Quercetin alleviates cadmium-induced BRL-3A cell apoptosis by inhibiting oxidative stress and the PERK/IRE1α/ATF6 signaling pathway

doi:10.21203/rs.3.rs-2245667/v1

Download PDF

Research Article

Quercetin alleviates cadmium-induced BRL-3A cell apoptosis by inhibiting oxidative stress and the PERK/IRE1α/ATF6 signaling pathway

https://doi.org/10.21203/rs.3.rs-2245667/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The highly toxic heavy metal cadmium (Cd) can enter the body through biological enrichment. As an essential metabolic organ in the body, the liver is an important target organ of Cd poisoning. Quercetin (Que) is a type of flavonoid that exhibits the pharmacological activities of scavenging free radicals and antioxidation. 4-Phenylbutyrate (4-PBA) can alleviate endoplasmic reticulum stress (ERS) and is frequently considered an inhibitor of ERS. Previous studies have shown that Que can alleviate rat hepatocyte apoptosis caused by Cd; however, the mechanism remains unclear. To explore the specific mechanism of Que that alleviates Cd-induced hepatocyte apoptosis, we established a model of Cd toxicity and Que rescue in BRL-3A cells and used 4-PBA, an ERS inhibitor, as positive control. Cell Counting Kit-8 was employed to measure cell viability. Fluorescence staining was applied to observe cell apoptosis. Flow cytometry was performed to detect reactive oxygen species levels. Real-time quantitative polymerase chain reaction was adopted to detect the messenger RNA expression levels of ERS and apoptosis-related genes. Western blot was used to observe the expression levels of ERS/apoptosis-related proteins. We confirmed that Que could alleviate the apoptosis caused by Cd in BRL-3A cells by inhibiting the PERK/IRE1α/ATF6 ERS signaling pathway. The effects of Que were similar to those of ERS inhibitors.

Cadmium

Endoplasmic reticulum stress

Oxidative stress

Apoptosis

Cadmium (Cd) is a highly toxic pollutant that can enter the human body through biological accumulation and cause organ damage. In serious cases, Cd can lead to cancer^[1]. Weak acid-soluble and reducible Cd is harmful to humans, animals, and plants. The improper discharge of industrial wastewater is considered an important cause of Cd pollution^[2]. Cd can enter the food chain through groundwater migration and plant enrichment; then, it enters the human body through daily diet and respiration^[3]. After it enters the body, Cd combines with erythrocyte albumin, enters the blood^[4], and accumulates in the liver, kidney, and other tissues, resulting in diseases of the liver, kidney, testis, bone, and other organs and tissues. As an important metabolic organ, the liver participates in the synthesis and metabolism of substances; it is the key target organ of Cd poisoning^{[5, 6]}. Studies have shown that reactive oxygen species (ROS) accumulation and oxidative stress caused by Cd exposure are important causes of liver diseases, and the liver can resist damage caused by Cd through the synthesis of metallothionein to alleviate Cd poisoning^[7]. In addition to the tissue damage caused by Cd, Cd has also been proven to cause hepatocyte apoptosis by activating endoplasmic reticulum stress (ERS) and mitochondrial damage^{[8, 9]}.

The endoplasmic reticulum (ER) is the organelle responsible for maintaining normal growth and development in cells. ER is in a stable state under normal conditions^[10]. ER stress causes unfolded and misfolded proteins to accumulate in the ER. The activation of unfolded protein response (UPR) is an important mechanism of the body for maintaining homeostasis^[11]. When UPR occurs, glucose regulatory protein 78 (GRP78) dissociates from ERS sensor proteins, such as protein kinase RNA-like ER kinase (PERK), inositol-requiring kinase 1 (IRE1α), and activating transcription factor 6 (ATF6), resulting in the phosphorylation or activation of PERK, IRE1α, and ATF6, and further activating the eukaryotic translation initiation factor 2α (eIF2α) of downstream key target proteins, activating transcription factor 4 (ATF4), C/EBP-homologous protein (CHOP), and X-box binding protein 1 (XBP1)^[12]. ROS accumulation and oxidative stress are important causes of ERS, and excessive ERS ultimately leads to cell apoptosis^[13].

Flavonoids reduce the toxicity of heavy metals in vivo and in vitro. Feasibility studies on flavonoids as a protective agent against heavy metal poisoning are being conducted extensively^[10]. Quercetin (Que) is a natural plant flavonoid from the flavonoid family; it has many pharmacological activities, such as improving vascular homeostasis, antiplatelet, anti-inflammatory, antioxidant, and free radical scavenging^[14]. Que has been reported to treat inflammation, diabetes, cancer, cardiovascular diseases, and other health problems^[15]. Que is widely distributed in fruits and vegetables, and it has been certified by the US Food and Drug Administration (FDA)^[16]. Some studies have shown that the potential mechanism of Que-induced anti-apoptosis is to inhibit ERS^[17]. Several experiments have proven that Que can regulate ERS in various ways ^[18].

4-Phenylbutyrate (4-PBA) can promote protein folding; it is a chaperone protein and considered an ERS inhibitor because it can promote the folding of unfolded proteins^{[19, 20]}. Studies have shown that ERS is the pathogenesis of many diseases, and 4-PBA exhibits the ability to alleviate ERS^[21]. Research has demonstrated that as a chaperone of unfolded proteins, 4-PBA can rescue cells from apoptosis by reducing ERS^[22].

Previous studies of our results have confirmed that ERS plays a key role in Cd-induced rat hepatocyte apoptosis^[23]. Que can reduce Cd-induced rat hepatocyte apoptosis, but whether it can alleviate Cd-induced rat hepatocyte apoptosis by reducing oxidative stress and ERS and its specific mechanism remain unclear. Therefore, the current experiment established a model of Cd poisoning and Que treatment in BRL-3A rat hepatocytes and added the ERS inhibitor 4-PBA. Real-time quantitative polymerase chain reaction (qRT-PCR), Western blot, and flow cytometry were employed to explore the specific mechanism by which Que alleviates Cd-induced BRL-3A cell apoptosis, providing a theoretical basis for the clinical application of Que.

2.1 Reagents

Que (98%) (No. 21637-25-2) was purchased from Beijing Bailingwei Technology Co., Ltd. CdCl₂ (99.95%) (No.7790-78-5) and 4-PBA (99%) (No. 1821-12-1) were bought from Shanghai Sigma Biochemical Technology Co., Ltd. 5×Protein loading buffer (No. CR2110105) and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) gel preparation kit (No. G2003-50T) were procured from Wuhan Servicebio Technology Co., Ltd. Cell Counting Kit (CCK)-8 (No. BS350B) was obtained from Beijing Labigc Technology Co., Ltd. Total RNA extraction reagent TRIzol (No. R401-1), HiScript III RT SuperMix for qPCR (+ gDNA wiper) reverse transcription kit (No. R323-01), and ChamQ Universal SYBR qPCR Master Mix kit (No. Q711) were acquired from Nanjing Novizin Biotechnology Co., Ltd. Anti-GRP78 (No. PA1815) primary antibody was purchased from Boster Biological Technology Co. Ltd. Anti-PERK (No. ab229912), anti-eIF2α (No. ab169528), and anti-ATF4 (No. A18687) primary antibodies were bought from Abcom Ltd.. Anti-CHOP (No. GADD153), anti-IRE1α (No. 27528-1-AP), anti-XBP1 (No. 24868-1-AP), anti-ATF6 (No. 24169-1-AP), anti-Caspase-12 (No. 55238-1-AP), anti-Bax (No. 60267-1-Ig), and anti-Bcl2 (No. 60178-1-Ig) primary antibodies were procured from Proteintech Group, Illinois, USA. Anti-Caspase-3 (No. A2156) and anti-β-actin (No. AC004) primary antibodies were acquired from ABclonal Technology Co., Ltd. Horseradish peroxidase-conjugated goat anti-rabbit/mouse IgG (No. HA1006/HA1001) second antibody was purchased from Huaan Biotechnology Co., Ltd. Electrogenerated chemiluminescence (ECL) hypersensitive reagents (No. P0018F) were obtained from Beyotime.

2.2 Cell cultures and treatments

The culture of BRL-3A cells was performed in accordance with a method presented in a previous study^[23]. A petri dish was placed in a 5% CO₂ incubator at 37 ℃. The adherent state of the cells was observed 4 h after inoculation. The cells were subcultured when they proliferated to about 70%. In accordance with the requirements of subsequent tests, the cells were inoculated into 10 mL petri dishes, 6-well plates, or 96-well plates for culturing. Que and/or 4-PBA of different concentrations were added to the cell culture medium for 24 h for the subsequent experiments.

2.3 Cellular viability assay

In accordance with the characteristics of WST-8, BRL-3A cell viability was detected via the CCK-8 method. WST-8 can be reduced using the electron coupling reagent 1-methoxy PMS to produce orange formazan dye precipitate. BRL-3A cells were digested and collected using trypsin and inoculated into 96-well plates at about 2000 cells/well^[24]. After cell adherent growth, Que and/or 4-PBA of different concentrations were added to the cell culture medium for 24 h. Thereafter, 10 µL of CCK-8 reagent was added to each well. The absorbance value at 450 nm was measured after incubation in the dark for 1 h.

2.4 Cell morphology analysis

Cells were digested and collected using trypsin and evenly cultured in 100 mm petri dishes. After the cells proliferated by about 80%, appropriate concentrations of CdCl₂, Que, and 4-PBA were added separately. Cell morphology was observed with an inverted microscope after 24 h of culture.

2.5 Flow cytometry

ROS levels in BRL-3A cells were detected via DCFH-DA staining. After the cells were treated overnight with CdCl₂, Que, and/or 4-PBA, the cells were digested and collected into centrifuge tubes by using trypsin, and the supernatant was discarded. Then, 10 µM of DCFH-DA was added, and the centrifuge tube was incubated in a cell incubator for 20 min while shaking it every 5 min. Thereafter, phosphate-buffered saline (PBS) was used to wash and remove the residual probe two times. After flow cytometry, Flowjo-V10 was used to analyze ROS levels.

2.6 Hoechst 33342 staining

The Hoechst 33342 method was used to detect apoptosis. Hoechst 33342 can pass through the cell membrane to stain the nucleus with DNA. It can combine with double-stranded DNA and emit blue fluorescence in the cell. After trypsin digestion, the cells were evenly cultured in a six-well plate. After the cells proliferated by about 70%, they were treated with CdCl₂, Que, and/or 4-PBA separately. After overnight incubation in the cell incubator, the cells were washed with PBS, and then 1 mL of Hoechst 33342 dye was added to each well. After 20 min of incubation in the dark at 37 ℃, excess dye was washed away with PBS. Then, apoptosis was observed via inverted fluorescence microscopy.

2.7 qRT-PCR

After the cells inoculated into the cell culture dish were treated overnight with CdCl₂, Que, and/or 4-PBA, the culture medium was discarded and washed two times with PBS. Then, 1 mL of TRIzol reagent was added. The lysed cells were ground thoroughly with a cell scraper, and the total RNA of the cells was extracted in accordance with previous studies. Purity and concentration were measured using electrophoresis and nucleic acid concentration determination. The HiScript III RT SuperMix for qPCR (+ gDNA wiper) reverse transcription kit was used for RNA reverse transcription, and the ChamQ Universal SYBR qPCR Master Mix kit was used for real-time PCR. β-Actin was selected as an internal parameter. The relative expression level of messenger RNA (mRNA) was calculated using the 2^−ΔΔCt method. The primer sequences of relevant genes are provided in Table 1 and synthesized by Shanghai Shenggong Bioengineering Co., Ltd.

Table 1

List of primer sequences in this study.
Gen bank No.	Genes	Primers used for PCR (5→3′)	Products (bp)
NM_178021.1	GRP78	F:ATGGTGTGGGAGATCCTGTTTTC	124
		R:CAAGACGCACAGGGATACGC
NM_031599.2	PERK	F:ACAAGGCTGTCACTCAGGTG	121
		R:GCTAGGAGCCTTGGAGCAC
NM_001399818.1	eIF2α	F:TTTCCGGGACAAGATGGCG	87
		R:AAGTGTGGGGGTCCATTCAC
NM_024403.2	ATF4	F:TGTTGGCGGGGGACTTAATG	200
		R:AAAGGCATCCTCCTTGCCG
NM_001109986.1	CHOP	F:CTGGGAAACAGCGCATGAAG	121
		R:GTGGTCTCTACCTCCCTGGT
NM_001191926.1	IRE1α	F:GCGCAGGTGCAATGACATAC	98
		R:CATGCAAACTTCCGTCCAGG
NM_001271731.1	XBP1	F:CTGAGTCCGCAGCAGGTG	188
		R:GACCTCTGGGAGTTCCTCCA
NM_001107196.1	ATF6	F:TCATGGACCAGGTGAAGACT	169
		R:GGGGCTCCATATGTCTGACTC
NM_130422.1	Caspase-12	F:TCGGAGAAGGAGCGAGCTTA	121
		R:AGCTGTTTGTCGGAATTGGC
NM_012922.2	Caspase-3	F:GGAGCTTGGAACGCGAAGAA	169
		R:ACACAAGCCCATTTCAGGGT
NM_017059.2	Bax	F:CACGTCTGCGGGGAGT	189
		R:CATCCTCTCTGCTCGATCCTG
NM_016993.2	Bcl2	F:AGCATGCGACCTCTGTTTGA	108
		R:TCACTTGTGGCCCAGGTATG
NM_031144.3	β-actin	F:CACCCGCGAGTACAACCTT	72
		R:TCATCCATGGCGAACTGGTG

2.8 Cell total protein extraction

After the cells were treated overnight with CdCl₂, Que, and/or 4-PBA, the culture medium was discarded and the cells were washed two times with PBS. Then, 100 µL of radioimmunoprecipitation assay mixed lysate was added, and the lysed cells were thoroughly ground with a cell scraper. The lysed mixture was transferred to a centrifuge tube. Then, the supernatant, i.e., the total protein solution of the cells, was collected after centrifugation. A bicinchoninic acid kit was used to measure the protein concentration and adjust the total cell protein to 5 µg/uL. Then, four times of the 5×protein loading buffer was added to the total protein solution. After mixing fully, protein was denatured in a water bath for 10 min. The denatured protein samples were stored in an ultralow-temperature refrigerator at − 80 ℃ for subsequent experiments.

2.9 Western blot analysis

The SDS–PAGE gel preparation kit was used to prepare SDS polyacrylamide gel. After adding the sample, electrophoresis was performed to separate the protein. Then, the sample protein was transferred onto a PVDF membrane via the wet sandwich membrane transfer method. After the sample protein was transferred, the PVDF membrane was blocked by immersing in 5% skim milk powder for 2 h. The incubation box was placed on a shaking table to ensure complete closure. After washing excess milk with TBST, anti-GRP78 (1:700), anti-PERK (1:1000), anti-eIF2α (1:1000), anti-ATF4 (1:300), anti-CHOP (1:1000), anti-ATF6 (1:3000), anti-IRE1α (1:2000), anti-XBP1 (1:500), anti-Caspase-12 (1:1000), anti-Caspase-3 (1:3000), anti-Bax (1:10000), anti-Bcl2 (1:1000), and anti-β-actin (1:7000) primary antibodies were added separately. The resulting solutions were placed on a shaking table for overnight incubation at 4 ℃. Then, TBST was used to wash away the excess primary antibodies. The horseradish peroxidase-conjugated goat anti-rabbit/mouse IgG (1:20000) secondary antibody was added and incubated for 1 h. Then, the excess secondary antibodies were washed off with TBST. The surface of the PVDF film was evenly covered after mixing ECL solutions A and B in the same proportion. After 2 min, the chemiluminescence imaging system was used for Western blot observation, Image J software was used for gray value analysis, and Photoshop CS6 was used for typesetting.

2.10 Data analysis

All data analyses were performed using SPSS 20.0 software, and all images were drawn and processed through GraphPad Prism 7.0 and Photoshop CS6. Data were expressed as mean ± standard deviation (SD) relative to the control. P > 0.05 indicates no significant difference, P < 0.05 indicates a significant difference, and P < 0.01 indicates an extremely significant difference.

3.1 Effects of CdCl₂/Que/4-PBA on BRL-3A cell proliferation

As shown in Fig. 1A, BRL-3A cell viability gradually decreased with an increase in CdCl₂ concentration. When CdCl₂ concentration increased to 12.5 µM, BRL-3A cell viability began to decrease significantly; hence, 12.5 µM CdCl₂ was used as the experimental concentration. As illustrated in Fig. 1B, with increasing Que concentration, BRL-3A cell viability was significantly lower than that of the control group when the concentration of Que reached 10 µM; hence, 5 µM was used as the experimental concentration of Que. As depicted in Fig. 1C, when the concentration of 4-PBA reached 20 mM, BRL-3A cell viability was significantly reduced relative to that of the control group. As shown in Fig. 1D, BRL-3A cells were added with different concentrations of 4-PBA after treatment with 12.5 µM CdCl₂. When the concentration of 4-PBA reached 10 mM, BRL-3A cell viability was significantly increased relative to that of the control group. Thus, 10 mM was selected as the experimental concentration of 4-PBA.

3.2 Que alleviates the decrease of BRL-3A cell viability caused by Cd by inhibiting ERS

As shown in Fig. 1E, the viability of BRL-3A cells in the CdCl₂ treatment group was significantly decreased compared with that in the control group. In contrast with the Cd treatment group, cell viability in the combined treatment group of Cd and Que and in the combined treatment group of Cd and 4-PBA increased significantly. No difference was found between the cell viability of the Que/4-PBA treated groups and the control group.

3.3 Que decreases Cd-induced cell morphological changes by inhibiting ERS

As depicted in Figs. 2A to 2F, in contrast with those in the control group, BRL-3A cells in the Cd treated group generally shrank in volume, intercellular connections disappeared, distribution was scattered, and cytoplasmic density increased. No significant difference in cell morphology was observed between Que or 4-PBA treated group and the control group. Meanwhile, in the combined treatment group of Cd and Que and the combined treatment group of Cd and 4-PBA, BRL-3A cells were evenly distributed, closely arranged, and had normal cytoplasmic density, which was different from the Cd treatment group, whose cell morphology was close to that of the control group. The addition of Que or 4-PBA can effectively improve the morphological changes caused by Cd treatment.

3.4 Que alleviates the reduction of ROS levels caused by Cd by inhibiting ERS

As shown in Figs. 3A to 3F, in contrast with that in the control group, ROS level in the Cd treatment group increased significantly. In contrast with that in the Cd treatment group, ROS level in the combined treatment group of Cd and Que was significantly reduced and that in the combined treatment group of 4-PBA and Cd decreased significantly.

Figure 3 Effect of Que/4-PBA on Cd induced BRL-3A cells ROS level changes. A: Control group. B: 12.5 µM CdCl₂ treatment group. C: 12.5 µM CdCl₂ and 5 µM Que co-treatment group. D: 5 µM Que treatment group. E: 12.5 µM CdCl₂ and 10 mM 4-PBA co-treatment group. F: 10 mM 4-PBA treatment group.

3.5 Que improves Cd-induced BRL-3A cell morphological apoptosis by inhibiting ERS

As shown in Figs. 4A and 4B, in contrast with that in the control group, fluorescence intensity in the Cd treated group increased significantly, the nucleus shrank and cracked, the chromatin agglutinated, the nucleolus of the nuclear membrane ruptured, and apoptotic bodies were formed. In contrast with that in the Cd treated group, cell fluorescence intensity in the combined treatment group of Cd and Que decreased significantly, and cell structure was relatively complete, i.e., close to the normal level. Cell fluorescence intensity in the combined treatment group of Cd and 4-PBA was reduced significantly, and cell tissue structure was intact. This finding was not significantly different from that of the control group.

3.6 Que alleviates Cd-induced ERS

As shown in Figs. 5A to 5H, Que and 4-PBA can effectively alleviate the increase in mRNA expression levels of ERS-related genes caused by Cd. In contrast with the control group, the mRNA expression levels of GPR78 and the PERK/IRE1α/ATF6 signaling pathway increased significantly in the Cd treatment group. In contrast with the Cd treated group, the mRNA expression levels of GPR78 and the PERK/IRE1α/ATF6 signaling pathway decreased significantly in the combined treatment group of Cd and Que. In contrast with the Cd treated group, the mRNA expression levels of GPR78 and the PERK/IRE1α/ATF6 signaling pathway decreased significantly in the combined treatment group of Cd and 4-PBA.

As illustrated in Figs. 6A to 6J, Que and 4-PBA could effectively alleviate the increased expression levels of ERS-related proteins in BRL-3A cells caused by Cd. In contrast with the control group, the protein expression levels of GPR78 and the PERK/IRE1α/ATF6 signaling pathway in the Cd treated group were significantly increased. In contrast with the Cd treated group, the protein expression levels of GPR78 and the PERK/IRE1α/ATF6 signaling pathway were significantly decreased in the combined treatment group of Cd and Que. In contrast with the Cd treated group, the protein expression levels of GPR78 and the PERK/IRE1α/ATF6 signaling pathway were significantly decreased in the combined treatment group of Cd and 4-PBA.

3.7 Que alleviates Cd-induced apoptosis by inhibiting ERS

As shown in Figs. 7A to 7E, Que and 4-PBA could effectively alleviate the mRNA expression level increase of apoptosis-related factors caused by Cd. In contrast with the control group, the mRNA expression levels of Caspase-12, Caspase-3, and Bax in the Cd treated group were significantly increased, whereas the mRNA expression level of Bcl2 was decreased. In contrast with the Cd treated group, the mRNA expression levels of Caspase-12, Caspase-3, and Bax were significantly decreased in the combined treatment group of Cd and Que, whereas the mRNA expression level of Bcl2 was significantly increased. In contrast with the Cd treated group, the mRNA expression levels of Caspase-12, Caspase-3, and Bax were significantly decreased in the combined treatment group of Cd and 4-PBA, whereas the mRNA expression level of Bcl2 was significantly increased.

As depicted in Figs. 8A to 8E, Que and 4-PBA could effectively alleviate the changed expression levels of apoptosis-related proteins caused by Cd. In contrast with the control group, the protein expression levels of Caspase-12, Caspase-3, and Bax in the Cd treated group was considerably increased, whereas the protein expression level of Bcl2 was considerably decreased. In contrast with the Cd treated group, the protein expression levels of Caspase-12, Caspase-3, and Bax were considerably decreased and the protein expression level of Bcl2 was considerably increased in the co-treatment of Cd and Que. In contrast with the Cd treated group, the protein expression levels of Caspase-12, Caspase-3, and Bax were extremely decreased, whereas the protein expression level of Bcl2 was extremely increased in the Cd and 4-PBA co-treated group.

As a heavy metal that widely exists in nature, Cd is a highly toxic pollutant that can enter the human body through biological enrichment and cause serious damage. Given its long half-life, Cd can persist in the body, and thus, it is classified as human class I carcinogen by the National Toxicology Program of the United States^[25]. The liver is one of the important organs in humans and animals^[26]. Given its powerful metabolic function, the liver is also an important target organ of Cd poisoning. Cd ingested by the body accumulates in the liver, frequently causing liver hemorrhage and edema, and in serious cases, it can lead to hepatocyte apoptosis and necrosis^[27]. Studies have shown that the antioxidant function of Que can resist and alleviate the short-term toxicity caused by Cd^{[15, 28]}. Moreover, Que’s function of inhibiting ROS generation, antioxidation, and autophagy plays a protective role against Cd-induced testicular toxicity^[29]. Que can alleviate Cd-induced apoptosis^[23], but the specific mechanism remains unclear. 4-PBA is an ERS inhibitor that can reduce the occurrence of ERS by regulating the folding ability of ER folding protein and inhibiting oxidative stress^[30]. Therefore, on the basis of the establishment of rat BRL-3A cell Cd poisoning and a Que treatment model, this experiment uses the ERS inhibitor 4-PBA to further explore the specific mechanism of Que in alleviating Cd-induced BRL-3A cell apoptosis.

We performed cytotoxicity tests after selecting the appropriate concentrations of Cd (Fig. 1A), Que (Fig. 1B), and 4-PBA (Figs. 1C and 1D) from previous studies and repeated experiments^{[21, 23]}. The significant reduction in cell viability in the Cd treated group demonstrates the important toxic effect of Cd on hepatocyte injury (Fig. 1E). However, the recovery of BRL-3A cell viability in the combined treatment groups of Cd and Que and Cd and 4-PBA confirmed the protective effect of Que against Cd toxicity. We speculated that such effect was related to the inhibition of the occurrence of ERS. From the observation experiments on BRL-3A cell morphology, we can conclude that Cd treatment (Fig. 2B) triggered cellular Cd poisoning, leading to disorganized cell alignment, the disappearance of intercellular junctions, and incomplete morphology. Meanwhile, the addition of Que (Fig. 2C) or 4-PBA (Fig. 2E) can effectively alleviate the toxic effects of Cd.

Previous studies have found that the primary pathway by which Cd exerts toxicity is by activating oxidative stress^{[29, 31, 32]}. Cd can cause cell viability reduction by regulating the body’s ROS levels, and a large aggregation of ROS is an important cause of cell apoptosis^{[33, 34]}. Through the detection of intracellular ROS levels, we determined that Cd treatment significantly elevated the ROS levels of BRL-3A cells (Fig. 3B), leading to the occurrence of oxidative stress. By contrast, the addition of Que (Fig. 3C) or 4-PBA (Fig. 3E) effectively alleviated cellular ROS levels and reduced oxidative stress, further confirming the antioxidant effect of Que. Previous studies have found that by disrupting the balance of intracellular oxidative stress^[33], Cd can further induce an apoptotic cascade, which is an important mechanism of Cd cytotoxicity. Apoptosis, a cell autonomous death regulated by genes, is an important regulatory technique used for self-recovery after body injury. Apoptosis plays an important role in regulating the homeostasis of the body^[35]. Through Hoechst 33342 staining (Figs. 4A and 4B), we determined that the fluorescence intensity of the cells in the group treated with Cd considerably increased and the cells exhibited apoptotic morphologies. Cell shrinkage, fragmentation, and nuclear chromatin condensation can be observed under fluorescence microscopy. Meanwhile, BRL-3A cell morphologies in the combined treatment groups of Cd and Que and Cd and 4-PBA were all restored to nearly the same condition as the cells in the control group; apoptosis was alleviated, confirming the occurrence of apoptosis caused by Cd from the morphological perspective^[36]. Meanwhile Que inhibited apoptosis. However, what is the specific mechanism by which Que alleviates apoptosis? We conducted subsequent experimental explorations to answer this question.

In accordance with previous reports, Cd-induced liver apoptosis has three major pathways. The ER-mediated apoptosis pathway refers to the apoptosis caused by the occurrence of ERS and the failure of the homeostasis of the organism environment to recover in time. A large amount of ROS accumulation will lead to the imbalance of oxidation and antioxidant levels in the body, and ultimately, to ERS^{[13, 37]}. The occurrence of ERS apoptosis primarily depends on the release of GRP78 and its combination with downstream targets^[38], resulting in PERK/IRE1α/ATF6 signal pathways^[39–41]. An increasing amount of evidence has shown that when ERS is not addressed, UPR may lead to cell death by inducing inflammatory body activation and apoptosis, leading to metabolic diseases, such as fatty liver^[42]. The activation of the caspase cascade is an important pathway for ERS to mediate apoptosis. Among them, Caspase-12 is a key factor that widely exists in the liver and kidneys and has a high expression level^[43]. The activation of Caspase-12 is specifically caused by ER damage. Recombinant Caspase-12 can activate Caspase-3 and other effector caspases, eventually leading to apoptosis. Caspase-12-mediated apoptosis is an important pathway of ERS-induced apoptosis^[44]. This process is also regulated by members of the Bcl2 cell lymphoma protein family. Bax is a pro-apoptotic protein, whereas Bcl2 is an anti-apoptotic protein. Bax and Bcl2 are considered the key genes that regulate apoptosis and can directly reflect the degree of apoptosis.

To explore whether Que can alleviate Cd-induced apoptosis by inhibiting ERS, we first performed qRT-PCR to detect the mRNA expression level of ERS (Figs. 5 and 7). After Cd treatment, the mRNA expression levels of ERS-related genes increased significantly, activating the ERS signaling pathway. Then, by activating the mRNA expression levels of Caspase-12 and Caspase-3, the expression level of Bax increased significantly, whereas the expression level of Bcl2 decreased significantly, eventually leading to apoptosis. Compared with the control group, the mRNA expression levels of ERS-related genes in the combined treatment group of Cd and Que were significantly decreased, proving that the addition of Que can effectively reduce the increased mRNA expression levels of ERS-related genes induced by Cd toxicity. The mRNA expression levels of ERS-related genes in the combined treatment group of Cd and 4-PBA were considerably lower than those in the control group, also proving that 4-PBA can significantly alleviate the increase in mRNA expression levels of ERS-related genes caused by Cd. The mRNA expression levels of Caspase-12, Caspase-3, and Bax in the combined treatment group of Cd and Que were reduced considerably and the mRNA expression level of Bcl2 was increased remarkably compared with those in the control group, proving that Que reduced the mRNA expression levels of apoptosis-related genes by inhibiting the mRNA expression levels of ERS-related genes. The mRNA expression levels of Caspase-12, Caspase-3, and Bax in the combined treatment group of Cd and 4-PBA were also reduced remarkably and the mRNA expression level of Bcl2 was also increased considerably than those in the control group, also proving that 4-PBA inhibited the mRNA expression levels of apoptosis-related genes by inhibiting the mRNA expression levels of ERS-related genes. Therefore, we speculate that Que can alleviate the apoptosis of BRL-3A cells induced by Cd by decreasing the mRNA expression levels of ERS-related genes.

For further verification, we performed Western blot to detect the expression of ERS and apoptosis-related proteins (Figs. 6 and 8, respectively). The experimental results indicated that Cd treatment led to a significant increase in the expression levels of ERS-related proteins, Caspase-12, Caspase-3 and Bax proteins, and a decrease in the expression level of Bcl2, proving that Cd treatment leads to an increase in the expression levels of ERS-related proteins; it activates ERS, which ultimately leads to the improvement of the expression levels of apoptosis-related proteins and causes apoptosis^[45]. The addition of Que or 4-PBA can considerably reduce the expression levels of ERS-related proteins, significantly reducing the expression levels of Caspase-12, Caspase-3, and Bax proteins, and remarkably increasing the expression level of Bcl2 protein, proving that Que and 4-PBA can inhibit the expression levels of apoptosis-related proteins by inhibiting the expression of ERS-related proteins. This study clearly demonstrated that Que can reduce apoptosis-related protein expression in BRL-3A cells by inhibiting the expression levels of ERS-related proteins and then alleviating apoptosis. Meanwhile, the role of Que is similar to that of an ERS inhibitor. Combined with the qRT-PCR and Western blot results, we determined that Que can alleviate Cd-induced apoptosis by inhibiting the PERK/IRE1α/ATF6 ERS signaling pathway, in which the effect of Que was similar to that of 4-PBA.

Cd can lead to decreased BRL-3A cell viability, disordered morphology, and increased ROS levels, which cause the occurrence of ERS by activating the PERK/IRE1α/ATF6 signaling pathway and eventually inducing BRL-3A cells apoptosis. Que can restore cell viability, reduce ROS levels, and alleviate Cd-induced BRL-3A cell apoptosis by inhibiting the PERK/IRE1α/ATF6 ERS signaling pathway (Fig. 9). Our study further demonstrated the specific mechanism of Que that inhibits the Cd-induced apoptosis of BRL-3A cells by using the ERS inhibitor 4-PBA, further providing a theoretical basis for the anti-apoptotic function of Que.

Author contribution

Lulu Ding: Conceptualization, Methodology, Editing, Data analyses, Writing. Ke Wang: Methodology, Editing, Supervision. Ruxue Huang: Data curation, Data analyses, Editing. Wenjing Yu: Data curation, Data analyses. Bingzhao Yan: Conceptualization, Methodology. Bianhua Zhou: Supervision, Resources. Hongwei Wang: Supervision, Resources. Zijun Yang: Supervision, Resources. Zongping Liu: Supervision, Resources. Jicang Wang: Conceptualization, Methodology, Editing, Supervision. All authors reviewed the manuscript.

Funding

This study was supported by grants from National Natural Science Foundation of China (No. 31972753, 32273083), Henan science and technology research project (222102110340).

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Ethics approval

Not applicable.

Conflict of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Hirao-Suzuki, M., et al., Cadmium-stimulated invasion of rat liver cells during malignant transformation: Evidence of the involvement of oxidative stress/TET1-sensitive machinery. Toxicology, 2021. 447.
Sobhanardakani, S., Human Health Risk Assessment of Cd, Cu, Pb and Zn through Consumption of Raw and Pasteurized Cow's Milk. Iranian journal of public health, 2018. 47(8): p. 1172-1180.
Andjelkovic, M., et al., Toxic Effect of Acute Cadmium and Lead Exposure in Rat Blood, Liver, and Kidney. Int J Environ Res Public Health, 2019. 16(2).
Genchi, G., et al., The Effects of Cadmium Toxicity. International journal of environmental research and public health, 2020. 17(11): p. 100372.
Fu, C., L. Liu, and F. Li, Acetate alters the process of lipid metabolism in rabbits. Animal, 2018. 12(9): p. 1895-1902.
Zhang, Z., et al., Aspirin Eugenol Ester Attenuates Paraquat-Induced Hepatotoxicity by Inhibiting Oxidative Stress. Frontiers in physiology, 2020. 11: p. 582801.
Azarmehr, Z., et al., The effect of N-Acetyl cysteine on the expression of Fxr (Nr1h4), LXRalpha (Nr1h3) and Sirt1 genes, oxidative stress, and apoptosis in the liver of rats exposed to different doses of cadmium. Mol Biol Rep, 2021. 48(3): p. 2533-2542.
Han, D., et al., Subacute cadmium exposure modulates Th1 polarization to trigger ER stress-induced porcine hepatocyte apoptosis via regulation of miR-369-TNFalpha axis. Environ Sci Pollut Res Int, 2022. 29(11): p. 16576-16587.
Zheng, W., et al., Zearalenone Promotes Cell Proliferation or Causes Cell Death? Toxins (Basel), 2018. 10(5).
Li, X., et al., Protective Effects of Astilbin Against Cadmium-Induced Apoptosis in Chicken Kidneys via Endoplasmic Reticulum Stress Signaling Pathway. Biol Trace Elem Res, 2021.
Chen, J., et al., Cadmium-induced endoplasmic reticulum stress in chicken neutrophils is alleviated by selenium. J Inorg Biochem, 2017. 170: p. 169-177.
Zheng, J., et al., Icariin attenuates ischaemic stroke through suppressing inflammation mediated by endoplasmic reticulum stress signalling pathway in rats. Clinical and experimental pharmacology & physiology, 2022. 49(7): p. 719-730.
Zhu, M., et al., Histological changes, lipid metabolism, and oxidative and endoplasmic reticulum stress in the liver of laying hens exposed to cadmium concentrations. Poultry science, 2020. 99(6): p. 3215-3228.
Chatterjee, J., et al., Neuroprotective effect of quercetin against radiation-induced endoplasmic reticulum stress in neurons. J Biochem Mol Toxicol, 2019. 33(2): p. e22242.
Chen, X., et al., Quercetin protects the vascular endothelium against iron overload damages via ROS/ADMA/DDAHⅡ/eNOS/NO pathway. European journal of pharmacology, 2020. 868: p. 172885.
Eisvand, F., et al., Quercetin and its role in modulating endoplasmic reticulum stress: A review. Phytotherapy Research, 2021. 36(1): p. 73-84.
Cai, X., et al., Quercetin alleviates cell apoptosis and inflammation via the ER stress pathway in vascular endothelial cells cultured in high concentrations of glucosamine. Mol Med Rep, 2017. 15(2): p. 825-832.
Feng, K., et al., Quercetin attenuates oxidative stress-induced apoptosis via SIRT1/AMPK-mediated inhibition of ER stress in rat chondrocytes and prevents the progression of osteoarthritis in a rat model. J Cell Physiol, 2019. 234(10): p. 18192-18205.
Wang, Z., et al., 4-PBA Enhances Autophagy by Inhibiting Endoplasmic Reticulum Stress in Recombinant Human Beta Nerve Growth Factor-Induced PC12 cells After Mechanical Injury via PI3K/AKT/mTOR Signaling Pathway. World Neurosurg, 2020. 138: p. e659-e664.
Pao, H., et al., viaSuppression of Endoplasmic Reticulum Stress by 4-PBA Protects Against Hyperoxia-Induced Acute Lung Injury Up-Regulating Claudin-4 Expression. Frontiers in immunology, 2021. 12: p. 674316.
Choi, Y., et al., 4-Phenylbutyric acid, a potent endoplasmic reticulum stress inhibitor, attenuates the severity of collagen-induced arthritis in mice via inhibition of proliferation and inflammatory responses of synovial fibroblasts. The Kaohsiung journal of medical sciences, 2021. 37(7): p. 604-615.
You, Y., et al., 4-Phenylbutyric Acid Attenuates Endoplasmic Reticulum Stress-Mediated Intestinal Epithelial Cell Apoptosis in Rats with Severe Acute Pancreatitis. Digestive diseases and sciences, 2019. 64(6): p. 1535-1547.
Wang, J., et al., Role of endoplasmic reticulum stress in cadmium-induced hepatocyte apoptosis and the protective effect of quercetin. Ecotoxicology and Environmental Safety, 2022. 241.
Lihui, X., et al., Albicanol inhibits the toxicity of profenofos to grass carp hepatocytes cells through the ROS/PTEN/PI3K/AKT axis. Fish & shellfish immunology, 2022. 120: p. 325-336.
Xiaoyu X, Y.Z., Houjuan X, et al., Ameliorative Effect of Selenomethionine on Cadmium-Induced Hepatocyte Apoptosis via Regulating PI3K/AKT Pathway in Chickens. Biological trace element research, 2020 2(559-568).
Dai, Z., et al., Exposure to waterborne cadmium induce oxidative stress, autophagy and mitochondrial dysfunction in the liver of Procypris merus. Ecotoxicol Environ Saf, 2020. 204: p. 111051.
Zhong, G., et al., Arsenic causes mitochondrial biogenesis obstacles by inhibiting the AMPK/PGC-1α signaling pathway and also induces apoptosis and dysregulated mitophagy in the duck liver. Ecotoxicology and environmental safety, 2021. 230: p. 113117.
Badr, G.M., et al., Protective effects of quercetin supplementation against short-term toxicity of cadmium-induced hematological impairment, hypothyroidism, and testicular disturbances in albino rats. Environ Sci Pollut Res Int, 2019. 26(8): p. 8202-8211.
Wang, J., et al., Protective effect of quercetin on rat testes against cadmium toxicity by alleviating oxidative stress and autophagy. Environ Sci Pollut Res Int, 2020. 27(20): p. 25278-25286.
Bhardwaj, A., et al., AMPA induced cognitive impairment in rats: Establishing the role of endoplasmic reticulum stress inhibitor, 4-PBA. Journal of neuroscience research, 2021. 99(10): p. 2573-2591.
Zhang, C., et al., Cadmium and molybdenum co-induce pyroptosis via ROS/PTEN/PI3K/AKT axis in duck renal tubular epithelial cells. Environ Pollut, 2021. 272: p. 116403.
Zhang, T., et al., Cadmium-induced dysfunction of the blood-brain barrier depends on ROS-mediated inhibition of PTPase activity in zebrafish. J Hazard Mater, 2021. 412: p. 125198.
Yiran, Z., et al., Oxidative stress and mitogen-activated protein kinase pathways involved in cadmium-induced BRL 3A cell apoptosis. Oxid Med Cell Longev, 2013. 2013: p. 516051.
Yiran, Z., et al., Oxidative stress and mitogen-activated protein kinase pathways involved in cadmium-induced BRL 3A cell apoptosis. Oxidative medicine and cellular longevity, 2013. 2013: p. 516051.
Wang, J., et al., Cadmium-induced oxidative stress in Meretrix meretrix gills leads to mitochondria-mediated apoptosis. Ecotoxicology, 2021. 30(10): p. 2011-2023.
Cao, X., et al., Cadmium induced BEAS-2B cells apoptosis and mitochondria damage via MAPK signaling pathway. Chemosphere, 2021. 263: p. 128346.
Wan, N., et al., Ameliorative Effects of Selenium on Cadmium-Induced Injury in the Chicken Ovary: Mechanisms of Oxidative Stress and Endoplasmic Reticulum Stress in Cadmium-Induced Apoptosis. Biological trace element research, 2018. 184(2): p. 463-473.
Wang, Y., et al., The unfolded protein response induces the angiogenic switch in human tumor cells through the PERK/ATF4 pathway. Cancer Res, 2012. 72(20): p. 5396-406.
Guo, Y., et al., The PERK/eIF2alpha/ATF4/CHOP pathway plays a role in regulating monocrotaline-induced endoplasmic reticulum stress in rat liver. Res Vet Sci, 2020. 130: p. 237-239.
Kolpikova, E.P., et al., IRE1alpha Promotes Zika Virus Infection via XBP1. Viruses, 2020. 12(3).
Zhang, R., et al., Regulation of the cerebrovascular smooth muscle cell phenotype by mitochondrial oxidative injury and endoplasmic reticulum stress in simulated microgravity rats via the PERK-eIF2alpha-ATF4-CHOP pathway. Biochim Biophys Acta Mol Basis Dis, 2020. 1866(8): p. 165799.
Lebeaupin, C., et al., Endoplasmic reticulum stress signalling and the pathogenesis of non-alcoholic fatty liver disease. Journal of hepatology, 2018. 69(4): p. 927-947.
Wu, H., et al., Copper sulfate-induced endoplasmic reticulum stress promotes hepatic apoptosis by activating CHOP, JNK and caspase-12 signaling pathways. Ecotoxicology and environmental safety, 2020. 191: p. 110236.
Zhang, Q., et al., Caspase-12 is involved in stretch-induced apoptosis mediated endoplasmic reticulum stress. Apoptosis : an international journal on programmed cell death, 2016. 21(4): p. 432-42.
Hong, Z., et al., Rosmarinic acid attenuates acrylamide induced apoptosis of BRL-3A cells by inhibiting oxidative stress and endoplasmic reticulum stress. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 2021. 151: p. 112156.

No competing interests reported.

11.4Graphicalabstract.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Quercetin alleviates cadmium-induced BRL-3A cell apoptosis by inhibiting oxidative stress and the PERK/IRE1α/ATF6 signaling pathway

Status:

Version 1

Abstract

Figures

1 Introduction

2 Materials And Methods

2.1 Reagents

2.2 Cell cultures and treatments

2.3 Cellular viability assay

2.4 Cell morphology analysis

2.5 Flow cytometry

2.6 Hoechst 33342 staining

2.7 qRT-PCR

2.8 Cell total protein extraction

2.9 Western blot analysis

2.10 Data analysis

3 Results

3.1 Effects of CdCl₂/Que/4-PBA on BRL-3A cell proliferation

3.2 Que alleviates the decrease of BRL-3A cell viability caused by Cd by inhibiting ERS

3.3 Que decreases Cd-induced cell morphological changes by inhibiting ERS

3.4 Que alleviates the reduction of ROS levels caused by Cd by inhibiting ERS

3.5 Que improves Cd-induced BRL-3A cell morphological apoptosis by inhibiting ERS

3.6 Que alleviates Cd-induced ERS

3.7 Que alleviates Cd-induced apoptosis by inhibiting ERS

4 Discussion

5 Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

Quercetin alleviates cadmium-induced BRL-3A cell apoptosis by inhibiting oxidative stress and the PERK/IRE1α/ATF6 signaling pathway

Status:

Version 1

Abstract

Figures

1 Introduction

2 Materials And Methods

2.1 Reagents

2.2 Cell cultures and treatments

2.3 Cellular viability assay

2.4 Cell morphology analysis

2.5 Flow cytometry

2.6 Hoechst 33342 staining

2.7 qRT-PCR

2.8 Cell total protein extraction

2.9 Western blot analysis

2.10 Data analysis

3 Results

3.1 Effects of CdCl2/Que/4-PBA on BRL-3A cell proliferation

3.2 Que alleviates the decrease of BRL-3A cell viability caused by Cd by inhibiting ERS

3.3 Que decreases Cd-induced cell morphological changes by inhibiting ERS

3.4 Que alleviates the reduction of ROS levels caused by Cd by inhibiting ERS

3.5 Que improves Cd-induced BRL-3A cell morphological apoptosis by inhibiting ERS

3.6 Que alleviates Cd-induced ERS

3.7 Que alleviates Cd-induced apoptosis by inhibiting ERS

4 Discussion

5 Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

3.1 Effects of CdCl₂/Que/4-PBA on BRL-3A cell proliferation