BMAL1 involved in autophagy and injury of thoracic aortic endothelial cells of rats induced by intermittent heat stress through AMPK/mTOR/ULK1 pathway

doi:10.21203/rs.3.rs-2247091/v1

Download PDF

Research Article

BMAL1 involved in autophagy and injury of thoracic aortic endothelial cells of rats induced by intermittent heat stress through AMPK/mTOR/ULK1 pathway

https://doi.org/10.21203/rs.3.rs-2247091/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The physiological activities of the body have obvious biological rhythm. As the core of circadian rhythm, BMAL1 is the only clock gene whose deletion can lead to abnormal physiological function. However, it has not been reported whether heat exposure at different time can affect cardiovascular function changes by changing the circadian rhythm of clock genes. This study aimed to investigate whether autophagy is mediated by AMPK/mTOR/ULK1 pathway under intermittent heat exposure, and the effect of BMAL1 expression on thoracic aortic autophagy and apoptosis.

Methods

Intermittent heat stress model was established in vitro and vivo, western blot and immunofluorescence were used to detect the expressions of autophagy, apoptosis, AMPK/mTOR/ULK1 pathway and BMAL1. And then Autophagy was inhibited and activated, western blot and immunofluorescence detected the changes of autophagy and apoptosis. Finally, BMAL1 was silenced, RT-qPCR detected the expression of autophagy and apoptosis.

Results

Our study suggested heat stress induced autophagy and apoptosis were in RTAECs. In addition, intermittent heat stress raised AMPK and ULK1 but reduced the phosphorylation of mTOR in RTAECs, and autophagy inhibition by compound C reversed the expression of phosphorylation AMPK, mTOR and ULK1, the expression of Beclin1 and LC3-II/LC3-I decreased compared to the group of intermittent heat stress in vitro. Furthermore, Rapamycin mediated autophagy promoted apoptotic effects, and autophagy inhibitor 3-Methyladenine (3-MA) depressed the expression of apoptosis in vitro. After administration of Rapamycin, LC3-II/LC3-I, Beclin1 and Bax were further upregulated, whereas 3-MA alleviated the cells death. Finally, BMAL1 was elevated in vitro and vivo, and shBMAL1 reduced the expression of autophagy and apoptosis.

Conclusion

We revealed that intermittent heat stress induced apoptosis and autophagy. BMAL1 may involve in the occurrence of autophagy and apoptosis by AMPK/mTOR/ULK1 pathway.

intermittent heat stress

BMAL1

autophagy

apoptosis

Heat stress can trigger thermal reactions and lead to physiological dysfunction or irreversible pathological damages [1], such as weakening the fluidity and stability of cellular membrane [2, 3]. As the inner layer of blood vessel, endothelial cells play a critical role in maintaining physiological dynamic balance [4]. Moderate heat stress enables cells to improve signal pathways and reprogram gene expression to adapt to the surrounding environment [5]. Whereas severe heat stress may lead to cell programmed death, which mainly occurred in the transition of G1/S and G2/M [6, 7]. Cell survival depends on the exposed temperature and time, when exposed to high temperature, the cells may experience energy failure and necrosis and finally lead to programmed cell death [8].

Endothelial autophagy is one of the essential cellular functioning in maintaining endothelial state and preventing cardiovascular diseases [9]. In most conditions, autophagy is important to prevent the accumulation of damaged or dysfunctional proteins that may be harmful to cells [10]. However, excessive autophagy may mean inevitable cell death and lead to pathological tissue remodeling by adapting to adverse stress conditions [11]. Autophagy disorder may be the common pathway of vascular aging and related pathological development [12]. Many studies have pointed out that heat stress induced autophagy and apoptosis in cells, such as, human umbilical vein endothelial cells and cancer cells [13, 14], but autophagy may play beneficial or harmful roles in different cell lines, which needs to further evaluate the final biological effects.

In organisms, the core clock genes including BMAL1, CLOCK, PER and CRY form a series of positive and negative feedback pathways, playing a major role in regulating cell functions [15]. BMAL1 exhibited obvious circadian rhythm in human heart [16]. As the core of circadian rhythm, the deletion of BMAL1 leads to the immediate loss of behavioral circadian rhythm [17]. It plays a key role in the pathophysiology of vascular diseases [18]. As an important structural and functional regulator of vascular, accumulating evidences suggesting that the loss of BMAL1 greatly affected the change of vascular and the expression of autophagy and apoptosis. selective deletion of BMAL1 in vascular smooth muscle canceled time changes of vasoconstriction induced by phenylephrine or 5-hydroxytryptamine [19], and BMAL1 positively regulated proliferation of vascular smooth muscle cells after vascular injury[20]. A study on mouse Leydig cells indicated that BMAL1 may promote apoptosis by PI3K/AKT pathway [21].

In recent years, the research on heat mainly focused on the continuous heat stress and the recovery of heat stress [22–24], while intermittent heat exposure is common in real life, such as steel factory workers, police officers, sanitation workers and farmers, but there is little on the effect of intermittent heat stress. Our previous study revealed that the structure of thoracic aorta of ruptured severely and apoptosis increased under intermittent heat stress [25]. However, the potential molecular mechanism by which intermittent heat stress affect vascular endothelium have not been explored. This study aims to investigate autophagy and apoptosis activities and their relationship when intermittent heat stress was given, and whether BMAL1 involved in the changes of this process.

Chemical and reagents

Foetal Bovine Serum (cat. no. 04-001-1A) was brought from Biological Industries. Rapamycin (Rapa, cat. no. HY-10219), 3-Methyladenine (3-MA, cat. no. HY-19312), and Dorsomorphin (Compound C, CC) (cat. no. HY-13418A) were from Med Chem Express. Caspase3 (cat. no. bs-0081R), Phospho-mTOR (cat. no. bs-3495R), ULK1(cat. no. bs-3602R) and Phospho-ULK1(Ser556, cat. no. Bs-3464R) were purchased from Bioss. mTOR (cat. no. 66888-1-IG), Beclin1 (cat. no. 11306-1-AP), BMAL1 (cat. no. 14268-1-AP) were obtained from Proteintech Group Inc. LC3 (cat. no. #AF5402) was from Affinity Biosciences. SQSTM1/P62 (cat. no. #23214), AMPKα (cat. no. 2532S) and AMPKα (Thr172, cat. no. 2535T) were from Cell Signaling Technology Inc.

Intermittent Heat Stress Model Establishing

Thoracic aortic endothelial cells of rats (RTAECs) provided by the Saiqi Bioengineering Co., Ltd. (Shanghai, China) were cultured at 37℃ in a humidified incubator with 5% CO² in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine, serum100 U/ml penicillin and 100µg/ml streptomycin. The control group (CN) were cultured at 37°C; the continuous heat stress group were at 40°C for indicated time (0, 4, 6, 8, 12, 24, 36, 48 and 72 h); the intermittent heat stress group were at both normal (37°C) and high temperatures (40°C) alternatively for 3 or 6 circles, heat stress and recovery alternated. The intermittent heat stress group included 4(3), 6(3), 8(3), 12(3), 24(3), 24(6), 36(3), 36(6), 48(3), 48(6) and 72(3) h, take 36 h for an example, 36 h were divided into 3 or 6 circles averagely (12 h or 6 h in one circle), and cells were exposed at 40°C in any continuous one third of each circle (4 h or 2 h), and then cultured at 37°C at the rest time for recovery, followed by the next heat stress and recovery circle again until 3 or 6 circles finished. The detailed information shown in Table 1.

Table 1

Intermittent heat stress cycle and time (h)
groups circle	4(3)	6(3)	8(3)	12(3)	24(3)	24(6)	36(3)	36(6)	48(3)	48(6)	72(3)
Heat stress time	0.45	0.67	0.88	1.33	2.67	1.33	4	2	5.33	2.67	8
Recovery time	0.88	1.33	1.78	2.67	5.33	2.67	8	4	10.66	5.33	16

Note: n(m), n is for overall time, m is for heat stress cycle.

Animals model

A total of 27 healthy 7-week-old male Wistar rats (SCXK2021-0006) weighing around 190–210g, were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. The animals were included in the study if they survived successful after 7 days heat exposure, otherwise they were excluded from the experiments. According to the experimental scheme, rats were randomly divided into three groups (n = 9/group), control group (HS-CN), intermittent heat stress for 8 h (HS-8) and continuous heat stress for 24 h (HS-24). The control group was kept at 24℃, while the HS-24 was exposed to 32℃. The rats in HS-8 were exposed to heat for any consecutive 8 h per day, and the rest of the time were maintained under control conditions. Rats were fed in the artificial climate chamber (Qianjiang Instruments and equipment Co., Ltd., Hangzhou, China), and overall heat expose lasted for 7 days. Food and water were supplied ad libitum. Rats were housed in a 12-h light/dark cycle (light 6:00 p.m. to 6:00 a.m.).

Due to overt behavioral inactivity after heat exposure, the experimenter could not be blinded to whether the animal underwent heat or control condition. The experimental procedures of the present study were approved by the Animal Ethics and Use Committees of Ningxia Medical University (2020 − 601, Yinchuan, China). The behavior and active state of rats were be monitored carefully. At the end of the experiment, all thoracic aorta of rats were gently removed for further experiments after the rats were anesthetized.

Western Blot Analysis

RTAECs and thoracic aorta of Wistar rats were prepared to extract proteins and determine protein concentration by Whole Cell Lysis Assay (KeyGen Bio Tech, Nanjing, China, KGP2100) and the bicinchoninic acid (BCA) kit (KeyGen Bio Tech, KGP902). Protein samples were separated by 7.5–12% Omni-Easy PAGE (Epizyme Biotech, PG212) followed by transferal to a polyvinylidene fluoride (PVDF) membrane for around 2 h. After blocking with diluted nonfat milk powder, the membranes were incubated overnight at 4°C with the primary antibodies. The next day, membranes were washed with phosphate-buffered saline-Tween-20 (PBS-T) three times and then further incubated for 1.5 h with goat anti-rabbit Ig-G or goat anti-mouse Ig-G. After washing, enhanced Chemiluminescence (SuperSignal West Pico, Pierce Biotechnology, Rockford, IL, USA) was used to visualize proteins, and band densities were recorded using ImageJ Software.

Real-time quantitative PCR (RT-qPCR) analysis.

According to the manufacturers' protocols, total cellular RNAs were isolated from RTAECs using RNA Prep Kit (Servicebio, Wuhan China) and cDNA was synthesized using a Servicebio® RT First Strand cDNA Synthesis kit (Servicebio, Wuhan, China). Prepare, mix gently and centrifuge reverse transcription reaction condition in which contained 5ⅹ Reaction Buffer (4 µl), Oligo (dT)18 Primer (100 µm) (0.5 µl), Random Hexamer primer (100 µm) (0.5 µl), Servicebio®RT Enzyme Mix(1 µl), total RNA (10 µl), and RNase free water (4 µl) per 20 µl mixture. The following thermal cycles were performed for PCR amplifying, 95℃ (10 min) for preheat, 95℃ (15 s) for denature, 60℃ (30 s) for annealing and elongation. The fluorescence signals were collected every 0.5℃ between 65℃ and 95℃. The 2 ^{–∆∆ Ct} method was used to perform data. Primer information is shown in Table 2.

Table 2

Information on primers used for RT-qPCR
Gene	Sequence (5′–3′)	GenBank No.	Size (bp)
AMPK	F: CCAAATTATGCAGCACCGGA R: CGGTTGAGATACTCCGGGATG	NM_023991	188
Bax	F: TTTGCTACAGGGTTTCATCCAG R: GTTGTTGTCCAGTTCATCGCC	NM_017059.2	145
Beclin1	F: CTTCAATGCGACCTTCCATATC R: CCAGAACAGTACAACGGCAACT	NM_001034117.1	258
BMAL1	F: CTGGAGAAACCTGCCAAGTATG R: GGTGGAAGAATGGGAGTTGCT	NM_024362.2	159
Caspase3	F: CTGGACTGCGGTATTGAGACA R: CGGGTGCGGTAGAGTAAGC	NM_012922.2	103
mTOR	F: GCCTGGGACCTCTACTATCACG R: AGGAGGAAAACAAACTCGTGCC	NM_019906.1	199
GAPDH	F: CTGGAGAAACCTGCCAAGTATG R: GGTGGAAGAATGGGAGTTGCT	NM_017008.4	138
ULK1	F: ACTGACAGCCTACAGGAGAAACC R: GGAGCCCACAGTAAATACCACA	NM_001108341.1	126

Immunofluorescence staining.

After heat stress, cells were rinsed by phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde at room temperature for 20 min, and then blocked with Immunol staining blocking buffer for 1 h at 4°C. BMAL1 (1:50), LC3 (1:50) were added and incubated overnight at 4°C. After being washed with PBS, cells were incubated with the secondary antibody for 1 h at room temperature, and the nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI).

The thoracic aorta segments were placed in an oven at 60℃ for 2–3 h. Quickly put the tissue slices into xylene for dehydration, and wash the slices with running water for 3 times. Dry the sections, add goat serum diluent (1:50), put the sections in a wet box, and seal them in an incubator at 37℃ for 1 h. After incubation, dry the water in the air, add the first antibody and incubate according to BMAL1 (1:50), GAPDH (1:200), place the slices in a wet box at 4℃ overnight. Discard the first antibody, add second antibody donkey anti rabbit (1:500) for incubation. Add a proper amount of neutral resin to the tissue center, take the slide with tweezers to cover it gently, discharge excess bubbles, and dry it at room temperature for microscopic observation.

Immunohistochemical staining

The paraffin sections were dewaxed and was incubated in 3% H2O2 at room temperature for 5–10 minutes to eliminate the activity of endogenous peroxidase. The slices were washed with distilled water, soaked in PBS for 5 mins, and sealed with 5–10% normal goat serum (diluted with PBS). After incubation at room temperature for 10 minutes, the serum was poured out. BMAL1 antibodies (1:50) was used to incubate the sections at 4°C overnight, and rinse with PBS for 3 times, 5 mins each time. Then appropriate amount of secondary antibody solution was added for incubation at 37 ℃ for 10–30 minutes, and rinse the slices with PBS 3 times. Horseradish enzyme or alkaline phosphatase labeled Streptomyces ovalbumin working solution was used to incubate he sliced at 37 ℃ for 10–30 mins. After washing, the color reaction was developed for 3–15 mins, and the segments were washed, redyed, dehydrated and mounted. Images were observed under electron microscope.

Bioinformatics analysis

The protein interaction network (PPI) was constructed by STRING (https://string-db.org/) to obtain differentially expressed genes in signal pathways exported in TSV format. The files were imported into Cytoscape for visual analysis, and the Hub genes were analyzed with plug-in cytoHub to screen out potential key genes. And gene enrichment analysis (GSEA) was conducted using KEGG's gene set to evaluate the possible signal pathways interacting with BMAL1.

Cell transfection

To knock down BMAL1 in RTAECs, cells were transfected with BMAL1 shRNA for 48 h followed by 36(6) h intermittent heat stress. RTAECs was transfected with the assistance of LipoGene 2000 Plus Transfection Reagent (L7003, UV EVERBRIGHT INC) according to the manufacturer’s instructions.

Statistical analyses.

Data from at least three independent experiments were recorded as mean ± standard deviation (SD). GraPhPad7.0 was used to analyze and draw the experimental data. Analysis of variance (one-way ANOVA) was used for compare means of groups. The level of significance was set at P < 0.05.

Heat stress induced Autophagy in RTAECs

In order to determine the optimal time for intermittent heat stress in RTAECs, we detected multiple heat exposure time and different cycles, including 3 cycles and 6 cycles. Western blot was used to detect the expression of autophagy related proteins after thermal exposure of RTAECs and evaluate the level of autophagy. Compared with the control group, Beclin1 and LC3-II/LC3-I fluctuated in intermittent heat stress groups, they were the highest at 36(3) h and 36(6) h, and the difference were statistically significant (P < 0.0001). In the continuous heat stress group, Beclin1 and LC3-II/LC3-I increased and reached the peak at 72 h, the difference was statistically significant (P < 0.05) (Fig. 1A/B).

We further compared the autophagy of cells exposed to heat for 36(3) h, 36(6) h and 36 h. After heat stress, Beclin1 and the ratio of LC3-II/LC3-I were significantly higher than that in the control group (P < 0.01), and the expression level of P62 decreased. Interestingly, the expressions of Beclin1 at 36(6) h was higher and P62 was lower than those at 36(3) h (Fig. 1C). Immunofluorescence (IF) analysis showed that the red fluorescence in cytoplasm and membrane rose in RTAECs, and the red fluorescence at 36(6) h was brightener than that at 36(3) h (Fig. 1D). Collectively, these findings suggested that heat stress induced autophagy in RTAECs, and the more intermittent heat exposure cycles, the higher expression of autophagy proteins.

Heat stress caused apoptosis in RTAECs

Then we performed various western blot to explore the effect of heat stress on apoptosis in RTAECs. Obviously, the expression abundance of apoptosis proteins Bax, Caspase3 and anti-apoptosis protein Bcl-2 changed in RTAECs. Bax and Caspase3 in intermittent heat stress group were higher than that in the control group, but fluctuated and reached the peak at 48(6) h (P < 0.0001). Compared with the control group, the abundance of apoptotic proteins Bax and Caspase3 in the continuous heat stress group increased in a time-dependent manner, and the difference was statistically significant (P < 0.0001). (Fig. 2A/B). We further compared the expression of apoptotic factors at 36(3) h, 36(6) h and 36 h. Interestingly, 36(6) h heat stress induced more cell apoptosis evidenced by the elevation of Caspase3 and Bax (Fig. 2C). Taken together, heat stress caused apoptosis of RTAECs and apoptosis proteins at 36(6) h became the highest.

AMPK/mTOR/ULK1 involved in the autophagy of RTAECs under intermittent heat stress

The we investigated the possible pathway participating the induction of autophagy. We examined the effects of intermittent and continuous heat stress at different time on the expression levels of AMPK/mTOR/ULK1 pathway-related proteins. Compared with the control group, the expression of p-AMPKα(Thr172) in the intermittent heat stress group was significantly increased from 36(3) h, the p-AMPK/AMPK reached the peak at 36(6) h, and the p-ULK1(Ser556)/ULK1 was significantly up-regulated at 24(6) h. The expression of p-AMPK/AMPK reached the peak at 36 h (P < 0.001), then decreased gradually, and the expression of p-ULK1(Ser556)/ULK1 increased after continuous heat stress (Fig. 3A). In addition, we compared the changes of various proteins in the pathway of heat stress for 36(3) h, 36(6) h and 36 h. The levels of p-AMPKα(Thr172) and p-ULK1(Ser556) increased, but the level of p-mTOR decreased significantly. Compared with the control group, the differences were statistically significant (P < 0.01) (Fig. 3B). AMPK and ULK1 were activated at Thr172 and Ser556 respectively, and p-mTOR was inactivated at Ser2448.

To consolidate the role of AMPK /mTOR/ULK1, AMPK inhibitor Compound C (CC) was used to intervene RTAECs in 36(6) h group, and then WB detected the changes of pathway and autophagy proteins. CC greatly decreased the ratio of p-AMPK/AMPK and p-ULK1(Ser556)/ULK1, while increased. p-mTOR/TOR. Meanwhile, Beclin1 and the ratio of LC3-II/LC3-I were down-regulated, and the difference was statistically significant (P < 0.001) (Fig. 3C). Hence, AMPK /mTOR/ULK1 pathway took part in the occurrence of autophagy.

Effect of autophagy on apoptosis under heat stress.

To clarify the effect of autophagy on the injury of RTAECs, we detected the expression of Bax and Bcl-2 after autophagy was inhibited and activated respectively. The results showed that after 3-MA treatment, the expression levels of Beclin1 and LC3-II/LC3-I were lower than that of 36(6) h. At the same time, apoptosis factor Bax decreased and Bcl-2 increased, the differences were statistically significant (P < 0.5) (Fig. 4A). On the contrary, Rapamycin induced expression levels of Beclin1 and LC3-II/LC3-I, and further promoted cells apoptosis (Fig. 4B). In addition, compared with the group of 36(6) h, the red fluorescence intensity of autophagic lysosomes in the 36(6) h with 3-MA group became lower; compared with 36(3) h, and the red fluorescence intensity of autophagic lysosomes increased after 36(3) h with Rapamycin (Fig. 4C).

BMAL1 increased during heat stress in vivo and vitro.

To delineate the role of BMAL1 in the process of injury of RTAECs, BMAL1 was evaluated by various methods. Firstly, we used bioinformatics tools to screen genes or pathways related to BMAL1. Cytoscape software was used to construct the protein interaction network, screening the proteins directly interacting with ARNTL (BMAL1) (Fig. 5A). The top 10 key genes interacting with BMAL1 include SIRT1, CLOCK and NPAS2 (Fig. 5B/C), indicating that the research related to clock gene BMAL1 focused on circadian rhythm genes. The results of GO function enrichment (Fig. 5D) analysis showed that the pathways related to BMAL1 contained endogenous apoptosis and cell sensitivity regulation, suggesting that BMAL1 may be potentially related to cell apoptosis.

Then we used molecular biology methods to detect the expression of BMAL1 in RTAECs and thoracic aorta of Wistar rat. WB revealed that BMAL1 protein levels raised greatly in 36(3) h, 36(6) h and 36 h groups (P༜0.01) when RTAECs were exposed to 40℃(Fig. 6A). Furthermore, we evaluated BMAL1 in Wistar rats. The protein level of BMAL1 elevated highly in heat stress groups, and the difference was statistically significant (P༜0.001) (Fig. 6B). Brown particles in thoracic aortic vessels increased (Fig. 6C), and BMAL1 fluorescence intensity were enhanced in the rats under heat stress (Fig. 6D).

BMAL1 affected autophagy and apoptosis under intermittent heat stress.

To further clarify the effect of BMAL1 on autophagy and apoptosis in RTAECs, we intervened BMAL1with shRNA, and selected a group of plasmids with the best silencing efficiency for follow-up experiments. RT-qPCR detection suggested that both sh1 and sh2 BMAL1 plasmids could effectively reduce the gene expression level of BMAL1 in RTAECs, the expression of sh2 was much lower, and the difference was statistically significant (P < 0.05) (Fig. 7A). Then, the expression of autophagy, apoptosis and the pathway-related proteins were detected in neo and sh2 transfected RTAECs. Compared with neo group, ULK1mRNA decreased significantly (P < 0.01), and the gene levels of Beclin1, Caspase 3 and Bax were all decreased in sh2 group (P < 0.01) (Fig. 7B). Furthermore, we tested the expression of protein related to pathway and autophagy after 36(6) h intermittent heat stress. At the gene level, the mRNA expression of BMAL1 was significantly increased at 36(6) h, while the expression of BMAL1 in 36(6) h sh2 group was down-regulated significantly after the transfection of sh2 (Fig. 7C) (P < 0.05). Compared with 36(6), the ULK1mRNA decreased, and the ULK1mRNA increased in 36(6) sh2 group, Beclin1 and Caspase3 were down-regulated as well, and the difference was statistically significant (P < 0.05) (Fig. 7D/E). The above results indicated that BMAL1 influenced the changes of autophagy, apoptosis and AMPK/mTOR/ULK1 pathway in RTAECs.

Endothelium dysfunction is a complex and multiple process that eventually leading to cardiovascular disease, such as atherosclerosis and hypertension. Apart from sheer stress and smoking, it was reported that heat stress can induce endothelial injury as well [26]. Therefore, this study explores the potential mechanism of endothelial cell damage caused by intermittent stress simulating human activities can provide a basis for preventing harm of heat waves. In this study, we proved that heat stress can induce autophagy and apoptosis in RTAECs. Secondly, AMPK/mTOR/ULK1 pathway participated in autophagy induced by intermittent heat stress. Finally, BMAL1 affected autophagy and apoptosis during intermittent heat stress.

Previous studies have shown that heat stress can activate autophagy in various cell lines [27, 28]. Autophagy is regulated by multiple pathways. Phosphorylation of α subunit at threonine 172 is a key step in the activation of AMPK [29]. Under stress conditions, activated AMPK inhibits mTOR to alleviate phosphorylation of ULK1 at Ser757, leading to activation of ULK1, and ultimately induces autophagy [30]. In this study, both intermittent and continuous heat stress induced autophagy in RTAECs, the expression of p-AMPK (Thr172) raised, mTOR to be inactivated at Ser2448, and ULK1 to be activated at Ser556. Our results concurred with research on human bladder cancer, in which AMPK/mTOR/ULK1 axis activated autophagy [31].

Autophagy is critical for cell survival, autophagy and apoptosis may be synergistic or antagonistic, so we further explored the role of autophagy in apoptosis of RTAECs under intermittent heat stress. After the administration of 3-MA, the increase of autophagy induced by intermittent heat stress was reversed, and the expression of apoptosis factor also went down; rapamycin further promoted the expression autophagy and apoptosis, indicating that autophagy and apoptosis might act as partners in this study. Research on autophagy and apoptosis in acute lymphoblastic leukemia have reported that the enhanced activation of autophagy and apoptosis leads to the death of human acute lymphoblastic leukemia cell lines or primary leukemia cells [32], which is consistent with the results of our study. On the contrary, in a study on stem cell toxicity induced by T-2 toxin, autophagy had a protective effect on apoptosis induced by Tmur2 toxin [33], and autophagy also played a beneficial role in apoptosis of porcine granulosa cells induced by oxidative stress [34]. Therefore, the effect of autophagy on apoptosis depends on the cell lines and cell environment.

The circadian clock has an important impact on the function of vascular endothelial cells, and BMAL1 disorder aggravates the occurrence and development of vascular disease [35]. BMAL1, as an important part of the molecular feedback network of clock genes, not only has circadian rhythm, but also participates in various physiological and pathological processes by regulating different signaling pathways [36]. We hypothesized that BMAL1 might play role in the injury of RTAECs, and our findings revealed that heat stress elevated the expression of BMAL1 in vitro and vivo, knockdown of BMAL1 decreased ULK1 mRNA, attenuated autophagy and apoptotic proteins. Researches on BMAL1 and autophagy have shown that BMAL1 knockout mice increased mTORC1 (mammalian target of rapamycin complex1) activity, circadian rhythm of ULK1 mRNA expression almost complete disappeared [37]. Reports on relationship of BMAL1 and apoptosis illustrated that BMAL1^−/− mice exhibited various symptoms of aging with inefficient epidermal self-renewal, atrophy of organs and significantly shortened lifespan compared with wild littermates at 5 months [38], BMAL1 knockdown promoted apoptosis and reduced testosterone secretion in TM3 Leydig cell line. It is rational to conclude that BAML1 involved in the injury of RTAECs.

In summary, our present study revealed intermittent heat stress promoted the expression autophagy and apoptosis; AMPK/mTOR/ULK1 pathway took part in the occur of autophagy, and BMAL1 may be involved in autophagy and apoptosis in RTAECs. Therefore, this study focuses on the changes of cardiovascular status under different working hours in high temperature environment, which is expected to provide evidence and experimental data for reducing environmental damage and occupational protection of high temperature workers. However, further studies are needed to clarify the effects of BMAL1 on autophagy and apoptosis for some limitations of current studies. The results obtained in silence experiments by RT-qPCR only revealed the changed in gene level. BMAL1 overexpression should be done to further validate the effects of BMAL1 on autophagy and apoptosis.

RTAECs: Thoracic aortic endothelial cells of rat, Rapa: Rapamycin, 3-MA: 3-Methyladenine, CC: Compound C.

Ethics approval and consent to participate

The experimental procedures of the present study were approved by the Animal Ethics and Use Committees of Ningxia Medical University (2020-601, Yinchuan, China).

Statement for experiments

All experiments were performed in accordance with relevant guidelines and regulations, and all methods are reported in accordance with ARRIVE guidelines (https://arriveguidelines.org) for the reporting of animal experiments.

Consent for publication

Not applicable

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by the National Natural Science Foundation of China (grant no. 82060050), and the Ningxia Natural Science Foundation Key Project (grant no. 2021AAC020165).

Authors' contributions

CLY was responsible for the study design and implementation, data analysis and manuscript preparation. ZWD and XYC participated in animal studies. QHZ interpreted the data and critically reviewed it. XMW helped with the design of the study. GHL guided the implementation of the study in the whole process and were responsible for the revision of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Author details

¹School of Public Health and Management, Ningxia Medical University, Yinchuan, Ningxia 750004, P.R. China

²General Hospital of Ningxia Medical University, Yinchuan, Ningxia 750004, P.R. China

³Institute of Basic Medical Science; Ningxia Medical University, Yinchuan, Ningxia 750004, P.R. China

Prasanna P, Upadhyay A. Heat Shock Proteins as the Druggable Targets in Leishmaniasis: Promises and Perils. Infection and immunity 2021, 89(2).
Petrova NV, Velichko AK, Razin SV, Kantidze OL. Early S-phase cell hypersensitivity to heat stress. Cell Cycle. 2016;15(3):337–44.
Li Z, Li Y, Ren Y, Li C. High ambient temperature disrupted the circadian rhythm of reproductive hormones and changed the testicular expression of steroidogenesis genes and clock genes in male mice. Mol Cell Endocrinol. 2020;500:110639.
Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest. 1973;52(11):2745–56.
Park HG, Han SI, Oh SY, Kang HS. Cellular responses to mild heat stress. Cell Mol Life Sci. 2005;62(1):10–23.
Kühl NM, Rensing L. Heat shock effects on cell cycle progression. Cell Mol Life Sci. 2000;57(3):450–63.
Nitta M, Okamura H, Aizawa S, Yamaizumi M. Heat shock induces transient p53-dependent cell cycle arrest at G1/S. Oncogene. 1997;15(5):561–8.
Rennekampff HO, Alharbi Z. Burn Injury: Mechanisms of Keratinocyte Cell Death. Medical sciences (Basel, Switzerland) 2021, 9(3).
Schaaf MB, Houbaert D, Meçe O, Agostinis P. Autophagy in endothelial cells and tumor angiogenesis. Cell Death Differ. 2019;26(4):665–79.
Liang P, Jiang B, Li Y, Liu Z, Zhang P, Zhang M, Huang X, Xiao X. Autophagy promotes angiogenesis via AMPK/Akt/mTOR signaling during the recovery of heat-denatured endothelial cells. Cell Death Dis. 2018;9(12):1152.
Jiang F. Autophagy in vascular endothelial cells. Clin Exp Pharmacol Physiol. 2016;43(11):1021–8.
Thirumalaikumar VP, Wagner M, Balazadeh S, Skirycz A. Autophagy is responsible for the accumulation of proteogenic dipeptides in response to heat stress in Arabidopsis thaliana. Febs j. 2021;288(1):281–92.
Mameli E, Martello A, Caporali A. Autophagy at the interface of endothelial cell homeostasis and vascular disease. Febs j. 2022;289(11):2976–91.
Reglero-Real N, Pérez-Gutiérrez L, Yoshimura A, Rolas L, Garrido-Mesa J, Barkaway A, Pickworth C, Saleeb RS, Gonzalez-Nuñez M, Austin-Williams SN, et al: Autophagy modulates endothelial junctions to restrain neutrophil diapedesis during inflammation. Immunity 2021, 54(9):1989–2004.e1989.
Reid KJ. Assessment of Circadian Rhythms. Neurol Clin. 2019;37(3):505–26.
Patke A, Young MW, Axelrod S. Molecular mechanisms and physiological importance of circadian rhythms. Nat Rev Mol Cell Biol. 2020;21(2):67–84.
Farshadi E, Yan J, Leclere P, Goldbeter A, Chaves I, van der Horst GTJ. The positive circadian regulators CLOCK and BMAL1 control G2/M cell cycle transition through Cyclin B1. Cell Cycle. 2019;18(1):16–33.
Crislip GR, Douma LG, Masten SH, Cheng KY, Lynch IJ, Johnston JG, Barral D, Glasford KB, Holzworth MR, Verlander JW, et al. Differences in renal BMAL1 contribution to Na(+) homeostasis and blood pressure control in male and female mice. Am J Physiol Renal Physiol. 2020;318(6):F1463-f1477.
Xie Z, Su W, Liu S, Zhao G, Esser K, Schroder EA, Lefta M, Stauss HM, Guo Z, Gong MC. Smooth-muscle BMAL1 participates in blood pressure circadian rhythm regulation. J Clin Invest. 2015;125(1):324–36.
Takaguri A, Sasano J, Akihiro O, Satoh K. The role of circadian clock gene BMAL1 in vascular proliferation. Eur J Pharmacol. 2020;872:172924.
Ding H, Zhao J, Liu H, Wang J, Lu W. BMAL1 knockdown promoted apoptosis and reduced testosterone secretion in TM3 Leydig cell line. Gene. 2020;747:144672.
Jiang J, Chen S, Li K, Zhang C, Tan Y, Deng Q, Chai Y, Wang X, Chen G, Feng K, et al. Targeting autophagy enhances heat stress-induced apoptosis via the ATP-AMPK-mTOR axis for hepatocellular carcinoma. Int J hyperthermia: official J Eur Soc Hyperthermic Oncol North Am Hyperth Group. 2019;36(1):499–510.
Hirunsai M, Srikuea R. Autophagy-lysosomal signaling responses to heat stress in tenotomy-induced rat skeletal muscle atrophy. Life Sci. 2021;275:119352.
Bao ZQ, Liao TT, Yang WR, Wang Y, Luo HY, Wang XZ. Heat stress-induced autophagy promotes lactate secretion in cultured immature boar Sertoli cells by inhibiting apoptosis and driving SLC2A3, LDHA, and SLC16A1 expression. Theriogenology. 2017;87:339–48.
Xu T, Liu F, Luo Y, Zhu L, Niu J, Li G. Spontaneously hypertensive rats are sensitive to thoracic aorta damage induced by a hot and humid environment. Exp Ther Med. 2017;14(5):4383–90.
Swanlund JM, Kregel KC, Oberley TD. Autophagy following heat stress: the role of aging and protein nitration. Autophagy. 2008;4(7):936–9.
Dündar G, Shao Z, Higashitani N, Kikuta M, Izumi M, Higashitani A. Autophagy mitigates high-temperature injury in pollen development of Arabidopsis thaliana. Dev Biol. 2019;456(2):190–200.
Omer A, Patel D, Moran JL, Lian XJ, Di Marco S, Gallouzi IE. Autophagy and heat-shock response impair stress granule assembly during cellular senescence. Mech Ageing Dev. 2020;192:111382.
Gui D, Cui Z, Zhang L, Yu C, Yao D, Xu M, Chen M, Wu P, Li G, Wang L, et al. Salidroside attenuates hypoxia-induced pulmonary arterial smooth muscle cell proliferation and apoptosis resistance by upregulating autophagy through the AMPK-mTOR-ULK1 pathway. BMC Pulm Med. 2017;17(1):191.
Hurley JH, Young LN. Mechanisms of Autophagy Initiation. Annu Rev Biochem. 2017;86:225–44.
Wang F, Cao M, Fan M, Wu H, Huang W, Zhang Y, Hu Z, Jin X. AMPK-mTOR-ULK1 axis activation-dependent autophagy promotes hydroxycamptothecin-induced apoptosis in human bladder cancer cells. J Cell Physiol. 2020;235(5):4302–15.
Huang FL, Yu SJ, Li CL. Role of Autophagy and Apoptosis in Acute Lymphoblastic Leukemia. Cancer control: journal of the Moffitt Cancer Center. 2021;28:10732748211019138.
Wu J, Zhou Y, Yuan Z, Yi J, Chen J, Wang N, Tian Y. Autophagy and Apoptosis Interact to Modulate T-2 Toxin-Induced Toxicity in Liver Cells. Toxins 2019, 11(1).
Zhang JQ, Ren QL, Chen JF, Gao BW, Wang XW, Zhang ZJ, Wang J, Xu ZJ, Xing BS. Autophagy Contributes to Oxidative Stress-Induced Apoptosis in Porcine Granulosa Cells. Reproductive sciences (Thousand Oaks, Calif) 2021, 28(8):2147–2160.
Zha M, Tian T, Xu W, Liu S, Jia J, Wang L, Yan Q, Li N, Yu J, Huang L. The circadian clock gene Bmal1 facilitates cisplatin-induced renal injury and hepatization. Cell Death Dis. 2020;11(6):446.
Xie M, Tang Q, Nie J, Zhang C, Zhou X, Yu S, Sun J, Cheng X, Dong N, Hu Y, et al. BMAL1-Downregulation Aggravates Porphyromonas Gingivalis-Induced Atherosclerosis by Encouraging Oxidative Stress. Circ Res. 2020;126(6):e15–29.
Ma D, Panda S, Lin JD. Temporal orchestration of circadian autophagy rhythm by C/EBPβ. Embo j. 2011;30(22):4642–51.
Silveira EJD, Nascimento Filho CHV, Yujra VQ, Webber LP, Castilho RM, Squarize CH. BMAL1 Modulates Epidermal Healing in a Process Involving the Antioxidative Defense Mechanism. Int J Mol Sci 2020, 21(3).

No competing interests reported.

supplementaryfile.xlsx

Download PDF

Version 1

posted

You are reading this latest preprint version

BMAL1 involved in autophagy and injury of thoracic aortic endothelial cells of rats induced by intermittent heat stress through AMPK/mTOR/ULK1 pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Chemical and reagents

Intermittent Heat Stress Model Establishing

Animals model

Western Blot Analysis

Immunohistochemical staining

Bioinformatics analysis

Cell transfection

Results

Heat stress induced Autophagy in RTAECs

Heat stress caused apoptosis in RTAECs

AMPK/mTOR/ULK1 involved in the autophagy of RTAECs under intermittent heat stress

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1