi.org/10.11646/zootaxa.1204.1.1
Yu SJ (2008) The toxicology and biochemistry of insecticides. CRC Press, London

No competing interests reported.

Download PDF

Journal Publication

published 16 Feb, 2023

Read the published version in Experimental and Applied Acarology →

Version 1

posted

You are reading this latest preprint version

Genetic diversity of the tomato russet mite supporting oligophagy and evidencing widespread of an invasive haplotype

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Material & Methods

Sampling

Molecular Studies

DNA extraction, amplification, and sequencing

Sequences, Genetic Diversity, And Phylogenetic Analyses

Results

Discussion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1