Construction of recombinant Lactococcus expressing thymosin and interferon fusion protein and its application as an immune adjuvant

doi:10.21203/rs.3.rs-2242889/v1

Download PDF

Research Article

Construction of recombinant Lactococcus expressing thymosin and interferon fusion protein and its application as an immune adjuvant

https://doi.org/10.21203/rs.3.rs-2242889/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 06 Feb, 2024

Read the published version in Microbial Cell Factories →

You are reading this latest preprint version

In this study, recombinant food-grade Lactococcus lactis (r-L. lactis-Tα1-IFN) expressing thymosin Tα1 and interferon fusion protein was constructed. In vitro interaction with macrophages showed that recombinant r-L. lactis-Tα1-IFN could significantly activate both macrophage J774-Dual™ NF-κB signaling pathway and IRF signaling pathway. In vitro interaction with chicken, PBMCs showed that recombinant r-L. lactis-Tα1-IFN significantly enhanced the expression levels of IFN-γ, IL-10, CD80, and CD86 molecules in chicken PBMCs cells. Animal experiments showed that injection of recombinant r-L. lactis-Tα1-IFN could significantly activate the proliferation activity of T cells and antigen-presenting cells in chicken PBMCs, and the results of 16S analysis of intestinal microbiota showed that injection of recombinant r-L. lactis-Tα1-IFN could significantly improve the structure and composition of chicken intestinal microbiota, with a significant increase in probiotic genera such as Lactobacillus spp. were significantly increased. The results of animal experiments using recombinant r-L. lactis-Tα1-IFN as an immune adjuvant for inactivated chicken Newcastle disease vaccine showed that the serum HI antibody titers of the experimental group were extremely significantly higher than those of the vaccine control group, and the expression levels of cytokines IFN-γ, IL-2, and IL-10 were significantly higher than those of the vaccine control group, These results indicate that food-safe recombinant r-L. lactis-Tα1-IFN has potential as a vaccine immune booster and immune adjuvant, and this study lays the foundation for the development of natural green novel animal immune booster or immune adjuvant.

thymosin

interferon

recombinant Lactococcus

immune enhancer

immune adjuvant

Immune enhancers are substances that are not related to antigens and can enhance the immune response of the body when used alone or simultaneously with antigens and can alter or enhance the specific immune response of the body to antigenic substances through non-specific pathways; while immune adjuvants are substances that can be used in combination with vaccines and can enhance the immune response to vaccine antigens [1]. Studies have shown that there are very many substances with immune-enhancing effects, commonly used are oil-water emulsions, microorganisms, and their metabolites, nucleic acids, and their analogs, cytokines, propolis, immunostimulatory complexes, liposomes, and artificial chemical synthesis, etc. However, these substances face many challenges as immune enhancers, such as induction of physiological disorders, allergic reactions, hypersensitization, and cytotoxicity [2, 3]. In recent years, biosafety and green food safety have placed higher demands on future biologics, especially on the biosafety of preventive biological agents, such as immune enhancers or immune adjuvants, and novel immune adjuvants, immune enhancers, and novel vaccines must meet the basic requirements of green food safety and biosafety. Therefore, research on natural peptides and natural proteins derived from animals themselves as immune adjuvants or immune enhancers has been emphasized.

Natural immune peptides, which are mostly peptides with natural immunomodulatory activity obtained from animals themselves or food proteins [4], these peptides can regulate the specific and non-specific immune functions of the body by affecting the growth and development of immune organs (tissues), the proliferation and transformation of lymphocytes, the activity, and function of immune cells, or by participating in the expression, synthesis and/or release of immune molecules (cytokines, antibodies, etc.). These natural immune peptides play an important role in maintaining the immune function and maintaining the body's health [5]. Because they are natural proteins from animals, there are no biosafety and food safety concerns. Thymic peptides are a class of peptides secreted by the epithelial cells of thymus tissue and they are involved in immune development and immune regulation of the body, among which thymosin Tα1 is a short peptide consisting of 28 amino acids and is highly conserved among different animal species [6, 7]. Studies have shown that thymosin Tα1 has important immunomodulatory activities [8], it can promote T cell proliferation, secretion of various cytokines by natural killer cells, such as interleukin-2 (IL-2) and interferon-α (INF-α), and also promotes the production of high-affinity IL-2 receptors, and is an immune enhancer targeting T lymphocytes, an immune enhancer against CD₃⁺ induced apoptosis, enhances NK cell function, inhibits tumor growth, and a series of other immunomodulatory functions [9]. At present, the thymus peptides used in veterinary clinical practice are mostly extracted from bovine thymus tissue, mostly a mixture of molecular small peptides, which have many problems, such as large content of impurities, low Tα1 content (about 0.1%), poor treatment effect, large dosage, serious side reactions and other problems; Moreover, the extraction of thymus peptide from thymus tissue has problems such as the difficult source of thymus tissue and low yield [5]. There are also purified Tα1 mostly synthetic products, which are expensive. Therefore, exploring the use of genetic engineering methods to obtain highly active Tα1 at low cost has become the first choice.

Interferon (IFN) was discovered in 1957 as a substance that interferes with virus reproduction, it is a natural protein produced by the immune system of most vertebrates when resisting viruses, bacteria, parasites, tumor cells, and other foreign substances. IFN-γ is mainly produced by activated T cells and natural killer cells and is involved in immune regulation and inflammatory responses, with important immunomodulatory and antiviral effects. In recent years, some studies have confirmed that the combined application of interferon and thymosin has the function of synergistically promoting T cell growth, proliferation, differentiation, and activation of NK cell activity, which can enhance the immune capacity of the body [10, 11], the combination of interferon and thymosin as natural immune enhancers or immune adjuvants has brought new hope for the treatment of viral and neoplastic diseases [12].

However, these natural peptides obtained from animal tissues face many difficulties such as difficulty in extracting sufficient amounts and difficulty in purification, while the use of genetic engineering methods to express natural proteins also faces some problems. Many scientists have applied Escherichia coli, yeast, etc. to express natural proteins, but their application is limited by the presence of substances such as endotoxin. Food-grade lactic acid bacteria genetically engineered to express natural proteins have become the first choice because food-grade lactic acid bacteria themselves do not have endotoxin, they can completely replace Escherichia coli as a live vector to deliver the protein of interest in food or in vivo and become the most commonly used Gram-positive host bacteria and gene expression system. Lactic acid bacteria have been widely and successfully used in food fermentation for thousands of years [13]. Most lactic acid bacteria species are beneficial to animals, plants, and humans, and probiotics are not only endotoxin-free, but their cell wall and nucleic acid and other components have immune adjuvant activity themselves [14], and among the many benefits of probiotics, their ability to modulate the immune system occupies an important position [15], and several studies have provided clear evidence of the modulatory properties of certain probiotics on the immune system [16], with some probiotics can enhance the non-specific immune functions of the organism, including the phagocytic activity of innate immune cells and the cytotoxicity of NK cells [16], and also enhance the specific immune response function of the organism, promoting the stimulation of B cells to secrete specific IgA and IgG and activating helper T lymphocytes and macrophages [17, 18]. In today's very critical food safety and biosafety situation, food-grade lactic acid bacteria, with their food safety and biosafety properties, make them the preferred carriers for the construction of immune adjuvants and immune enhancers compatible with their safety and probiotic functions and are the preferred carriers for the expression of natural immune enhancers or immune adjuvants.

In this study, recombinant Lactococcus lactis (r-L. lactis-Tα1-IFN) expressing chicken thymosin Tα1 and chicken IFN-γ fusion protein was constructed using food-grade Lactococcus lactis NZ3900 and an antibiotic-free labeled expression vector. In vitro and in vivo studies showed that r-L. lactis-Tα1-IFN demonstrated good immune booster and immune adjuvant activities, and this study laid a good foundation for the research and application of green food-safe grade vaccine adjuvants or immune enhancers.

Strains, Cells, And Reagents

Lactococcus lactis NZ3900 and expression vector pNZ8149 from MoBiTec (MoBiTec, Gottingen, Germany); Macrophage cell line J774-Dual™ (InvivoGen, Hong Kong. J774-Dual™ cells were derived from the mouse J774.1 macrophage-like cell line and were constructed by stably integrating two reporter genes (alkaline phosphatase (SEAP) and Lucia luciferase). J774-Dual™ cells detect activation of the NF-kB pathway by assessing the expression of the alkaline phosphatase (SEAP) reporter and monitoring Lucia luciferase activity to assess activation of the interferon regulator (IRF) pathway); DMEM (Thermo Fisher Scientific, USA); Lipopolysaccharide (LPS)、2’3’-cGAMP、Pam3CSK4 (InvivoGen, Hong Kong); Chicken peripheral blood lymphocyte separation solution kit (TBD, China); Fetal bovine serum (FBS) (Gibco, USA); RPMI 1640 medium (Sigma, USA); PMA and ConA was purchased from Invivogen (Invivogen, Toulouse, France); DNA gel extraction and purification kit purchased from Axygen; One Step Cloning Kit was purchased from Vazyme. PrimerStar Max, SYBR Green Realtime PCR Master Mix, Premix Ex Taq (Probe qPCR) kit purchased from Toyobo Biotechnology Co., Ltd. Ex Taq enzyme, RNAiso Plus purchased from TaKaRa; HA mouse monoclonal antibody purchased from Beijing Bolong Company; Newcastle disease oil emulsion inactivated vaccine (Lasota strain) was purchased from Harbin Weike Biology Co., Ltd.

Construction Of Recombinant Plasmids And Recombinant Lactococcus

The fusion protein was designed based on the reference sequences of thymosin Tα1 and interferon from GenBank, and the DNA sequence was synthesized by gene codon optimization by Genescript, Inc based on the genome of the host strain NZ3900 (fusion protein with HA tag at the carboxyl end). The fusion gene was amplified by PCR using forward primer 5'-ACCATGGGTACTGCAGGCATG-3' and reverse primer 5'-AGCTCTCTAGAACTAGTGGTACC-3', according to One Step Cloning Kit (Vazyme Biotechnology, Nanjing, China), homologous recombination was performed and cloned into plasmid pNZ8149. The cloned region was sequenced after each construction stage and the final recombinant plasmid was electro-transformed into the competent receptor host Lactococcus lactis NZ3900. Plates were coated on Elliker culture agar plates containing 0.5% lactose, selected for lactose-resistant monoclonal colonies, and incubated at 30°C for 24 h according to the standard protocol [19]. Subsequently, the r-Tα1-IFN fragment was detected by PCR to identify a positive recombinant strain.

Nisin-induced Expression And Western Blotting Analysis

Nisin-induced expression and western blotting analysis

The constructed recombinant Lactococcus were inoculated in L-Elliker liquid medium at a ratio of 1:100. When the OD value was 0.35, the inducer nisin was added to a final concentration of 20 ng/mL, incubated for 6 h at 30°C, washed twice with PBS and then concentrated 10-fold, and the supernatant was collected after ultrasonic crushing using an ultrasonic crusher and centrifuged at 3000×g for 10 min. Lactococcus lactis NZ3900 containing the control pNZ8149 plasmid was also treated as a blank control according to the above method. After sonication, the supernatant was analyzed by Western blotting. The specific steps are as follows: after the sample is subjected to 12% SDS-PAGE, the sample is electrically transferred to the nitrocellulose membrane, and the nitrocellulose membrane is blocked at room temperature with 5% skim milk for 2 h, after 3 times PBST washing, HA murine monoclonal antibody (1:2000) is added, incubated at room temperature for 1.5 h, PBST is washed 4 times, sheep anti-mouse infrared labeled secondary antibody is added for room temperature incubation for 50 min, PBST is washed 3 times and then imaging with an Odyssey Infrared Scanner.

Quantification Of Recombinant Protein (Tα1-ifn) And Preparation Of Recombinant Protein Mixture

After the recombinant lactic acid bacteria induced the expression of the target protein according to the above method, the bacteria were washed with sterile PBS solution three times, and the OD600 value of the bacterial solution was adjusted to 2 OD (the concentration of lactic acid bacteria was about 2×10⁸ CFU/mL), it was ultrasonically broken (the ultrasonic time was adjusted to 18 min) and then centrifuged at 12000×g for 10 min, the supernatant was collected and filtered with a 0.45µm filter. And the recombinant protein was quantified using the BCA method. The supernatant of the recombinant protein mixture and store at − 80°C for standby.

The Recombinant Protein (Tα1-ifn) And Macrophage J774 Dual ™ Interaction

The macrophage cell line J774-Dual™ (Invivogen, Hong Kong) was cultured in a 37°C 5% CO₂ incubator with 100 mg/mL Normocin, 100 U/mL penicillin, 100 µg/mL streptomycin, 5 µg/mL blasticidin, 100 µg/L Zeocin DMEM (Thermo Fisher Fisher, USA). Cell scrapers were used to separate cells and count the number of cells. The cells were centrifuged at 1000–1500 RPM (RCF 200–300×g) for 5 min. Remove the supernatant and resuspend J774-Dual™ cells in fresh, pre-warmed growth medium at 2.8×10⁵ cells/mL.

To detect the activation of the NF-κB signaling pathway in J774-Dual™ cells, 100 µL of J774-Dual™ (2.8×10⁵ cells/mL) was seeded in 96-well cell culture plates, and 20 µL of the prepared recombinant Tα1-IFN recombinant protein mixture was added to each test well, respectively. Pam3CSK4 was used as a positive activation control, and 20 µL PBS was used as a negative control. The cells were incubated at 37°C 5% CO₂ for 24 h, and the culture supernatant was collected and stored at -20°C for later use. Then, 170 µL of the configured QUANTI-Blue™ solution was added to each well of a 96-well plate, followed by 30 µL of the J774-Dual™ cell supernatant, and incubated in a 37°C 5% CO₂ incubator for 4–8 h. The NF-κB-induced alkaline phosphatase expression level was measured at 650 nm using a microplate spectrophotometer.

Detection of activation of the IRF signaling pathway in J774-Dual™ cells. Seed 100 µL of J774-Dual™ (2.8×10⁵ cells/mL) into a 96-well cell culture plate, add 20 µL of prepared (Tα1-IFN) recombinant protein mixture to each test well. 2'3'-GAMP was used as a positive control. Use 20 µL of PBS as the negative (non-stimulating) control. After stimulating the cells in a 37°C 5% CO₂ incubator for 24 h, collect the culture supernatant. Pipette the sample (20 µL per well) to the white (opaque) of 96 wells, and detection of luciferase expression using a microplate chemiluminescence detector (LB 960). Set the following photometer parameters: 50 µL QUANTI-Luc™ injection, endpoint measurement, start time 4 s, end reading 0.1 s, followed by measurement.

Recombinant Proteins (Tα1-ifn) Interact With Pbmcs

According to the instructions of the chicken peripheral blood lymphocyte isolation solution kit (TBD, China), the peripheral blood mononuclear cells (PBMCs) were isolated from the anticoagulant blood of chickens, PBMCs cells were resuspended in RPMI 1640 culture medium (Sigma, USA) with 150 µg/mL gentamicin, 100 mg/ml Normicin, 2 mM-glutamine, and 10% heat-inactivated fetal bovine serum (FBS) (Corning, USA) at 37°C and the cell concentration was adjusted to 1×10⁶ cells/mL for later use. Seed 1 ml of PBMCs (to 1×10⁶ cells/mL) into a 24-well cell culture plate. Add 20 µL of the prepared recombinant (Tα1-IFN) protein mixture. Use 50 µL of Lactococcus lactis NZ3900 lysed supernatant as a negative control. After stimulation for 24 h in an incubator at 37°C 5% CO₂, cells were collected, centrifuged, and stored at -80°C for backup, RNA was extracted, and the transcript levels of IFN-γ and IL-10, as well as CD80 and CD86 in the cells, were quantified using SYBY Green I quantitative PCR (see Table 1 for primers).

Table 1

Primer sequences
Primer	Primer sequences (5’- 3’)
IFN-γ-F	CTCCCGATGAACGACTTGAG
IFN-γ-R	CTGAGACTGGCTCCTTTTCC
IL-10-F	CTGTCACCGCTTCTTCACCT
IL-10-R	ACTCCCCCATGGCTTTGTA
CD80-F	CAGCAAGCCGAACATAGAAAGA
CD80-R	AGCAAACTGGTGGACCTGAGA
CD86-F	TACCTTGGCCAGGAAAAACA
CD86-R	ATACTGCCCCTCATCCACAA
β-actin -F	TCCACCGCAAATGCTTCTAAAC
β-actin -R	CTGCTGACACCTTCACCATTCC

Determination Of Pbmcs Cell Proliferation Activity

The isolated chicken peripheral blood lymphocytes were washed twice in a fresh RPMI 1640 medium. Cells were resuspended in 10% fetal bovine serum (FBS) RPMI 1640 medium, maintaining a cell concentration of 1×10⁶ cells/mL, 100 U/mL penicillin, 100 µg/mL streptomycin, 100 µg/mL Normosin, and 100 µg/mL gentamicin. 100 µL of cells were added to 96-well plates with a mixture of ConA (5 µg/mL, Sigma) and Ionomycin (Ionomycin, 1 µg/mL, Sigma) or Canavalin A (ConA, 5 µg/mL) and Phorbol 12-myristate 13-acetate (PMA, 100 ng/mL) or LPS (1 µg/mL) were used as stimuli. Incubate the plates in a 37°C 5% CO₂ incubator for 48 h, then add 10 µL of CCK-8 per well, continue incubation in a thermostatic incubator for 4 h, and measure absorbance at 450 nm with a microplate reader.

Analysis Of Intestinal Microbiota 16s Diversity

Chickens in the experimental group were euthanized separately from those in the blank control group. In addition to collecting serum and other samples, samples of cecum intestinal contents were collected and placed in 15 mL centrifuge tubes, then quickly stored in a − 80°C freezer for cryopreservation and transported through a dry ice storage box to a sequencing company (Shanghai Meiji Biotechnology Co., Ltd., China) for sample DNA extraction. The primers for amplification of the V3-V4 region of the 16S rRNA gene were as follows: forward primer 343F; Reverse primer 798R. All samples were analyzed using the Megasound Cloud Analysis Platform (Shanghai Megasound Biotechnology Co., Ltd., China).

Detection Of Serum Antibody Titer By Hemagglutination Inhibition Test

The serum to be tested was removed from − 20 ℃ and set aside. Firstly, the HA titer of NDV virus antigen was detected: the Lasota strain NDV virus antigen solution was diluted sequentially in a 96-well hemagglutination plate, and 50 µL of the prepared 0.5% chicken red blood cell suspension was added to each well, placed in a 37°C incubator for 30 min, and the HA titer was read. According to the HA titer of the antigen, prepare the virus liquid of 8 hemagglutination units and 4 hemagglutination units, respectively. Add 50 µL of 8 hemagglutination units of the virus to the first column of the 96-well hemagglutination plate, add 50 µL of 4 hemagglutination unit virus solution to each of the remaining wells, one serum is detected in each line, add 50 µL of the tested serum to the first well, dilute the serum one by one, and set up positive control wells and negative control wells. Then, add 50 µL of 0.5% chicken red blood cell suspension to all wells, mix gently, and place in a 37°C incubator for 30 min before reading the results. Antibody titers are expressed as 1:2ⁿ (n is the highest dilution of the number of wells in which the agglutination of erythrocytes was 100% inhibited by the serum) or negative logarithm nLog2 is expressed as serum titer.

Detection Of Cytokines

Detection of serum cytokines: The collected serum was diluted at a ratio of 1:2 and the levels of IL-1β, IL-2, IL-4, and IFN-γ were determined using an ELISA kit (Solarbio, Beijing, China). Optical density value (OD value) measured at 450nm. Cytokine concentrations were calculated according to the standard curve and the manufacturer's instructions.

Experimental Chickens And Animal Experimental Design

Special Pathogen Free (SPF) chickens were purchased from the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Harbin, China) and housed in a negative pressure filtered air isolator at Harbin Guosheng Biotechnology Co. All animal experiments in this study were conducted by the standards of the Specification for Laboratory Animals of the Ministry of Science and Technology of the People's Republic of China (Beijing, China). All SPF chickens are reared and handled by the principles of humane care and the use of laboratory animals. All chickens tested with r-L. lactis-Tα-IFN as an immune enhancer were 21-day-old chicks, which were housed in special pathogen-free negative-pressure filtered air isolators. All chickens in the experiment used r-L. lactis-Tα1-IFN as vaccine immune adjuvant were 10-day-old chicks reared in special pathogen-free negative-pressure-filtered air isolators.

Animal experimental design for injection of r-L. lactis-Tα1-IFN as an immune booster in chickens: 21-day-old SPF chickens were randomized into 2 groups: a blank control group and r-L. lactis-Tα1-IFN immune booster group, 10 animals in each group were immunized by injection at 21 and 28 days of age, respectively. r-L. lactis-Tα1-IFN immune booster group was injected intramuscularly with 200 µL (recombinant protein mixture (27 µg/ml)) per animal. The blank control group was injected intramuscularly with 200 µL PBS per animal. Blood, serum, and anticoagulated blood were collected at the 2nd, 4th and 7th weeks after immunization, PBMCs were prepared, and intestinal tissues were collected; relevant assays were performed as described above.

Preparation of water-in-oil immunoadjuvant: the aqueous phase consisted of r-L. lactis-Tα1-IFN mixture with 0.25% surfactant Tween-80, shaken well in a warm bath at 37°C for 30 min, and set aside at rest; the oil phase was prepared by adding 2% aluminum stearate to white oil (10# white oil) with 5% Span-80 and was autoclaved and set aside. The emulsification consisted of 2 parts of the oil phase (oil emulsion) and 1 part of the water phase, and the two phases were mixed and emulsified to form a W/O oil emulsion to prepare r-L. lactis-Tα1-IFN immunoadjuvant oil emulsion.

Preparation of r-L. lactis-Tα1-IFN immunoadjuvant Newcastle disease oil emulsion inactivated vaccine: In a 1:1 ratio, one part of r-L. lactis-Tα1-IFN immunoadjuvant oil emulsion was added to one part of the chicken Newcastle disease oil emulsion inactivated vaccine and re-emulsified by an emulsifier to prepare and obtain r-L. lactis-Tα1-IFN immunoadjuvant Newcastle disease oil emulsion inactivated vaccine was prepared.

Animal experimental design for injection of r-L. lactis-Tα1-IFN as an immune adjuvant for inactivated Newcastle disease vaccine: 14-day-old SPF chickens were randomly divided into three groups: blank control group, vaccine control group, and r-L. lactis-Tα1-IFN oil emulsion inactivated vaccine test group, 10 chickens in each group. Immunization dose: in the r-L. lactis-Tα-IFN immune adjuvant Newcastle disease oil emulsion inactivated vaccine test group, the injected dose was 0.6 mL per animal; in the Newcastle disease oil emulsion inactivated vaccine control group, the injected dose was 0.3 mL per animal (to ensure that the antigen dose in the immune adjuvant group was the same as that in the vaccine control group); in the blank control group, the injected dose was 0.3 mL of PBS. Blood was collected on 3, 7, and 14 days after immunization for serum preparation, and PBMCs were prepared on day 14 after immunization.

Data Statistical Analysis

Ordinary one-way analysis of variance (ANONA) was performed using Graph PadPrism 8.0 software (LaJolla, CA, USA) to detect differences between groups. Statistical significance was *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, respectively.

Construction Of Recombinant Lactococcus And Induced Expression Of The Target Protein

The recombinant plasmid pNZ8149-Tα1-IFN was identified by PCR to amplify a 674 bp gene fragment (Fig. 1A, lanes 2 and 3), which was sequenced completely correctly. Recombinant Lactococcus lactis (r-L. lactis-Tα1-IFN) was obtained by electrotransferred pNZ8149-Tα1-IFN plasmid into L. lactis NZ3900, and recombinant Lactococcus lactis (r-L. lactis-Tα1-IFN) was induced to be expressed, and Western blotting yielded a recombinant Tα1- IFN that matched the size of the intended target recombinant protein (about 25 KD) (Fig. 1B, lane 2); the concentration of r-Tα1-IFN protein was 27 µg/mL by BCA assay.

r- L. lactis -Tα1-IFN activates IRF and NF-κB signaling pathways of macrophages in vitro

In vitro studies showed that r-L. lactis-Tα1-IFN lysis mixture interacted with macrophage reporter cells J774-Dual™ and extremely activated the NF-κB signaling pathway in macrophage J774-Dual™ cells compared to blank controls (P < 0.0001; Fig. 2A); r-L. lactis-Tα1-IFN lysis mixture effectively stimulated NF-κB signaling pathway in macrophage J774-Dual™ cells.

Activation of IRF pathway by r-L. lactis-Tα1-IFN lysis mixture was highly significant compared with wt-L. lactis-control, (P < 0.0001; Fig. 2B); and with the 2'3'-cGAMP-stimulated positive control (P < 0.0001; Fig. 2B); and compared with the blank control, the difference was highly significant, (P < 0.0001; Fig. 2B); the results showed that r-L. lactis-Tα1-IFN lysis mixture could effectively stimulate the interferon regulatory factor (IRF) signaling pathway in macrophage J774-Dual™ cells.

r- L. lactis -Tα1-IFN activates PBMCs in vitro

The results showed that r-L. lactis-Tα1-IFN lysis mixture could effectively stimulate the production of cytokine IFN-γ in chicken PBMCs (Fig. 2C), and the difference between r-L. lactis-Tα1-IFN lysis mixture and PBS-control were highly significant (P < 0.0001; Fig. 2C). The r-L. lactis-Tα1-IFN lysis mixture effectively stimulated the production of cytokine IL-10 in chicken PBMCs (Fig. 2D), and the difference between r-L. lactis-Tα1-IFN lysis mixture and PBS-control was highly significant (P < 0.0001; Fig. 2D); compared with wt-L. lactis-control, the differences were significant, (P < 0.05; Fig. 2D). r-L. lactis-Tα1-IFN could effectively activate chicken PBMCs. In addition, our study showed that r-L. lactis-Tα1-IFN extremely significantly increased the expression of CD80 and CD86 in chicken PBMCs (Fig. 2F, G). r-L. lactis-Tα1-IFN significantly upregulated the expression of CD80 and CD86 compared with the control group (P < 0.0001; Fig. 2F, G).

Animal experiments to verify the immune enhancer activity of r- L. lactis -Tα1-IFN

The proliferation activity of PBMCs activated by the combination of ConA and Ionomycin showed that after 2 weeks of immunization, the proliferation activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was extremely significantly higher than that of the blank control group (P < 0.0001; Fig. 3B); after 4 weeks of immunization, the proliferation activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was extremely significantly higher than that of the blank control group (P < 0.0001; Fig. 3B); after 7 weeks of immunization, the proliferative activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was not significant compared with that in the blank control group (P༞0.05; Fig. 3B).

When ConA and PMA jointly activated PBMCs, the proliferation activity showed that after 2 weeks of immunization, the proliferation activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was extremely significantly higher than that in the blank control group (P < 0.0001; Fig. 3C); after 4 weeks of immunization, the proliferative activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was extremely significantly higher than that in the control group (P < 0.0001; Fig. 3C); after 7 weeks of immunization, the proliferative activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was extremely significantly higher than that in the blank control group (P < 0.0001; Fig. 3C).

The proliferative activity of PBMCs activated by LPS showed that after 2 weeks of immunization, the proliferation activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was extremely significantly higher than that in the blank control group (P < 0.0001; Fig. 3D); after 4 weeks of immunization, the proliferative activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was extremely significantly higher than that of the control blank group (P < 0.0001; Fig. 3D); after 7 weeks of immunization, the proliferative activity of PBMCs in the r-L. lactis-Tα1-IFN immune enhancer group was not significantly different from that of the blank control group (P༞0.05; Fig. 3D). The results showed that the r-L. lactis-Tα1-IFN immune enhancer significantly activated the antigen-presenting cells of PBMCs in immunized chickens and improved the immune response.

r- L. lactis -Tα1-IFN improves the structure and composition of the intestinal microbiota in chickens

Heatmap analysis of the top 30 microbiota of the gut microbiota structure at the genus level showed that r-L. lactis-Tα1-IFN significantly altered the intestinal community structure of the cecum compared with the blank control group, and the abundance of microbiota was significantly changed in the r-L. lactis-Tα1-IFN group. In the r-L. lactis-Tα1-IFN group, beneficial probiotics such as Lactobacillus were more abundant, while the abundance of Lachnoclostridium, Ruminococcaceae_UCG-008, unclassified_0_Clostridiales was lower (Fig. 4A). Community Bar-based analysis showed that at the genus level, sample diversity differed between the r-L. lactis-Tα-IFN group and the blank control group, and the abundance of Lactobacillus increased significantly in the r-L. lactis-Tα1-IFN group, whereas Ruminococcaceae_UCG-014, Alistipes, Blautia, norank_ f__Clostridiales_vadinBB60_group, [Ruminococcus]_torques_group, unclassified_f__Lachnospiraceae, Subdoligranulum and others decreased in abundance (Fig. 4B). The alpha diversity index-based analysis showed that the sample diversity differed between the r-L. lactis-Tα1-IFN group and the blank control group, with the r-L. lactis-Tα1-IFN group having greater diversity (Fig. 4C). In addition, Beta diversity analysis of the similarity or difference in the composition structure of sample communities within and between groups, and Pcoa analysis of samples at the OTU level showed that there were differences in the microbiota between the r-L. lactis-Tα1-IFN group and the blank group, with closer substrate distances within groups and farther substrate distances between groups, indicating significant separation of intestinal microbiota, suggesting better sampling in each group (Fig. 4D). LEfSe (linear discriminant analysis (LDA) combined with effect size measurement) analysis showed that the species with higher relative abundance in the r-L. lactis-Tα1-IFN group was g__Lactobacillus, f__Lactobacillaceae, o__Lactobacillales, c__Bacilli, and p__Firmicutes, which all had LDA SCORE (log10) greater than 4.5 (Fig. 4E). These results clearly show that r-L. lactis-Tα1-IFN increases the relative abundance of beneficial microbiota and alters the composition of the gut microbiota. Especially the increase of probiotics such as lactobacillus.

r- L. lactis -Tα1-IFN as an inactivated vaccine immune adjuvant

The results of serum antibody titers in each group showed that after 2 weeks of immunization, the ND antibody titers in the r-L. lactis-Tα1-IFN immune adjuvant group was not significantly different from those in the vaccine control group (P > 0.05; 5B); however, after 3 weeks of immunization, the ND antibody titers in the r-L. lactis-Tα1-IFN immune adjuvant group was extremely different from those in the vaccine control group (P < 0.01; 5B); and after 4 weeks of immunization, the ND antibody titers in the r-L. lactis-Tα1-IFN immune adjuvant group was extremely significantly higher than those in the vaccine control group (vaccine control) (P < 0.0001; 5B).

ELISA results for IFN-γ showed the concentration of IFN-γ in the r-L. lactis-Tα1-IFN immune adjuvant group was extremely significantly higher than that in the vaccine control group at 3 and 7 days of the first immunization (P < 0.0001; Fig. 6A). The concentrations of IFN-γ in the r-L. lactis-Tα1-IFN immune adjuvant group was significantly higher than those in the vaccine control group at 14 days of immunization (P < 0.01; Fig. 6A). And with the extension of immune time, the concentration of IFN- γ was decreased.

IL-4 in the r-L. lactis-Tα1-IFN immune adjuvant group was highly significantly higher than in the vaccine control group at 3 and 7 days of immunization (P < 0.0001; Fig. 6B), and the highest concentration of IL-4 was reached at 7 days after immunization. There was no significant difference in IL-4 concentrations at 14 days of immunization compared with the vaccine control group (P > 0.05; Fig. 6B).

IL-2 was highly significantly higher in the r-L. lactis-Tα1-IFN immunoadjuvant group than in the vaccine control group at 3 days of immunization (P < 0.001; Fig. 6C). IL-2 was highly significantly higher in the r-L. lactis-Tα1-IFN immunoadjuvant group than in the vaccine control group at 7, and 14 days of immunization (P < 0.0001; Fig. 6C).

IL-1β was highly significantly higher in the r-L. lactis-Tα1-IFN immunoadjuvant group than in the vaccine control group at 3, 7, and 14 days of immunization (P < 0.0001; Fig. 6D). The highest concentration of IL-1β was reached at 7 days after immunization, and IL-1β was significantly down-regulated at 14 days.

Proliferative activity assays when PBMCs were co-activated with ConA and PMA showed that after 14 days of immunization, the r-L. lactis-Tα1-IFN immune adjuvant group was extremely significantly higher than that in the vaccine control and blank control group (P < 0.0001; Fig. 6E).

With the continuous deepening research in immunology and the rapid development of genetic engineering technology, researchers have conducted a large number of experiments to develop and construct a variety of different microbial hosts as expression vectors. Most researchers usually apply E. coli expression systems, yeast expression systems, and Streptomyces expression systems for the expression of certain proteins. Each of these expression systems has its advantages and disadvantages [20–24]. Bacillus subtilis has biosafety properties [25] and has been rated as biosafety (GRAS) strain by the US Food and Drug Administration (FDA). The strain expression system has the advantages of a mature process, no inclusion body, and easy isolation and purification of the target gene product, the disadvantage is that the promoter transcription level is low, resulting in some proteins cannot be expressed in large quantities, and there are problems of unstable plasmid isolation and structural instability, cumbersome operation, low transformation efficiency, and other shortcomings limit its application [26–29]. The yeast expression system does not produce toxins, is safe and reliable, and has good activity and stability of expressed protein products, but the characteristics of low secretory protein ability, lack of promoters for efficient expression, and differences between post-translational processed protein products and higher eukaryotes also limit its wider application for exogenous protein production [30, 31]. In this study, a food-safe host strain (food-grade Lactococcus lactis NZ3900 strain) was used as the expression host strain. Food-grade Lactococcus lactis strain NZ3900 evolved from a strain of Lactococcus lactis that has been used in humans and animals for thousands of years and is currently recognized as a food-safe grade probiotic. The food-grade inducer Nisin is also a natural antimicrobial peptide that has been used for hundreds of years [32]. Therefore, the recombinant lactic acid bacteria NZ3900 constructed in this study and the natural thymus peptide and interferon expressed in this study fully meet the requirements of biosafety and green food safety.

In this study, we found that r-L. lactis-Tα1-IFN induced high levels of IFN-γ and IL-4 production in immune cells both in vivo and in vitro. In the immune system, Th1 and Th2 belong to two different CD₄⁺ T cell subsets, which secrete two different types of cytokines and play different immunomodulatory roles. Th1 cells and Th1 cytokines mainly mediate cellular immune response, IFN-γ is a typical Th1 cytokine, which is mainly produced in activated T cells, NK cells, activated macrophages, and a small number of NKT cells, its main function is to promote cellular immune response, promote the development and differentiation of lymphocytes and macrophages, and inhibit the secretion of Treg cytokines. It is also a pro-inflammatory and anti-infective cytokine that plays a key role in antiviral immune response and immunomodulation in viral and cancer immunity [33]. Th2 cells and Th2-type cytokines mainly regulate humoral immune response [34, 35], and IL-4 is a representative cytokine secreted by Th2 cells and is mainly produced by activated T cells. IL-4 can activate T cells, B cells, and macrophages, mainly activate the humoral immune response, promote antibody production, and it is also a multifunctional cytokine that plays an important regulatory role in the immune system, IL-4 can be used as a chemokine of macrophages, which can promote the antigen presentation of macrophages and inhibit the production of monocyte inflammatory cytokines IL-1, TNF, and IL-6. This study showed that injection of r-L. lactis-Tα1-IFN as an immune adjuvant produced high levels of IFN-γ and IL-4 after 3 days of immunization, indicating that cellular and humoral immune responses can be activated simultaneously.

In the present study, we used r-L. lactis-Tα1-IFN as an immune adjuvant for the inactivated vaccine, which induced high levels of cytokine IL-2 in the organism after 2 weeks, IL-2 is mainly secreted by T lymphocytes, is a key cytokine to induce T cell proliferation, can activate a variety of immune cells, induce T lymphocytes, NK cells, B cells and monocyte macrophages proliferation and differentiation [33], and the results of IL-2 in this study suggest that r-L. lactis-Tα1-IFN acts as an immune adjuvant and consistently promotes a high level of cellular immune response over 2 weeks. The present study also found that r-L. lactis-Tα1-IFN as an immune adjuvant for inactivated vaccine induced high levels of the pro-inflammatory cytokine IL-1β within 1 week, but then significantly decreased after 1 week. IL-1β is a typical major pro-inflammatory cytokine, which plays an important role in the occurrence and development of inflammation, IL-1β is mainly produced by monocytes and macrophages of pro-inflammatory cytokines, it can promote the production of IL-4, and local low concentration of IL-1β can synergistically stimulate the activation of APC and T cells, promote the proliferation of B cells and the secretion of antibodies, so the production and appropriate concentration of IL-1β is also necessary for an early immune response [36]. In the present study, IL-1β was significantly higher in r-L. lactis-Tα1-IFN injected as an immune adjuvant than in the vaccine control and blank groups after 3 and 7 days of immunization but significantly decreased after 14 days of immunization, and the difference was not significant compared with the vaccine control and blank groups, and the results of IL-1β detection suggested that r-L. lactis-Tα1-IFN injected as an immune adjuvant did not lead to a strong inflammatory response and over-activation of the body's immune system, suggesting that injection of r-L. lactis-Tα1-IFN could both activate the immune response and maintain immune homeostasis.

In this study, we performed a study of intestinal microbiota 16S analysis after injection of r-L. lactis-Tα1-IFN. Intestinal flora 16S analysis mostly uses OTUs to analyze the composition and structure of intestinal communities, alpha and beta diversity analysis, LEfSe analysis, and other indicators for overall analysis and evaluation [37–39]. The results of this study showed that injection of r-L. lactis-Tα1-IFN as an immune booster or immune adjuvant could induce large changes in the composition and structure of the intestinal microbiota in the gut, and the relative reduction in the abundance of the Phylum Proteobacteria in this experiment suggested that the intestinal microbiota could maintain a relatively stable intestinal microbial community structure after injection of r-L. lactis-Tα1-IFN. Our results also revealed that beneficial probiotics such as Lactobacillus, Phylum Bacillus, Blautia, and ruminococcus were more abundant, and they became the main genera of the intestinal microbiota of cecum contents, among which the Lactobacillus genus played an important role in shaping intestinal microbiota, and some of these strains could produce anti-microbial compounds such as hydrogen peroxide and short-chain fatty acids, which inhibit pathogen invasion and help maintain intestinal health [40], and our available findings suggest that the significant increase of Lactobacillus spp. improved the intestinal microbiota composition.

In the phylum Bacteroides, members of the order Bacteroides are the most abundant gram-negative microbiota. Since the Bacteroides phylum is an important core flora in the gastrointestinal tract of mammals, there is a co-evolutionary relationship between them and the mammalian host, and studies have proved that it has a profound beneficial effect on the host's immune system [41, 42]. A significant increase of Bacteroides in our study suggests a beneficial change in the composition of the intestinal flora after r-L. lactis-Tα1-IFN injection.

The Blautia is also one of the important core bacteria genera in the intestinal tract of animals, which can inhibit pathogenic bacteria and have anti-inflammatory effects, which have certain contributions to the alleviation of inflammatory diseases and metabolic diseases [43]; and it is also a cornerstone microbiota in the intestine that stabilizes the intestinal barrier and plays a crucial role in metabolism [44]. The results of this study showed that injection r-L. lactis-Tα1-IFN as an immune enhancer or immune adjuvant, it significantly increases the abundance of beneficial probiotic groups such as Lactobacillus, Bacteroides, Blautia, ruminococcus, etc., reconstructs and improves the intestinal flora of chickens, promotes the increase of probiotic abundance, inhibits gram-negative bacteria and pathogenic bacteria, and these increased beneficial microbiotas can comprehensively regulate immune response, promote immune response, maintain immune balance and other functions through the gut-immune axis, It is of great significance for maintaining local intestinal integrity and the stability of the environment throughout the body.

In this study, natural Tα1-IFN fusion protein was expressed by food-grade Lactococcus lactis, and recombinant Tα1-IFN fusion protein was used as an immune enhancer or immune adjuvant. On the one hand, it demonstrated strong immunomodulatory and immune enhancement activity in vivo and in vivo, which could simultaneously activate and improve the cellular and humoral immune response, and maintain the body's immune regulation homeostasis. On the other hand, injection of recombinant Tα1-IFN as an immune adjuvant or immune enhancer could significantly improve the structure and composition of the intestinal microbiota, increase the abundance of probiotics, and fully maintain the homeostasis of the environment in vivo. Recombinant r-L. lactis-Tα1-IFN has great potential for application as a vaccine immune adjuvant, and this study has important reference significance for the research and application of novel vaccine adjuvants.

Acknowledgments

The authors would like to thank colleagues and collaborators who contributed to these studies. Special thanks to Prof. Cui Hongyu for his help and constructive suggestions.

Ethics statement

Ethics Approval, all animal experiments, such as the generation of antisera from SPF chickens and immune protection tests of probiotics, were carried out according to protocols approved by the ethical review board of Harbin Veterinary Research Institute (HVRI) of the Chinese Academy of Agricultural Sciences (CAAS) and performed by approved animal care guidelines and protocols. The animal ethics committee approval number is SYXK (Heilongjiang) 2011022.

Declaration of interests

No potential conflicts of interest were disclosed.

Contributors

H.C. and G.H. designed the research; H.C. and Z.L. wrote the manuscript; Z.L. performed the experiment and analyzed data; S.Z., H.H., H.W., Y.Q., M.D., M.W., and Z.C., critically revised the manuscript. All of the authors reviewed the manuscript and approved the final version.

Competing interests

The authors declare that they have no competing interests.

Author details

¹College of Animal Science and Technology, Shihezi University, Shihezi 832003, Xinjiang, China. ²Harbin Guosheng Biotechnology Co., Ltd., Harbin 150028, China. ³Clinical Medical College, Hebei North University, Zhangjiakou 075000, China. ⁴State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150069, China.

Gutjahr A, Tiraby G, Perouzel E, Verrier B, Paul S. Triggering Intracellular Receptors for Vaccine Adjuvantation. Trends Immunol. 2016;37:573-87. https://doi.org/10.1016/j.it.2016.07.001.
Banday AH, Jeelani S, Hruby VJ. Cancer vaccine adjuvants--recent clinical progress and future perspectives. Immunopharmacol Immunotoxicol. 2015;37:1-11. https://doi.org/10.3109/08923973.2014.971963.
Wang W, Li Y, Wang Y, Ren S, Li Y, Wang B. Polyactin A is a novel and potent immunological adjuvant for peptide-based cancer vaccine. Int Immunopharmacol. 2018;54:95-102. https://doi.org/10.1016/j.intimp.2017.10.020.
Cai J, Li X, Du H, Jiang C, Xu S, Cao Y. Immunomodulatory significance of natural peptides in mammalians: Promising agents for medical application. Immunobiology. 2020;225:151936. https://doi.org/10.1016/j.imbio.2020.151936.
King R, Tuthill C. Immune Modulation with Thymosin Alpha 1 Treatment. Vitam Horm. 2016;102:151-78. https://doi.org/10.1016/bs.vh.2016.04.003.
Franco FJ, Diaz C, Barcia M, Freire M. Thymosin alpha 1 is a native peptide in several tissues. Biochim Biophys Acta. 1992;1120:43-8. https://doi.org/10.1016/0167-4838(92)90422-a.
Hoch K, Volk DE. Structures of Thymosin Proteins. Vitam Horm. 2016;102:1-24. https://doi.org/10.1016/bs.vh.2016.04.009.
Matteucci C, Minutolo A, Sinibaldi-Vallebona P, Palamara AT, Rasi G, Mastino A, Garaci E. Transcription profile of human lymphocytes following in vitro treatment with thymosin alpha-1. Ann N Y Acad Sci. 2010;1194:6-19. https://doi.org/10.1111/j.1749-6632.2010.05484.x.
Sztein MB, Serrate SA. Characterization of the immunoregulatory properties of thymosin alpha 1 on interleukin-2 production and interleukin-2 receptor expression in normal human lymphocytes. Int J Immunopharmacol. 1989;11:789-800. https://doi.org/10.1016/0192-0561(89)90133-1.
Garaci E, Pica F, Rasi G, Favalli C. Thymosin alpha 1 in the treatment of cancer: from basic research to clinical application. Int J Immunopharmacol. 2000;22:1067-76. https://doi.org/10.1016/s0192-0561(00)00075-8.
Wang X, Zeng X, Yang B, Zhao S, Chen W, Guo X. Efficacy of thymosin α1 and interferon α for the treatment of severe acute pancreatitis in a rat model. Mol Med Rep. 2015;12:6775-81. https://doi.org/10.3892/mmr.2015.4277.
Garaci E, Mastino A, Favalli C. Enhanced immune response and antitumor immunity with combinations of biological response modifiers. Bull N Y Acad Med. 1989;65:111-9.
Seegers JF. Lactobacilli as live vaccine delivery vectors: progress and prospects. Trends Biotechnol. 2002;20:508-15. https://doi.org/10.1016/s0167-7799(02)02075-9.
Jung YJ, Lee YT, Ngo VL, Cho YH, Ko EJ, Hong SM, Kim KH, Jang JH, Oh JS, Park MK, Kim CH, Sun J, Kang SM. Heat-killed Lactobacillus casei confers broad protection against influenza A virus primary infection and develops heterosubtypic immunity against future secondary infection. Sci Rep. 2017;7:17360. https://doi.org/10.1038/s41598-017-17487-8.
Bron PA, van Baarlen P, Kleerebezem M. Emerging molecular insights into the interaction between probiotics and the host intestinal mucosa. Nat Rev Microbiol. 2011;10:66-78. https://doi.org/10.1038/nrmicro2690.
Ishii M, Nishida S, Kataoka K, Nishiyama Y, Abe S, Sekimizu K. Lactic acid bacteria of the Leuconostoc genus with high innate immunity-stimulating activity. Drug Discov Ther. 2017;11:25-9. https://doi.org/10.5582/ddt.2016.01078.
Lee Y, Lee TS. Enhancement in ex vivo phagocytic capacity of peritoneal leukocytes in mice by oral delivery of various lactic-acid-producing bacteria. Curr Microbiol. 2005;50:24-7. https://doi.org/10.1007/s00284-004-4377-5.
Wyszyńska A, Kobierecka P, Bardowski J, Jagusztyn-Krynicka EK. Lactic acid bacteria--20 years exploring their potential as live vectors for mucosal vaccination. Appl Microbiol Biotechnol. 2015;99:2967-77. https://doi.org/10.1007/s00253-015-6498-0.
Platteeuw C, van Alen-Boerrigter I, van Schalkwijk S, de Vos WM. Food-grade cloning and expression system for Lactococcus lactis. Appl Environ Microbiol. 1996;62:1008-13. https://doi.org/10.1128/aem.62.3.1008-1013.1996.
Sung WL, Zahab DM, Barbier JR, Watson D, Yaguchi M, Neugebauer W, Willick GE. Specific degenerate codons enhanced selective expression of human parathyroid hormone in Escherichia coli. J Biol Chem. 1991;266:2831-5.
Chen H, Xu Z, Cen P. High-level expression of human beta-defensin-2 gene with rare codons in E. coli cell-free system. Protein Pept Lett. 2006;13:155-62. https://doi.org/10.2174/092986606775101724.
Graumann K, Premstaller A. Manufacturing of recombinant therapeutic proteins in microbial systems. Biotechnol J. 2006;1:164-86. https://doi.org/10.1002/biot.200500051.
Makino T, Skretas G, Georgiou G. Strain engineering for improved expression of recombinant proteins in bacteria. Microb Cell Fact. 2011;10:32. https://doi.org/10.1186/1475-2859-10-32.
Chen R. Bacterial expression systems for recombinant protein production: E. coli and beyond. Biotechnol Adv. 2012;30:1102-7. https://doi.org/10.1016/j.biotechadv.2011.09.013.
Morello E, Bermúdez-Humarán LG, Llull D, Solé V, Miraglio N, Langella P, Poquet I. Lactococcus lactis, an efficient cell factory for recombinant protein production and secretion. J Mol Microbiol Biotechnol. 2008;14:48-58. https://doi.org/10.1159/000106082.
Bron S, Meijer W, Holsappel S, Haima P. Plasmid instability and molecular cloning in Bacillus subtilis. Res Microbiol. 1991;142:875-83. https://doi.org/10.1016/0923-2508(91)90068-l.
Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, Azevedo V, Bertero MG, Bessières P, Bolotin A, Borchert S, Borriss R, Boursier L, Brans A, Braun M, Brignell SC, Bron S, Brouillet S, Bruschi CV, Caldwell B, Capuano V, Carter NM, Choi SK, Cordani JJ, Connerton IF, Cummings NJ, Daniel RA, Denziot F, Devine KM, Düsterhöft A, Ehrlich SD, Emmerson PT, Entian KD, Errington J, Fabret C, Ferrari E, Foulger D, Fritz C, Fujita M, Fujita Y, Fuma S, Galizzi A, Galleron N, Ghim SY, Glaser P, Goffeau A, Golightly EJ, Grandi G, Guiseppi G, Guy BJ, Haga K, Haiech J, Harwood CR, Hènaut A, Hilbert H, Holsappel S, Hosono S, Hullo MF, Itaya M, Jones L, Joris B, Karamata D, Kasahara Y, Klaerr-Blanchard M, Klein C, Kobayashi Y, Koetter P, Koningstein G, Krogh S, Kumano M, Kurita K, Lapidus A, Lardinois S, Lauber J, Lazarevic V, Lee SM, Levine A, Liu H, Masuda S, Mauël C, Médigue C, Medina N, Mellado RP, Mizuno M, Moestl D, Nakai S, Noback M, Noone D, O&#x27, Reilly M, Ogawa K, Ogiwara A, Oudega B, Park SH, Parro V, Pohl TM, Portelle D, Porwollik S, Prescott AM, Presecan E, Pujic P, Purnelle B, Rapoport G, Rey M, Reynolds S, Rieger M, Rivolta C, Rocha E, Roche B, Rose M, Sadaie Y, Sato T, Scanlan E, Schleich S, Schroeter R, Scoffone F, Sekiguchi J, Sekowska A, Seror SJ, Serror P, Shin BS, Soldo B, Sorokin A, Tacconi E, Takagi T, Takahashi H, Takemaru K, Takeuchi M, Tamakoshi A, Tanaka T, Terpstra P, Togoni A, Tosato V, Uchiyama S, Vandebol M, Vannier F, Vassarotti A, Viari A, Wambutt R, Wedler H, Weitzenegger T, Winters P, Wipat A, Yamamoto H, Yamane K, Yasumoto K, Yata K, Yoshida K, Yoshikawa HF, Zumstein E, Yoshikawa H, Danchin A. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature. 1997;390:249-56. https://doi.org/10.1038/36786.
Ming-Ming Y, Wei-Wei Z, Xi-Feng Z, Pei-Lin C. Construction and characterization of a novel maltose inducible expression vector in Bacillus subtilis. Biotechnol Lett. 2006;28:1713-8. https://doi.org/10.1007/s10529-006-9146-z.
Schumann W. Production of recombinant proteins in Bacillus subtilis. Adv Appl Microbiol. 2007;62:137-89. https://doi.org/10.1016/S0065-2164(07)62006-1.
Matsushika A, Sawayama S. Comparative study on a series of recombinant flocculent Saccharomyces cerevisiae strains with different expression levels of xylose reductase and xylulokinase. Enzyme Microb Technol. 2011;48:466-71. https://doi.org/10.1016/j.enzmictec.2011.02.002.
Liu Z, Tyo KE, Martínez JL, Petranovic D, Nielsen J. Different expression systems for production of recombinant proteins in Saccharomyces cerevisiae. Biotechnol Bioeng. 2012;109:1259-68. https://doi.org/10.1002/bit.24409.
Takala TM, Saris P. C terminus of NisI provides specificity to nisin. Microbiology (Reading). 2006;152:3543-9. https://doi.org/10.1099/mic.0.29083-0.
Lasfar A, Zloza A, Cohen-Solal KA. IFN-lambda therapy: current status and future perspectives. Drug Discov Today. 2016;21:167-71. https://doi.org/10.1016/j.drudis.2015.10.021.
Seremet T, Brasseur F, Coulie PG. Tumor-specific antigens and immunologic adjuvants in cancer immunotherapy. Cancer J. 2011;17:325-30. https://doi.org/10.1097/PPO.0b013e3182326004.
McElhaney JE, Coler RN, Baldwin SL. Immunologic correlates of protection and potential role for adjuvants to improve influenza vaccines in older adults. Expert Rev Vaccines. 2013;12:759-66. https://doi.org/10.1586/14760584.2013.811193.
Yazdi AS, Ghoreschi K. The Interleukin-1 Family. Adv Exp Med Biol. 2016;941:21-9. https://doi.org/10.1007/978-94-024-0921-5_2.
Bäckhed F, Ding H, Wang T, Hooper LV, Koh GY, Nagy A, Semenkovich CF, Gordon JI. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A. 2004;101:15718-23. https://doi.org/10.1073/pnas.0407076101.
Atarashi K, Tanoue T, Shima T, Imaoka A, Kuwahara T, Momose Y, Cheng G, Yamasaki S, Saito T, Ohba Y, Taniguchi T, Takeda K, Hori S, Ivanov II, Umesaki Y, Itoh K, Honda K. Induction of colonic regulatory T cells by indigenous Clostridium species. Science. 2011;331:337-41. https://doi.org/10.1126/science.1198469.
Kers JG, Velkers FC, Fischer E, Hermes G, Stegeman JA, Smidt H. Host and Environmental Factors Affecting the Intestinal Microbiota in Chickens. Front Microbiol. 2018;9:235. https://doi.org/10.3389/fmicb.2018.00235.
Drissi F, Raoult D, Merhej V. Metabolic role of lactobacilli in weight modification in humans and animals. Microb Pathog. 2017;106:182-94. https://doi.org/10.1016/j.micpath.2016.03.006.
Troy EB, Kasper DL. Beneficial effects of Bacteroides fragilis polysaccharides on the immune system. Front Biosci (Landmark Ed). 2010;15:25-34. https://doi.org/10.2741/3603.
Xu L, Zhou J, Qu G, Lin Z, Fan Q, Wang C, Wang Q. Recombinant lactobacillin PlnK adjusts the gut microbiome distribution in broilers. Br Poult Sci. 2020;61:390-9. https://doi.org/10.1080/00071668.2020.1752911.
Liu X, Mao B, Gu J, Wu J, Cui S, Wang G, Zhao J, Zhang H, Chen W. Blautia-a new functional genus with potential probiotic properties. Gut Microbes. 2021;13:1-21. https://doi.org/10.1080/19490976.2021.1875796.
Graziani F, Pujol A, Nicoletti C, Dou S, Maresca M, Giardina T, Fons M, Perrier J. Ruminococcus gnavus E1 modulates mucin expression and intestinal glycosylation. J Appl Microbiol. 2016;120:1403-17. https://doi.org/10.1111/jam.13095.

No competing interests reported.

Download PDF

Journal Publication

published 06 Feb, 2024

Read the published version in Microbial Cell Factories →

Editorial decision: Major revision
02 Aug, 2023
Reviews received at journal
02 Aug, 2023
Reviewers agreed at journal
01 Aug, 2023
Reviews received at journal
28 Feb, 2023
Reviewers agreed at journal
11 Feb, 2023
Reviewers agreed at journal
14 Nov, 2022
Reviewers invited by journal
07 Nov, 2022
Editor assigned by journal
07 Nov, 2022
Submission checks completed at journal
07 Nov, 2022
First submitted to journal
06 Nov, 2022

You are reading this latest preprint version

Construction of recombinant Lactococcus expressing thymosin and interferon fusion protein and its application as an immune adjuvant

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Strains, Cells, And Reagents

Construction Of Recombinant Plasmids And Recombinant Lactococcus

Nisin-induced Expression And Western Blotting Analysis

Quantification Of Recombinant Protein (Tα1-ifn) And Preparation Of Recombinant Protein Mixture

The Recombinant Protein (Tα1-ifn) And Macrophage J774 Dual ™ Interaction

Recombinant Proteins (Tα1-ifn) Interact With Pbmcs

Determination Of Pbmcs Cell Proliferation Activity

Analysis Of Intestinal Microbiota 16s Diversity

Detection Of Serum Antibody Titer By Hemagglutination Inhibition Test

Detection Of Cytokines

Experimental Chickens And Animal Experimental Design

Data Statistical Analysis

Results

Construction Of Recombinant Lactococcus And Induced Expression Of The Target Protein

r- L. lactis -Tα1-IFN activates IRF and NF-κB signaling pathways of macrophages in vitro

r- L. lactis -Tα1-IFN activates PBMCs in vitro

Animal experiments to verify the immune enhancer activity of r- L. lactis -Tα1-IFN

r- L. lactis -Tα1-IFN improves the structure and composition of the intestinal microbiota in chickens

r- L. lactis -Tα1-IFN as an inactivated vaccine immune adjuvant

Discussion

Declarations

Acknowledgments

Ethics statement

Declaration of interests

Contributors

Competing interests

Author details

References

Additional Declarations

Status:

Journal Publication

Version 1