Wax Metabolism is involved in Response to Alternate Freeze-thaw Stress to Regulate Shoot Shriveling

doi:10.21203/rs.3.rs-2242406/v1

Download PDF

Research Article

Wax Metabolism is involved in Response to Alternate Freeze-thaw Stress to Regulate Shoot Shriveling

https://doi.org/10.21203/rs.3.rs-2242406/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Shoot shriveling is one of the main challenges for apple (Malus×domestica) growth and productivity. Cuticular wax plays a critical role in plant resistance. In this study, branches of 'Asi' and 'Miyazaki' with different overwintering characters were selected, and a series of physiological indicators were measured. The results showed that shoot shriveling rate of 'Miyazaki' was 2.31 times than 'Asi', the critical water content of 'Asi' was higher than 'Miyazaki'; In freeze-thaw alternate phase of 'Asi', the activities of starch phosphorylase (SP) and amylase (Amy) was 1.54 and 1.2 times that of 'Miyazaki', the relative conductivity (REC) and Proline (Pro) were 0.89 and 0.65 times that of 'Miyazaki'. The wax content of the two varieties in the freezing-thawing phase decreased to 41.84% and 60.63%, respectively, 'Asi' wax was tightly distributed and wax components was much diversify than 'Miyazaki'. The correlation analysis showed that the wax content was positively correlated with the water content and negatively correlated with shoot shriveling rate. Subsequently, eleven wax-related genes were selected for expression to verify their reliability. Under freeze-thaw stress, the expression of CER1 dramatically increased, and the expression of KCS1, CER3 and WIN1 increased firstly and then decreased with the elongation of stress time. Compared with the sensitive shriveling 'Miyazaki', the anti-sensitive shriveling 'Asi' strengthens its overwintering by containing higher water content, triggering the expression of CER1, CER3, WIN1 and other genes, enriching its waxy components, increasing the content of osmotic adjustment substances, and improving the water retention performance during the overwintering process.

Shoot shriveling

Critical water content

Wax metabolism

Apple

Apple (Malus×domestica), with its attractive appearance and pleasant taste, has become an important component of the human diet, apple production in china is mainly distributed in the northwest Loess Plateau, the route of the Yellow River, Bohai Bay and other places. Although the apple industry develops year after year, abiotic and biotic stresses seriously limit the yield of apple. Shoot shriveling caused by strong evaporation in early spring seriously threats fruit production in the dry and cold areas of northern China (Yin et al. 2002). In recent years, the threat is getting worsen with global warming. Hence, more attention to this phenomenon and the mechanism to avoid its occurrence have become a research hotspot, a thorough understanding of apple responses to shoot shriveling is necessary for the development of shoot shriveling-tolerant cultivars.

It has been widely accepted that shoot shriveling is caused by less water absorption of root and more evaporation of branches which caused water unbalance through winter (González and Ayerbe 2010). During the overwintering phase, root system were frozen or thawed slowly due to the low ground temperature, which affects water absorption (Yang et al. 2020). Studies indicated that the degree of development of protective tissues such as the cuticle and cork of branches, the content of proline, relative conductivity, and the activity of branch enzymes could effectively prevent the loss of water (Agopian et al. 2011). The investigation revealed that various trees display different degrees of shoot shriveling due to the different critical water content, such as blueberry (Kikuchi and Masuda 2009), pears and walnut (Cheng et al. 2014). Additionally, there are obvious differences in the shoot shriveling rate between different varieties of the same species (Senadheera et al. 2009).

The aerial surfaces of land plants are coated with a cuticle comprised of cutin and wax, which is a hydrophobic barrier for preventing uncontrolled water loss and environmental damage (Jee et al. 2007). Studies exhibited that cuticular wax plays a pivotal role in plants’ resistance to both biotic and abiotic stresses. Cuticular wax is a complex mixture of the fatty acids and their derivatives (Kunst et al. 2003), such as primary alcohols, aldehydes, alkenes, branched alkanes, secondary alcohols, unsaturated fatty alcohols, ketones, wax esters, and cyclic compounds (Gutiérrez et al. 2021). The morphology of wax crystal structure and content are affected by the chemical composition of wax (Li et al. 2022), plant growth, development stage and environmental conditions (Koch et al. 2006). For example, the wax content of rape (Brassica napus) leaves is as high as 29.4 µg·cm^-2, the main component is alkanes, followed by ketones, while the wax content of corn (Zea mays) leaves is 8.2 µg·cm^-2, and the main component contains primary alcohols, followed by aldehydes (Javelle et al. 2010); In the same plant, studies have found that the microscopic morphological structure of waxy crystals of different species also exhibit difference under the same external environmental stress (Premachandra et al. 1991). Studies have shown that wax affects the drought resistance (Kosma et al. 2010),and there is evidence that the total amount of wax and long-chain alkanes per unit area of rose leaves increased under drought stress (Ahmad et al. 2021); Javelle revealed that wax can enhance the drought resistance of plants by increasing photosynthetic efficiency and slow down the decline of leaf water potential (Javelle et al. 2010); The studies show that plant epidermal wax can effectively reduce water loss rate (Riederer and Schneider. 2007). There are significant differences in the thickness of the waxy layer on the proximal and abaxial surfaces of Populus euphratica leaves, the fusion of waxy crystals, and the morphological structure of the waxy crystals in different regions under the same dry and wet conditions from Viskari’ report (Viskari 2000). Previous studies especially focused on the influence of wax content on plant stress resistance, but with the advancement of research, it has been found that wax structure and composition are the key factors determining plant stress resistance (Oliveira et al. 2003). In addition, there have fewer reports on the study of wax microstructure and component analysis (Cameron et al. 2020).

We observed that there is a significant difference in shoot shriveling rate between different apple varieties during the production. The 'Asi' apples with regional characteristics in Gansu are not sensitive to shoot shriveling, while the 'Miyazaki' apples, the main cultivated varieties of Gansu, are prone to shoot shriveling severely with a high fatality rate. However, there is no report on the research of mechanism about the physiological properties of preventing shoot shriveling. Hence, exploring the shriveling mechanism of 'Asi' and 'Miyazaki' in response to freeze-thaw alternation have a great significance to the formulation of cultivation measures and the cultivation of new varieties.

Material handling and index determination

The test material was collected from Rongsheng Farm, Bahutai, Huazhuang Town, Honggu District, Lanzhou City, Gansu Province (N 36°23', E 103°12'). With an altitude of 1600–1750 m. It belongs to the northern temperate continental arid climate with an average annual precipitation of 350 mm and a minimum temperature of -15℃ in winter, with large temperature difference and little precipitation. This experiment adopted a single-factor completely randomized design, the annual 'Asi' and 'Miyazaki' branches were used as the test materials. The samples were collected on November 25, 2020 (4 ℃ / -4 ℃), December 24, 2020 (4 ℃ / -10 ℃), January 25, 2021 (5 ℃ / -9 ℃), February 25, 2021 (15°C/-1°C) and March 25, 2021 (18°C/5°C), and were named as initial dormancy, middle dormancy, deep dormancy, freeze-thaw alternation and germination according to temperature characteristics and growth and development characteristics of tree organs. When sampling, 5 branches of the current year were selected from the middle canopy layer of the test tree with similar growth and no pests and diseases in the same direction, and 90 branches with a branch length of more than 10 cm (cutting wax seal) were brought back to the laboratory for use in subsequent index determination.Rinse some of the harvested branches (about 30) with clean water and deionized water 3 times, then dry the surface water with clean gauze and randomly group them to determine various physiological indicators. Amylase (Amy) was determined by 3,5-dinitrosalicylic acid method (Hong et al. 2020), Star phosphorylate (SP) activity was determined by inorganic phosphorus colorimetric method (Achuba et al. 2015), Relative conductivity (REC) was determined by conductivity meter method (Zhao et al. 2019), Proline (Pro) determined with reference to Wang method (Wang et al. 2021).

Determination of Critical Water Content of 'Asi' and 'Miyazaki' Branches

Firstly, determine the initial moisture content of each material (42.37% for 'Asi' and 40.38% for 'Miyazaki') refer to Demirbas (Demirbas 2004). 5 moisture content gradients respectively were set according to its initial moisture content, namely CK, 40%, 35%, 30% and 25%, use an electric heating constant temperature drying oven to lose water at room temperature, and measure the quality of branches every 3 to 5 hours. When the branches reach the set water content, they are placed indoors for hydroponic culture, the hydroponic branches change water every 5 days. Count the shoot shriveling rate and sprout conditions of the branches. Branches that sprout without spreading leaves are considered shoot shriveling, 3 replicates are set for each test.

Scanning Electron Microscopic Observation of the Wax Quality of the Cuticle of 'Asi' and 'Miyazaki' Branches

Take the skin of the middle part of the branches to make a sample with a diameter of about 5 mm and a thickness of about 0.5 mm. The sample is cooled with liquid nitrogen and transferred to a freeze dryer, and then sprayed with gold using JFC-1600 ion sputtering instrument, and finally scanned with cryo-scanning electron microscope Observed by electron microscope.

Determination of the waxy components and contents of the stratum corneum

The stem segments of the sample branches were cleaned with distilled water until there was no foreign body on the surface. After drying, several round epidermal samples with a diameter of 1.1cm were taken with a round hole punch. The sample was put into 30 mL chloroform extract and removed immediately after 30 s. A single chloroform bath was performed for each replicate using a 50 mL Erlenmeyer flask, with the addition of 10 µg of tetracosane as the internal standard. Additionally, 5 mL of chloroform was added to the original Erlenmeyer flask in order to wash off any waxes that were stuck onto the wall of the flask. Both extractants were mixed well and transferred to 15 mL testing tubes, followed by a drying step under the nitrogen stream (LABCONCO® RapidVap Vertex Dry Evaporator, USA) at 45 ◦C. The dried samples were stored at − 30 ◦C until further analysis.

Dried waxes were resuspended into 500 µL of chloroform and transferred into a 2 mL amber vial (Agilent Technologies Inc., USA). After the chloroform was totally evaporated by the nitrogen stream (at 45 ◦C), an aliquot of 100 µL of pyridine and 100 µL of BFSTA + TMCS (99:1) was added into the vial for silylation of hydroxyl and carboxylic acid groups, at 80 ◦C for 1 h. After drying under the nitrogen stream and the heating block, the samples were reconstituted by 500 µL of chloroform for GC-MS analysis.

For GC-MS analysis, a sample volume of 1 µL was injected into an Agilent Technologies 6890N (G1530N) GC using an Agilent Technologies J&W DB-1ms column (122–0132) with 30 m length, 250 µm diameter, and 0.25 µm film thickness. The GC used a pulsed splitless mode with a constant gas flow of helium and the following program: 45 ◦C for 2 min; ramp 45 ◦C min^-1 to 210 ◦C; hold 1 min; ramp 5 ◦C min^-1 to 340 ◦C; hold for 24 min. The separated peaks were detected using an Agilent Technologies 5975 inert XL Mass Selective detector. The GC-MS data were analyzed with Agilent Technologies MSD ChemStation E.01.01.335. Separated peaks were identified by comparing their fragmentation patterns with the Wiley Chemical Compound Library (W7N05.L, Agilent Technologies Inc., USA) and comparing their fragmentation patterns and retention time with authentic standards. Quantification was obtained by the construction of calibration curves of one representative standard for each class of compounds and using the internal standard (tetracosane) method. Hexacosane, hexacosanoic acid, hexacosanol, hexacosanal, and behenyl palmitate were used as representative standards for alkanes, fatty acids, primary alcohols, aldehydes (and β-diketones), and esters, respectively. The content of each substance is quantified according to its corresponding true standard, the quantitative calculation was performed using an external standard and the area normalization method. The content of cuticular waxes of each sample was expressed in terms of wax (mg) per surface area (cm²) extracted. Each sample was analyzed three times.

Screening differential genes(DEGs) related to wax synthesis and metabolism by transcriptome

To elucidate the mechanism of wax resistance in response to freeze-thaw alternation in different cultivars, annual 'Asi' and 'Miyazaki' shoots were selected for transcriptome analysis, starting from the early dormancy (after leaves completely dropped), deep dormancy and freeze-thaw periods. To ensure data reliability, three replicates of each sample were sequenced. Index-encoded samples were clustered on the cBot Cluster Generation System (Illumina) using the TruSeq PE Cluster kit v3-cBot-HS. After cluster generation, library preparations were sequenced on the Illumina Hiseq 4000 platform. Clean data is obtained by removing reads containing adapters, reads containing ploy-N, and low-quality reads from the raw data. GO and KEGG enrichment analysis of DEG was performed by the Omicshare online program (https://www.omicshare.com/tools/), and GO terms with corrected p < 0.05 were considered to be significantly enriched for DEG. The DEGs detected by the transcriptome were subjected to GO and KEGG enrichment analysis.The screening condition takes P ≤ 0.05 as the threshold, and satisfying this condition is significant enrichment. Then, GO functional enrichment was used to clarify the biological functions involved in the differentially expressed genes, and the KEGG metabolic pathway was used to identify the main biological metabolic pathways involved in the screened differentially expressed genes.

Expression characteristics of wax-related genes under alternating freeze-thaw stress

In this study, 11 genes were selected from the relevant differentially expressed genes for real-time quantitative PCR analysis, and high-throughput data were detected. The experiment was set up with three biological replicates. The material used for qRT-PCR analysis is as described above, the total RNA was extracted using the Plant RNA Kit (TaKaRa) following standard protocol. Before reverse transcription, about 1–2 µg total RNA was treated with gDNA Eraser to remove genomic DNA, and then the first-strand cDNA was synthesized by PrimeScript RT Enzyme Mix I (TaKaRa) according to the manufacturer’s instruction. Finally, the products were diluted 10-fold with sterile distilled water.

Quantitative real-time PCR was carried out by using an ABI StepOnePlus instrument (Applied Biosystems). Each reaction volume of 20µl contained 10.0µl TB Green Ⅱ, 2.0µl cDNA, 2.0µl 10µM forward primer, 2.0 µl 10 µM reverse primer, and 6.0µl ddH2O. The PCR cycle used was as follows: 95°C for 1 min, 40 cycles of 95°C for 15s, 58°C for 30s, and 72°C for 45s. Data were collected during the extension step. Dissociation curve analysis was performed as follows: 95°C for 15s, 60°C for 1min, and 95°C for 15s. Specific primers of genes were listed in Table 1. MdActin gene was selected as an endogenous control. The samples were repeated 3 times. Finally, use 2^-∆∆CT to calculate the relative expression of genes. The single factor analysis method of SPSS software was used to analyze the significance of the difference.

Table 1

qRT-PCR primer sequence
Gene name	Sequence(5’-3’)
MdActin	F:TGAGGGCAAGGTGAAGGGTATCTT R:TCAAGTCAACCACACGCGTACTGT
AMTI	F:ATCTTCTTCCATCTCTACCCTCCCATC R:TTCTGTTCATGTTCATTTGTGCATCCC
WIN1	F:CGGCTCACACATCACAAATACATCAAC R:TGGATTGGAATGAAGGCACTGGAAC
CER1	F:GGCTCTCAAAATCATTTCCGCTCTTG R:TTCCTCGGCACTAAGTTGGCATTC
KCS1	F:AGTTGAGCTTCACTGGGCAAGATTC R:GCCGTTGTCAGAGCTAACACCTTC
CER6	F:GAACTGATTGGAAAGCTCGGAAACATC R:GCGAGTTCAACGGAGTGCTGTAG
NE2	F:GCTTCGGCTCCTTCTTCTACTCAAC R:TTTCTGGCAACAATCGGGTCCTTC
MYB96	F:ACGGACGACACATCATCAGAAACAG R:AACGGAGACACGATTGGTTGAAGG
KCR1	F:GTGTGAGAGAGTGAAAGAAGCAAGAATG R:ACATCCAAGGAAGCGAGTTCAAGTAC
CER3	F:ACCCTTCATCTTCTTTCCTCCCAATTTC R:TAGACTTCTTGATTGACGGTGGTGTTAC
LACS2	F:CTGACATAGAAGTGACAATGGTGGAGAG R:ACAACATTGAGATGGAGAACGGTAAGG
LTPG1	F:CGAATACGATGAGTTTGGACCACCTAG R:TTAAGCCGTTTCCCATCACAATCCC

Data processing

Origin 8.0 was used for data processing and graphing, and SPSS 22.0 was used for variance analysis and principal component analysis. Statistical analysis were performed by LSD of one-way ANOVA to compare the significance of differences between treatments (α = 0.05).

The shoot shriveling rate of 'Asi' and 'Miyazaki'

It can be seen from Fig. 1 that there are differences in the shoot shriveling rate between 'Asi' and 'Miyazaki. The shoot shriveling rate of 'Miyazaki' is higher compared to 'Asi', and 2.31 times that of the 'Asi'.

The relationship between the critical water content of 'Asi' and 'Miyazaki' and the shoot shriveling

Table 2

The relationship between the water content of 'Asi' and 'Miyazaki' and the shoot shriveling
Varity	Initial water content	Set water content	Shoot shriveling rate (%)	Germination rate (%)
		42.37%	0.00 ± 0.00d	100.00 ± 0.00a
		40%	0.00 ± 0.00d	100.00 ± 0.00a
'Asi'	42.37%	35%	14.29 ± 0.16c	85.71 ± 0.76b
		30%	57.14 ± 0.42b	42.86 ± 0.51c
		25%	100.00 ± 0.00a	0.00 ± 0.00d
		40.38%	0.00 ± 0.00e	100.00 ± 0.00a
		40%	16.67 ± 0.13d	83.33 ± 0.51b
'Miyazaki'	40.38%	35%	50.00 ± 0.25c	50.00 ± 0.28c
		30%	83.34 ± 1.3b	16.66 ± 0.14d
		25%	100.00 ± 0.00a	0.00 ± 0.00e

Note: Different small letters of the same column indicate significant difference among different treatment at P < 0.05 level.

It can be seen from Table 2 that the germination rate of the two branches without any treatment is above 83%. After the water content of the branches dropped to 35%, the germination rate of 'Asi' was reduced, but it was still above 83%, while the germination rate of 'Miyazaki' dropped to 50%. At this time, the shoot shriveling rate of both branches increased. When the water content of the branches drops to 30%, the germination rate of 'Asi' is 42.86%, while the 'Miyazaki' drops to 16.66%, and the occurrence rate of shoot shriveling is as high as 83.34%. When the water content of the branches drops to 25%, the branching rate of 'Asi' and 'Miyazaki''s branches is as high as 100%. The above results show that the critical moisture content of 'Asi' and 'Miyazaki''s shoot shriveling is 30%~35%.

Changes in wax content of branches during overwintering

It can be seen from the Fig. 2 that during the wintering process of the branches of the two apple varieties, the wax content showed a continuous decline, and the content and the decline range display discrepancy. The wax content of 'Asi' is higher than that of 'Miyazaki'. Compared with the initial dormancy phase, the wax content of 'Asi' and 'Miyazaki' in the freezing-thawing phase decreased to 41.84% and 60.63%.

Changes in waxy morphology and epidermal structure of branches

It can be seen from Fig. 3 that the waxy and epidermal morphology of 'Asi' and 'Miyazaki' show significant difference. In terms of waxy morphology, the waxy morphology of 'Asi' is acicular and densely distributed, while the 'Miyazaki' waxy morphology is lumpy and scattered. Additionally, it can be seen from the morphology of the epidermis that the arrangement of the epidermal cells of 'Asi' is different from that of 'Miyazaki'. 'Asi' branches have regular and smooth epidermis distribution, with large intercellular spaces between surface cells, while 'Miyazaki' branches have loose epidermal structures and rough surfaces.

Changes in waxy components of branches

The GC-MS technique was used to identify the wax components of the cuticle of 'Asi' and 'Miyazaki' branches. The results showed that aliphatic and aromatic components were detected in the two branches (Fig. 4), including alkanes, aliphatic acids, aliphatic alcohol, aliphatic aldehyed, alkanes, esters, triterpenes, amines and benzene et. Through the quantitative analysis of each component (Table 3), it can be known that the content of aliphatic alcohol in each component is the highest, which is 395.58µg/cm² ('Asi') 243.67µg/cm² ('Miyazaki'), amines were the least, 5.25µg/cm² ('Asi') and 11.83µg/cm² ('Miyazaki'). From the overall point of view, 'Asi' wax components are mostly higher than 'Miyazaki'.

After identifying the obtained GC-MS peak spectrum by spectral library search (Table 4), under similar retention times(RT), the wax components of 'Asi' and 'Miyazaki' are not exactly the same, for example, the wax component is C15H32O4Si2 ((tert-butyloxy)-2,4-bis[(trimethylsilyl)oxy]-1,3-5-butadienyl methyl ether), the RT of 'Asi' was 7.9097, while that of 'Miyazaki' was 7.9095. 'Asi' When the RT is 23.7513, the compound is n-Eicosane, and when the RT of 'Miyazaki' is 23.7508, the present compound is octamethylcyclotetrasiloxane. Therefore, we can conclude that the wax component is an important factor affecting the overwintering of the tree.

Table 3

Wax fraction content of the epiddermis of 'Asi' and 'Miyazaki' branches and carbon atomic distribution
component	'Asi' (µg/cm2)	'Miyazaki' (µg/cm2)
Aliphatic Acids	25.95e	17.95f
Aliphatic alcohol	395.58a	243.67a
Aliphatic aldehyed	105.32c	89.54c
Alkanes	127.04b	109.25b
Esters	46.03d	24.59d
Triterpenes	70.50d	52.14d
Amines	5.25f	11.83ef
Benzene	25.41e	34.51e

Note:Different lowercase letters in the same column represent significant differences in the content of different wax components of the same variety at the 0.05 level (P < 0.05). The first column represents the classification of waxy components obtained by GC-MS spectral analysis of 'Asi', the second column represents the specific content of each waxy component. Subsequent column numbers represent the classification of waxy components, the specific content of each waxy component, and the carbon number of the waxy component compound distribution obtained by 'Miyazaki' through GC-MS spectral analysis.

Table 4

GC-MS waxy part of the map compound
'Asi'			'Miyazaki'
RT	Chemical formula	Compound name	RT	Chemical formula	Compound name
5.7981	C10H8N2	2,2'-Bipyridine	5.2176	C8H24O2Si3	octamethyl-Trisiloxane
7.9097	C15H32O4Si2	(tert-butyloxy)-2,4-bis[(trimethylsilyl)oxy]-1,3-5-butadienyl methyl ether	7.9095	C15H32O4Si2	4-(tert-butyloxy)-2,4-bis[(trimethylsilyl)oxy]-1,3-butadienyl methyl ether
9.2473	C17H34O2	Methyl hexadecanoate	10.8833	C19H40O2Si	Palmitic acid trimethylsilyl ester
10.8835	C19H40O2Si	Palmitic acid trimethylsilyl ester	14.2404	C21H44O2Si	Octadecanoic acid,trimethylsilyl ester
14.2497	C21H44O2Si	Octadecanoic acid,trimethylsilyl ester	17.3115	C24H50	N-TETRACOSANE
17.3119	C24H50	N-TETRACOSANE	19.4285	C23H48O	1-Tricosanol
20.6007	C25H54OSi	Hexyl(nonadecyloxy)silane	23.7508	C8H24O4Si4	octamethylcyclotetrasiloxane
23.7513	C20H42	n-Eicosane	25.9120	C16H50O7Si8	1,15-Dihydrogenhexadecamethyloctasiloxane
28.0461	C27H56	n-Heptacosane	28.0953	C28H58	n-Octacosane
32.1972	C27H56	2-Methyl-n-hexacosane	32.1912	C14H24O3Si2	m-(Trimethylsilyloxy)phenylacetic acid trimethylsilyl ester
38.0954	C33H58OSi	3-tert-Butyldimethylsilyl-20-dehydro Cholesterol	34.9661	C12H38O5Si6	Hexasiloxane, 1,1,3,3,5,5,7,7,9,9,11,11-dodecamethyl-
42.7059	C33H56O2Si	(20R)-3β-(tert-butyldimethylsilyl)oxycholest-5-en-22-yn-20-ol	38.0451	C33H58OSi	3-tert-Butyldimethylsilyl-20-dehydro Cholesterol
44.7182	C8H24O4Si4	octamethylcyclotetrasiloxane	42.6998	C36H64O3Si2	Octadecanoic acid,(4-hydroxyphenyl)-, dodecyl ester
49.7100	C8H24O4Si4	octamethylcyclotetrasiloxane	45.9283	C36H64O3Si2	Octadecanoic acid,(4-hydroxyphenyl)-, dodecyl ester

Note: The first column of data in the table represents the retention time (RT) corresponding to each peak of the GC-MS spectrum of 'Asi', and the second column corresponds to the RT corresponding to the peak of the GC-MS spectrum of the first column of 'Asi' The molecular formula of the compound, the noun of the compound component in the third column corresponds to the chemical formula in the second column. The subsequent columns represent the RT corresponding to the peak of the GC-MS spectrum of 'Miyazaki', the molecular formula and the name of the compound corresponding to the retention time.

Transcriptome differential genes and metabolic pathway enrichment

In the transcriptome differential gene analysis, the total number of up-regulated genes was not much different, and the down-regulated genes were slightly more than the up-regulated genes (Fig. 5-a). The overwintering shooting shriveling rate of apples is closely related to wax synthesis and metabolism. In the wax synthesis pathway, the down-regulated genes were significantly more than the up-regulated genes, and the down-regulated genes were 1.6 times higher than the up-regulated genes (Fig. 5-b). Through KEGG pathway analysis, it can be seen that the wax metabolism pathway is significantly enriched. As shown in Fig. 5-c, C16 palmitic acid can form 16 by inducing the expression of CYP86A4, CYP704B1, and 1.1. -Hydroxypalmitate, 16-oxalate palmitate and hexadecanedioate, etc., can also form 10,16-dihydroxypalmitate under the action of CYP77A6. C18 oleic acid can pass 1.14.1480, 1.1.- .-Isogene expression to form Octadec-9-ene-1,1-dioic-acid. In addition, the expression of different genes was different at different periods. For example, CYP86A4 and CYP77A6 showed down-regulated expression in early dormancy and deep dormancy, but up-regulated expression in germination. However, CYP94A1 was down-regulated in deep dormancy and germination. Therefore, the expression of these differential genes provides the basis for the subsequent study of wax.

Expression analysis of wax synthesis related genes

A variety of genes are involved in the process of wax biosynthesis and metabolism. According to the transcriptome statistics report, the differential genes with higher expression levels were screened by Pvalue value. In this study, we selected 11 differentially expressed genes binding wax metabolism-related pathways from the transcriptome for further verification, namely AMT1, WIN1, CER1, KCS1, CER6, NE2, MYB96, KCR1, CER3, LACS2, LTPG1. Real-time fluorescence quantitative analysis of wax synthesis-related genes revealed that most genes rise first and then fall with the extension of the overwintering phase, except for CER6 and TPG1. Meanwhile, most genes have the highest expression levels during the freeze-thaw cycle(Fig. 6). The transcriptional regulator was WIN1/SHN1, an AP2-EREBP-type transcription factor, that activates cuticular wax biosynthesis by up-regulation of KCS1 and CER1 genes to directly control the expression of the LACS2 gene involved in cutin biosynthesis and indirectly regulate cuticular wax deposition. Among them, CER1 and CER3 encode the synthesis of alkanes, LCS2 controls the length of the carbon chain, and LTPG1 is responsible for the transportation of wax. In real-time fluorescence quantification, CER1, CER3 and LACS2 showed a trend of first rising and then falling, while LTPG1 showed a continuous upward trend with the extension of the wintering phase. It was found that the expression trend of each gene was consistent with the corresponding folding curve.

Biosynthesis Pathway of Cuticular Wax

In order to characterize the complex processes related to wax metabolism in the transcriptome, the analysis of the major pathways of differential gene enrichment showed that,The “Fatty acid elongation (mdm00062)”, “Cutin, suberine and wax biosynthesis” (mdm00073)”, “Fatty acid degradation (mdm00071)”, “wax biosynthetic process(mdm00025)”, “cutin biosynthetic process(mdm00043)” categories were significantly enriched (Fig. 7-a).

Based on transcriptomic metabolic pathway enrichment and differential gene expression verification, and combined with previous studies, we prepared a waxy anabolic pathway (Fig. 7-b). It mainly involves CER1 (MD02G1226900), CER3 (MD13G1273200), KCS1 (MD01G1087400), KCR1 (MD10G1021200), Synthetic genes such as LACS2 (MD05G1070800) and regulators such as MYB96 (MD17G1261000), it lays a foundation for further study of wax gene.

Changes of Amy and SP during the Overwintering of Branches

With the extension of the overwintering phase, the SP activity of the two apple branches increased first and then decreased, and the SP activity of 'Asi' was always higher than that of 'Miyazaki' in the same phase. The two kinds of apple branches reach the maximum during the deep dormancy phase, and they are 0.0195mg.g^-1.h^-1FW ('Asi') and 0.0165mg.g^-1.h^-1FW ('Miyazaki'). The SP activity of 'Asi' is 'Miyazaki' 1.18 times.

As shown in Fig. 8, the Amy activity of the two apple branches showed a increased first and then decreased trend and the difference was significant with the extension of the overwintering phase. From the early overwintering phase to the nutrient transition phase, the activity of 'Asi' Amy was higher than that of 'Miyazaki'.

Changes of Proline content and relative conductivity of branches during overwintering

It can be seen from Fig. 9 that with the extension of the overwintering phase, the REC content of branches first increased and then decreased, and the difference was significant. During the whole wintering phase, the REC content of 'Miyazaki' branches was always higher than that of 'Asi', and the two kinds of branches reached the maximum (138.06) and (182.33) during the deep dormancy ('Asi') and the freeze-thaw cycle ('Miyazaki'). Compared with the initial dormancy phase, the REC content of the two branches at germination decreased by 6.96% ('Miyazaki') and 14.39% ('Asi'). It can be clearly seen that the strain with weak anti-shrinking ability has a higher conductivity value than that with strong anti-shriveling ability, indicating that the relative conductivity is also a good indicator for detecting the anti-shriveling performance of the branches.

The Pro content of the two branches increased first and then decreased with the extension of the overwintering phase, and the Pro of 'Miyazaki' branches was always higher than that of 'Asi' (Fig. 9). The Pro content of the two branches reached the highest value during deep dormancy, which were 43.26 mg·g^-1 ('Miyazaki') and 38.03 mg·g^-1 ('Asi'), and then began to decline. Compared with the early overwintering phase, the Pro content of the two branches at germination increased by 7.39% ('Miyazaki') and 14.42% ('Asi').

Correlation analysis of wax metabolism and shoot shriveling

Correlation analysis was performed on 8 indicators of wax metabolism by using SPSS software, and the correlation coefficient matrix was obtained (Table 5). The results show that the wax content are positively correlated with the water content, SP and Amy of the branches, and negatively correlated with shoot shriveling rate, REC and Pro content. These results imply that it can be used to evaluate the degree of shoot shriveling during the freeze-thaw cycle with water content, wax content, SP, Amy, REC and Pro.

Table 5

Correlation analysis of wax metabolism and shoot shriveling
	Wax content	Shoot shriveling rate	Initial water content	Critical water content	SP	Amy	Pro	REC
Wax content	1
Shoot shriveling rate	-0.898*	1
Initial water content	0.820**	-0.988	1
Critical water content	0.977**	-0.785	0.681	1
SP	0.351	-0.727	0.823	0.145	1
Amy	0.999	-0.876	0.792	0.986	0.306	1
Pro	-0.431	0.784	-0.870	-0.231	-0.996	-0.388	1
REC	-0.942	0.994	-0.965	-0.850	-0.645	-0.925	0.709	1

Note:* indicates significant difference (P < 0.05); ** indicates extremely significant difference(P < 0.01).

During the overwintering phase, deciduous trees are sensitive to shoot shriveling due to the influence of the external environment temperature, thus resulting in yield and quality decline and even die (Semenikhina et al. 2021). The water loss of the branches is the most staple factor that leads to the shoot shriveling during the wintering phase (Antonio et al. 2003). In this experiment, the initial water content of 'Asi' was higher than 'Miyazaki'. When the water content reached 30%, 'Asi' shoot shriveling rate was 57.14%, while that of 'Miyazaki' was as high as 83.34%, illustrating that the water content of the branches can determine to a certain extent whether the plants can overwinter normally (Wilner 1959). As the first barrier for plants to contact the outside, the content, composition and morphology of cuticle wax will affect the cold resistance and water retention of plants (Riederer et al. 2006). Studies have illustrated that changes in temperature can cause changes in the structure, content and composition of plant epidermis wax (Sanchez et al. 2001). Shepherd found that temperature can induce the reorganization of the waxy crystal structure of plants, and plants covered with wax possess stronger low temperature tolerance than plants without wax covering (Shepherd et al. 2006). The wax content and composition are not only affected by genetic factors, but also by plant species, tissues, organs, and developmental phases, as well as environmental factors (Teusink et al. 2002). In this experiment, it was revealed that the 'Asi' was resistant to shoot shriveling than 'Miyazaki' through determining the shoot shriveling rate of two different apple varieties. Then the wax content was determined to show that the shoot shriveling-resistant varieties’ wax content was significantly higher than that of the sensitive-shoot shriveling, which further illustrates the positive correlation between the wax content and the anti-shriveling (Mills et al. 2001).

Koch divided the microscopic morphological structure of wax into 26 types such as flakes, tubes, vertical flakes, columnars, and linear shapes, and the waxy morphology is mainly affected by the wax content and composition (Koch et al. 2006). In the experiment, it was observed through scanning electron microscopy that the branches of the 'Asi' had a compact waxy structure and a needle-like appearance. At the same time, the epidermal structure of the branches was regular and smooth, and the intercellular spaces between surface cells were large. On the contrary, the waxy structure of the 'Miyazaki' is loose and bulky and the surface is rough, indicating that there is a significant difference in water retention between the two, the reason for this difference may be the sensitivity of different types of plants to low temperature (Maier et al. 1998).

A large amount of water is lost during the freeze-thaw cycle, and many studies have shown that the waxy component affects the degree of water loss (Samdur et al. 2003). Kosma believed that plants mainly synthesize a large amount of alkanes to cope with external drought stress (Kosma et al. 2009). The decline in plant resistance to stress is caused by the decrease in keratin and waxy monomers(especially alkanes)(Panikashvili et al. 2007). Researchers confirm the truth that aliphatic compounds are the most effective water-holding components and play an indispensable role in limiting water transpiration, especially alkanes (Vogg et al. 2004), and this view was also confirmed later by Guo Yanjun on alfalfa leaves (Guo et al. 2011). In this experiment, the waxy components were detected by GC-MS and it was indicated that the two branches contained 12 components, especially aliphatic, aromatic and some unknown components. From the perspective of the number of component compounds, the number of waxy components of 'Miyazaki' branches is far less than that of 'Asi', and the distribution of 'Miyazaki' carbon atoms is less; From the perspective of component properties, there are only 10 types of 'Miyazaki' branch compounds, mainly including acids, alkanes, and esters, among which alkanes account for only 17.24% of the total components, while there are 12 types of 'Asi' compounds, mainly containing alkanes and acids, whose components account for 32.0% of the total compound components. In addition, in most cases, terpenoids are the main biologically active substances in plant epidermal wax, and they are only present in trace amounts in plant epidermis (Mills et al. 2001). In 'Asi'' branches, terpenoids accounted for 6.9%, while Fuji only accounted for 4.08%, which indicated that the bioactive substances were dramatically superior to Fuji. Therefore, 'Asi' has excellent wax properties and it is more resistant than 'Miyazaki', which is similar to the research conclusion by Cameron (Aharoni et al. 2004), which demonstrated that epidermal wax restricts water dispersion loss, and the alkanes in the waxy component may mainly have the function of limiting water loss (Sánchez et al. 2001).

Plant epidermal waxes extend from the synthesis of fatty acid precursors to ultra-long chain fatty acids (VLCFAs), and finally form various waxy products such as alkanes, alcohols, aldehydes and esters through the primary alcohol metabolism pathway and the alkane metabolism pathway (Bernard et al. 2012). Each process involves multiple wax metabolism genes. This study selected representative wax metabolism genes in this process to explore their expression patterns during the wintering process. Real-time fluorescence quantification showed that most genes rose first and then fell with the extension of the wintering time, and the expression of the same gene in 'Asi' was higher. For example, the study showed that the content of alkanes in Arabidopsis thaliana increased after being subjected to low temperature stress significantly, alkanes are the key components in many plant waxes, and it can account for up to 70% of the total leaf wax in Arabidopsis (Sakuradani et al. 2013). As we all known, the proteins encoded by CER1 and CER3/WAX2 participate in the synthesis of alkanes (Chen et al. 2003). In this study, freeze-thaw stress induced a strong expression of CER1, which indicated that CER1 is not only related to drought resistance (tolerance), but also the main waxy gene in response to low temperature stress, and the up-regulation of gene expression is consistent with the increase in alkanes content. In addition, the expression of CER3 and WIN1 also showed a similar trend. The protein encoded by CER3 is currently unclear, but there are reports in the literature. CER3 is related to the synthesis of aldehydes and alkanes, WIN1 is a transcription factor that regulates epidermal wax accumulation (Bourdenx et al. 2011). The consistent expression of these three genes after stress suggests that the accumulation of plant wax may be achieved through the downstream pathway of wax synthesis-alkane synthesis pathway (Ni et al. 2014).

In the long process of evolution, plants gradually develop their own mechanisms to mitigate metabolic imbalances (CibilsStewart et al. 2021). Studies have illustrated that proline is an obvious index to measure the anti-shoot shriveling of plants (Gohari et al. 2021). In this experiment, the Pro content of the two apple varieties was measured at different phases, the results showed that two varieties showed a trend of increasing first and then decreasing from the initial dormancy to the germination phase, and both had the highest value during the deep dormancy phase, while the 'Miyazaki' branch’s Pro was significantly higher than that of 'Asi', indicating that 'Miyazaki' suffered more injure under the same environment during the winter. When plants are exposed to the external environmental stress, the REC will increase as the degree of hurt to the cells increases (Zhao et al. 2021). In the experiment, the REC of the 'Miyazaki' was significantly higher than 'Asi', and showed a trend of first rising and then decreasing with the extension of the overwintering phase, indicating that the conductivity value of the weak anti-shoot shriveling was significantly higher than that of the strong anti-shoot shriveling ability. The results of the enzyme activity assay showed that the SP and Amy activities of the 'Asi' were higher than those of 'Miyazaki', but the trend was different with the prolongation of the overwintering process, indicating that higher enzyme activity can protect plants to a certain extent.

In a word, Compared to 'Miyazaki', 'Asi'' branches can reduce the rate of the shoot shriveling due to the regular and tight wax distribution and more waxy components to survive the winter normally, which is consistent with the results of the correlation analysis.

Contributions

YLG and YXW designed the research. YLG and NYM performed the experiments. SCW and ZXZ performed the data analysis and interpretation. YLG and ZXZ prepared the figures and tables. YLG wrote the manuscript. All authors read, commented on and approved the manuscript.

Declaration of Interest Statement

The authors declare that they have no competing interests.

Funding Information

This work was supported by Special Fund for National Natural Science Foundation of China (Project Number 32160696).

Yin S-L, Wang F-L, M C-H (2002) Adaptability and use of introduced cultivars of pyrus pyrifolia nakai in gansu province of China. Acta Horticulturae 587:195-200.
González A, Ayerbe L (2010) Effect of terminal water stress on leaf epicuticular wax load, residual transpiration and grain yield in barley. Euphytica 172:341-349.
Yang C, Peng J, Li X, Liang D, Yang Z, Zhang Y (2020) The mechanism underlying overwintering death in poplar: the cumulative effect of effective freeze-thaw damage. Journal of Forestry Research 31: 219-229.
Agopian R, Peroni-Okita F, Soares CA, Mainardi JA, Nascimento J, Cordenunsi BR, Lajolo FM, Purgatto E (2011) Low temperature induced changes in activity and protein levels of the enzymes associated to conversion of starch to sucrose in banana fruit. Postharvest Biology & Technology 62: 133-140.
Kikuchi T, Masuda K (2009) Class I chitinase accumulated in the bark tissue involves with the cold hardiness of shoot stems in highbush blueberry (Vaccinium corymbosum L.). Sci.Hortic 120: 230-236. Kim KS, Park SH, Jenks MA (2007) Changes in leaf cuticular waxes of sesame (Sesamum indicum L.) plants exposed to water deficit. J Plant Physiol 164: 1134-1143.
Cheng T, David R, Susan LU (2014 ) Detecting diurnal and seasonal variation in canopy water content of nut tree orchards from airborne imaging spectroscopy data using continuous wavelet analysis. Remote Sensing of Environment 143: 39-53.
Senadheera P, Singh RK, Maathuis Frans JM (2009) Differentially expressed membrane transporters in rice roots may contribute to cultivar dependent salt tolerance. Journal of experimental botany 60: 2553-63.
Jee ER, Peter MP, William W, Van O (2007) Using the method of homogenization to calculate the effective diffusivity of the stratum corneum. Journal of Membrane Science 293: 174-182.
Kunst L, Samuels L (2003) Plant cuticles shine: advances in wax biosynthesis and export. Curr Opin Plant Biol 12: 721-727.
Gutiérrez C, Figueroa CR, Turner A, Munné-Bosch S, Muñoz P, Schreiber L, Zeisler V, Marín JC, Balbontín C (2021) Abscisic acid applied to sweet cherry at fruit set increases amounts of cell wall and cuticular wax components at the ripe stage. Scientia Horticulturae 283.
Li Y, Li Q, Liu D-C, Kuang L-Q, Hu W, Liu Y (2022) Changes in the crystal morphology, chemical composition and key gene expression of 'Suichuan' kumquat cuticular waxes after hot water dipping. Scientia Horticulturae 293.
Koch K, Barthlott W, Koch S, Hommes A, Wandelt K, Mamdouh W, De-Feyter S, Broekmann P (2006) Structural analysis of wheat wax (Triticum aestivum, c.v. ‘Naturastar’ L.): from the molecular level to three dimensional crystals. Planta 223:258-270.
Javelle M, Vernoud V, Depège-Fargeix N, Arnould C, Oursel D, Domergue F, Sarda X, Rogowsky PM (2010) Overexpression of the epidermis-specifi chomeodomain-leucine zipper IV transcription factor Outer Cell Layer1 in maize identifies target genes involved in lipid metabolism and cuticle biosynthesis. Plant Physiol 154:273-286.
Premachandra GSH, Kanaya M, Ogata S (1991) Cell membrane stability and leaf surfacewax content as affected by increasing water deficits in maize. Journal of experimental botany 42:167-171.
Kosma DK, Bourdenx B, Bernard A, Parsons EP, Lü S, Joubès J, Jenks MA (2009) The Impact of Water Deficiency on Leaf Cuticle Lipids of Arabidopsis1. Plant Physiology 151:1918-29.
Ahmad HM, Wang X-K, Mahmood UR, Fiaz S, Azeem F, Shaheen T (2021) Morphological and Physiological Response of Helianthus annuus L. to Drought Stress and Correlation of Wax Contents for Drought Tolerance Traits. Arabian Journal for Science and Engineering 47:6747-6761.
Riederer M, Schneider G (1990) The effect of the environment on the permeability and composition of Citrus leaf cuticles. II. Composition of soluble cuticular lipids and correlation with transport properties. Planta 180:-154-165.
Viskari EL (2000) Epicuticular wax of Norway spruce needles as indicator of traffic pollutant deposition. Water Air Soil Poll 121:327-337.
Oliveira AFM, Meirelles ST, Salatino A (2003) Epicuticular waxes from caatinga and cerrado species and their efficiency against water loss. An Acad Bras Cienc 75:431439.
Cameron KD, Teece MA, Smart LB (2006) Increased accumulation of cuticular wax and expression of lipid transfer protein in response to phaseic drying events in leaves of tree tobacco. Plant Physiol 140:176-183.
Hong Y, Zhang G-P (2020) The influence of drought stress on malt quality traits of the wild and cultivated barleys. Journal of Integrative Agriculture19(08):-2009-2015.
Achuba F I, Okoh P N (2015) Effects of Petroleum Products in Soil on α-Amylase, Starch Phosphorylase and Peroxidase Activities in Cowpea and Maize Seedlings. American Journal of Experimental Agriculture 6(2):112-120.
Zhao D-Q, Li T-T, Hao Z-J, Cheng M-L, Tao J (2019) Exogenous trehalose confers high temperature stress tolerance to herbaceous peony by enhancing antioxidant systems, activating photosynthesis, and protecting cell structure. Cell stress & chaperones 24(1): 247-257.
Wang A-H, Ma C, Ma H-Y, Qiu Z-L, Wen X-P (2021) Physiological and Proteomic Responses of Pitaya to PEG-Induced Drought Stress. Agriculture 11(7)632-632.
Demirbas A (2004) Effect of initial moisture content on the yields of oily products from pyrolysis of biomass. Journal of Analytical & Applied Pyrolysis 71:803-815.
Semenikhina Y, Kambulov S , Boyko A, Nadolinsky Y, Podlesniy D (2021) Influence of the main tillage methods on the moisture temperature mode of the soil and the yield of winter wheat. IOP Conference Series: Earth and Environmental Science 723:032048.
Antonio FM, Oliveira, Sérgio T. Meirelles, Antonio S (2003) Epicuticular waxes from caatinga and cerrado species and their efficiency against water loss. Anais da Academia Brasileira de Ciências 75:431-439.
Wilner J (1959) Note on an eiectrolytic procedure for differentiating between frost injury of roots and shoots in woody plants.Canadian Journal of Plant Science 39:512-513.
Riederer M (2006) Thermodynamics of the water permeability of plant cuticles: characterization of the polar pathway. Journal of Experiment Botany 57:2937-2942.
Sanchez FJ, Manzanares M, Andres EF, Tenorio JL, Ayerbe L (2001) Residual transpiration rate, epicuticular waxload and leaf colour of pea plants in drought conditions. Influence on harvest index and canopy temperature. Eur J Agron 15: 57-70.
Shepherd T, Wynne Griffiths D (2006) The effects of stress on plant cuticular waxes. New Phytologist 171: 469-499.
Teusink RS, Rahman M, Bressan RA, Jenks MA (2002) Cuticular waxes on Arabidopsis thaliana closerelatives Thellungiella halophila and Thellungiella parvula. International journal of plant sciences 163:309-315.
Mills D, Zhang G, Benzioni A (2001) Effect of different salts and of ABA on growth and mineral uptake inJojoba shoots grown in vitro. Journal of Plant Physiology 158:1031-1039.
Maier GA, Post-Beittenmiller D (1998) Epicuticular wax on leek in vitro developmental stages and seedlings under varied growth conditions. Plant Sci 134:53-67.
Samdur MY, Manivel P, Jain VK, Chikani BM, Gor HK, DesaiS, Misra JB (2003) Genotypic differences and water-deficit inducedenhancement in epicuticular wax load in peanut. Crop Sci 43:1294-1299.
Panikashvili D, Savaldi GS, Mandel T, Yifhar T, Franke RB, Höfer R, Schreiber L, Chory J, Aharoni A (2007) The Arabidopsis DESPERADO/AtWBC11 transporter is required for cutin and wax secretion. Plant physiology 145:1345-60.
Kosma DK, Nemacheck JA, Jenks MA, Williams CE (2010) Changes in properties of wheat leaf cuticle during interactions with Hessian fly. Plant J 63:31-43.
Vogg G, Fischer S, Leide J, Emmanuel E, Jetter R, Levy AA, Riederer M (2004) Tomato fruit cuticular waxes and their effects on transpiration barrier properties:functional characterization of a mutant deficient in a very-long-chain fatty acid beta-ketoacyl-CoA synthase. Journal of experimental botany 55(401):1401-10.
Guo Y, Ni Y, Guo Y, Han , Tang H, Yu Y (2011) Effects of water and heat stress on the waxy components and physiological indexes of alfalfa leaf epidermis. Acta Agronomica Sinica 37:911-917.
Aharoni A, Dixit S,Jetter R Thoenes E, van AG, Pereira A (2004) The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. The Plant cell 16:2463-80.
Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire R, Joubès J (2012) Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERSUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. The Plant Cell 24:3106-3118.
Sakuradani E, Zhao L-F, Haslam TM, Kunst L (2013) The CER22 gene required for the synthesis of cuticular wax alkanes in Arabidopsis thaliana is allelic to CER1. Planta 237(3): 731-738.
Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Cloning and characterization of the WAX2 gene of Arabidopsis involved in cuticle membrane and wax production. The Plant Cell 15:1170-1185.
Bourdenx B, Bernard A, Domergue F,Pascal S, Léger A, Roby D, Pervent M, VD, Haslam RP, Napier JA, Lessire R, Joubès J (2011) Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses. Plant physiology 156:29-45.
CibilsStewart X, Mace WJ, Popay AJ, Lattanzi FA, Hartley SE, Hall CR, Powell JR, Johnson SN (2021) Interactions between silicon and alkaloid defences in endophyte-infected grasses and the consequences for a folivore. Functional Ecology 36(1): 249-261.
Gohari G, Panahirad S, Sepehri N, Akbari A, Zahedi SM, Jafari H, Dadpour MR, Fotopoulos V (2021) Enhanced tolerance to salinity stress in grapevine plants through application of carbon quantum dots functionalized by proline. Environmental science and pollution research international 28(31): 42877-42890.
Zhao H-Y, Guan J-L, Liang Q, Zhang X-Y, Hu H-L, Zhang J (2021) Effects of cadmium stress on growth and physiological characteristics of sassafras seedlings. Scientific reports 11(1): 9913-9913.

renameda5849.xls

Download PDF

Version 1

posted

You are reading this latest preprint version

Wax Metabolism is involved in Response to Alternate Freeze-thaw Stress to Regulate Shoot Shriveling

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Material handling and index determination

Determination of Critical Water Content of 'Asi' and 'Miyazaki' Branches

Determination of the waxy components and contents of the stratum corneum

Screening differential genes(DEGs) related to wax synthesis and metabolism by transcriptome

Expression characteristics of wax-related genes under alternating freeze-thaw stress

Data processing

Results

The shoot shriveling rate of 'Asi' and 'Miyazaki'

The relationship between the critical water content of 'Asi' and 'Miyazaki' and the shoot shriveling

Changes in wax content of branches during overwintering

Changes in waxy morphology and epidermal structure of branches

Changes in waxy components of branches

Transcriptome differential genes and metabolic pathway enrichment

Expression analysis of wax synthesis related genes

Biosynthesis Pathway of Cuticular Wax

Changes of Amy and SP during the Overwintering of Branches

Changes of Proline content and relative conductivity of branches during overwintering

Correlation analysis of wax metabolism and shoot shriveling

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Version 1