The carbohydrate-binding module mediates mCherry protein anchoring on the cell wall in rice

doi:10.21203/rs.3.rs-2250462/v1

Download PDF

Research Article

The carbohydrate-binding module mediates mCherry protein anchoring on the cell wall in rice

https://doi.org/10.21203/rs.3.rs-2250462/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 24 Mar, 2023

Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) →

You are reading this latest preprint version

The red fluorescent protein mCherry is widely used as a tagged protein in intracellular protein positioning and dynamic tracing due to its stable characteristics in color and monomer molecule. In this study, mCherry was used as a tag to explore the cell wall-directed binding of the carbohydrate-binding module (CBM). The results of fluorescent signal detection showed that both the ubiquitin promoter and the CaMV35S promoter could drive the expression of mCherry gene in seeds, leaves, and roots. The results of subcellular localization by different methods displayed that the fluorescence signals were concentrated on the cell walls of the root, stem, leaf, and vascular bundle sheath. It indicated that the CBM could mediate the red fluorescent protein anchoring on the cell wall.

Carbohydrate binding module

Red fluorescent protein

Signal peptide

Cell wall

Directional accumulation

SP-CBM11-mCherry was transformed into rice along with Epsps, and overexpression of SP-CBM11-mCherry caused deep red color in seeds, and the mCherry anchored on the cell wall.

The cell wall is one of the important features to distinguish plant cells from animal cells, and its main components are cellulose, hemicellulose and pectin (Gigli Bisceglia et al. 2020). It is also the primary barrier involved in immune or defense, and the chemical components and secondary metabolites of the cell wall played important roles in responding to pests and diseases (Le Gall et al. 2015). However, the major substance of the cell wall can be degraded by a consortium of microbial enzymes, such as cellulases and hemicelluloses, which contain catalytic domain (CD), carbohydrate-binding module (CBM) and linker (Boraston et al. 2004). CBM is a noncatalytic module found in those carbohydrate-degrading enzymes (Sidar et al. 2020), and a group of independent domains which can bind polysaccharides and bring the biocatalyst into intimate and proximity to its substrate, which increases the effective enzyme concentration on the polysaccharide surface and the rate of catalysis (Guillen et al. 2010). Till now, over 88 families of CBM are reported in the CAZy database (http://www.cazy.org/). Based on the structural similarity and ligand binding function, CBM can be divided into three types. Type A CBM is a surface-bound style including family 1, 2a, 3a, 5, 10, and so on (Blake et al. 2006). The binding site of this type is distributed in or close to a plane, and selectively binds the insoluble crystalline substrate, such as crystalline cellulose or crystalline chitin (Gilbert et al. 2013). Type B CBM is a chain-bound type containing family 2b, 4, 6, 11, 15, 17, 20, 22, 27, 28, 29, 34, 36, etc (Armenta et al. 2017). This type of CBM has a slit or cavity on the surface, which can bind to a wide variety of glycans, such as xylans, mannans, galactans and starch (Armenta et al. 2017). Type C CBM is a small molecule sugar-bound type (Boraston et al. 2004) including family 9, 13, 14, 18, etc, and their binding substrates are limited to monosaccharide, oligosaccharide, or polysaccharide terminal sugar groups (Liu et al. 2021). Therefore, the target and specificity for substrate recognition of carbohydrates make CBM a good domain structure for anchoring on the cell wall of plants.

Clostridium thermocellum is an anaerobic thermophilic cellulolytic bacterium. In this bacterium, bifunctional cellulase Lic26A-Cel5E contains the GH26 and GH5 catalytic modules that display β-1,4 and β-1,3 − 1,4-mixed linked endoglucanase activity, respectively (Carvalho et al. 2004), and the CtCBM11 structure of Lic26A-Cel5E in Clostridium thermocellum belongs to family 11 CBM of type B, which binds polysaccharides into their groove on the surface (Viegas et al. 2008). β-1,3 − 1,4-glucan is abundant in many cell wall polysaccharides of cereals and cereal endosperm, where are the main locations of accessible substrate for CBM11 targeting and adhering (Scheller and Ulvskov 2010). For instance, the CBM3 domain in BsCel5A-CBM3 replaced by CtCBM11 domain minimized the non-specific binding to the lignin component and enhanced the activity of β-glucanase (Fonseca Maldonado et al. 2017). It was also reported that the addition of CtCBM11 to the C-terminus of cellulase A could enhance protein stability under extreme pH conditions and increase the affinity and activity to insoluble polysaccharides (Cattaneo et al. 2018).

In addition to carbohydrates, there are small amounts of protein in the plant cell wall (Cassab 1998). These proteins include extensins, glycine-rich proteins, proline-rich proteins, solanaceous lectins and arabinogalactan proteins (Showalter 1993). Among these proteins, the extensins are a class of hydroxyproline-rich glycoproteins characterized by the signal peptide and repeating units of Serine-(Proline)_n (Liu et al. 2016; M. et al. 2010). Analysis of the extensins from maize (Stiefel et al. 1991), Nicotiana tabacum (De Loose et al. 1991), and bean (Wycoff et al. 1995) showed that these proteins contain signal peptide sequence at N terminus. It was demonstrated that the extensin signal peptide from Nicotiana plumbaginifolia could secrete heterologous proteins from protoplasts into the extracellular space (De Loose et al. 1991). When the signal peptide from the extensin gene of Arabidopsis thaliana fused with the CBM from non-hydrolyzed protein family 2 of strawberry, the fusion protein CBMFaEXP2 could be secreted and localized on the cell wall (Nardi et al. 2015). When the signal peptide of extensin was linked with the CtCBM11 and iron-binding peptide, the iron ion signal could be observed by x-ray fluorescence microscopy on the cell wall of the Arabidopsis epidermis (Yang et al. 2016). Therefore, the extensin signal peptide was useful for extracellular secretion of proteins.

Till now, most of the studies focused on the intracellular expression and accumulation of exogenous proteins in plants, and few of the studies involved the secretion of exogenous proteins to the cell wall. Based on the specific binding properties of CBM to cell wall polysaccharides and the extracellular secretion function of the extensin signal peptide (SP), we designed a fusion protein SP-CBM-mCherry to verify that the CBM could guide the directional accumulation of the red fluorescent protein mCherry on the cell wall, so as to provide references and technical supports for the extracellular secretion and directional accumulation of other important functional proteins on the cell wall.

Fusion protein design and vector construction

The sequence of SP and CtCBM11 come from Nicotiana plumbaginifolia (De Loose et al. 1991) and Clostridium thermocellum Lic26A-Cel5E (GenBank: P16218.1) (Carvalho et al. 2004), respectively. The sequence of mCherry protein was from the tension sensor gene in the synthetic construct YPet(short)-FL-mCherry (GenBank: MF685013.1) (Ringer et al. 2017). The sequence of the chymotrypsin recognition site (NPAAPFRNP, GenBank: GU327680.1) was used to connect CtCBM11 with mCherry. The fusion protein SP-CBM11-mCherry was assembled by successive linking the SP, CtCBM1, chymotrypsin recognition sequence and mCherry (Fig. 1a). Without altering the encoded amino acid sequence, the fusion gene SP-CBM11-mCherry was optimized according to the codon bias of rice, then the KpnI and SpeI restriction sites were added at the 5' and 3' end, respectively. The fusion gene was synthesized by BGI (Shenzhen, China) and cloned into the vector pUC57, and the recombinant vector was named as pUC57-CBM11mCherry (Fig. 1b). The 3D structure of the fusion protein was predicted online (https://zhanggroup.org/I-TASSER/; Fig. 1c).

The plant expression vectors, pC3300-Epsps-UbiCBM11mCherry (Fig. 1d) and pC3300-Epsps-35SCBM11mCherry (Fig. 1e), were constructed from plasmids pC3300-Epsps-UbiCry1Ca (Zeng et al. 2020) and pC3300-Epsps-35SCry1Ca (Zeng et al. 2019) by replacing Cry1Ca with SP-CBM11-mCherry, respectively.

Transformation And Identification Of Rice Transformants

The rice japonica cultivar Nipponbare was used as the recipient and the strain EHA105 harboring pC3300-Epsps-UbiCBM11mCherry or pC3300-Epsps-35SCBM11mCherry were used for Agrobacterium-mediated transformation, respectively (Hiei and Komari 2008). The rice genomic DNA was extracted by the CTAB method (M.G.Murray and W.F.Thompson 1980), and the primer pairs Epsps-gF/Epsps-gR and mCherry-gF/mCherry-gR were used for detection of Epsps and SP-CBM11-mCherry, respectively (Table 1). The PCR reaction volume was 20 µL including 1 µL genomic DNA template (30 ~ 50 ng/µL), 0.5 µL each of the forward and reverse primers (10 µmol/L), 10 µL of 2× M5 Taq HiFi PCR mix, and 8 µL ddH₂O. The PCR procedure was conducted as follows: initial denaturation at 95°C for 3 min; 35 cycles at 95°C for 25 s, 58°C for 25 s, 72°C for 30 s; and final extension at 72°C for 10 min.

Table 1

The primer sequences for detection
Primer	Sequences (5′-3′)	Annealing temperature	Product size (bp)
Epsps-gF	CGCCAAGTCTTTGTGGGTGT	58°C	1363
Epsps-gR	GTCCACGGTGACAGGGTTCT	58°C	1363
mCherry-gF	GATCCCGTTCTCCAGCTTCCG	58°C	704
mCherry-gR	TGGTCTTGACCTCAGCGTCGTAGTG	58°C	704
mCh(153)-qF mCh(153)-qR	GAAGGGCGAGATCAAGCAGA TAGTCCTCGTTGTGGGAGGT	60°C	153
E(180)-qF	TATGGGCTTGGTCGGAGTCTAC	60°C	180
E(180)-qR	GTGATGGGAGTGGGAGTCTTG
actin7-141qF	CTGGTATTGCTGACCGTAT	60°C	141
actin7-141qR	GTTGGAAGGTGCTAAGGGA

Total Rna Extraction And Rt-pcr

Total RNA extraction and RT-PCR

Total RNA was isolated from transformants and wild type using the AG RNAex Pro Reagent (AG21101, Accurate Biology, Changsha, China) according to the manufacturer’s instruction. The template cDNA was synthesized using 1 µg total RNA via 5× All-In-One RT Master Mix Kit (ABM, Catalog#G486). RT-PCR was performed using specific primers for detecting the expression of Epsps and mCherry (Table 1). The RT-PCR procedure was as follows: initial denaturation at 94°C for 3 min; 30 cycles at 94°C for 30 s, 60°C for 30 s, 72°C for 30 s; with a final extension at 72°C for 4 min. The gene actin7 was used as the internal control (Fu and Liu 2020).

Glyphosate Tolerance Assay

About sixteen sterilized seeds from transformants and wild type were inoculated on solidified MS medium containing 340 mg/L glyphosate, and the wild type seeds without glyphosate stress were used as control. All of them were cultivated in a growth chamber at 28°C and with a 12 h/12 h light/dark photoperiod. After cultivation for 10 days, the plant status was photographed, as well as the root length, shoot length and fresh mass were measured.

Fluorescence Analysis

The seeds from transformants and wild type were observed under white and red filters by plant vivo imaging system (FUSION FX7 EDGE SPECTRA). The roots and leaves from transformants and wild type were free-hand sectioned using a razor blade and then the sections were observed under confocal laser microscope (LSM880, CarlZeiss) at excitation and emission wavelengths (587 nm/610 nm) of mCherry.

Subcellular Localization Of Fusion Protein

The calli of transformants and control were placed on glass slides and scanned by confocal laser microscope (LSM880, CarlZeiss) at 587 nm excitation wavelength and 610 nm emission wavelength.

The leaves from 30-day-old seedlings were used for paraffin embedding. The paraffin-embedded sections were incubated at room temperature in a 1:200 dilution of Anti-mCherry-Tag Mouse Monoclonal Antibody (9D3) (Abbkine, A02080) for 1 h, then the sections were washed three times for 5 min with 1× TBST buffer and incubated at room temperature in dark for 50 min in a 1:200 dilution of DyLight488 Goat Anti-Mouse IgG (Abbkine, A23210) as the second antibody. The sections were stained with 1 mg/mL DAPI (4’,6-Diamidine-2’-phenylindole) for 10 min (Tan et al. 2020) and washed as the method mentioned above. Finally, the sections were observed using confocal laser microscope (LSM880, CarlZeiss) at 488 nm for detection of the DyLight488 fluorescence and 405 nm for the DAPI fluorescence.

Protoplast Observation

Etiolated seedlings that grew at 28°C for about 12 days in dark were used for isolation of protoplasts. Before isolation of protoplasts, the leaf sheaths were used for detection of the red fluorescence of mCherry, and the Calcofluor White was applied as a specific dye of cell walls. The Calcofluor White was excited at 405 nm, and the emission was detected at 425 ~ 475 nm. The protoplasts were isolated according to the reference (He et al. 2016) and observed at excitation and emission wavelengths (587 nm/610 nm) for detection of mCherry with laser microscope (LSM880, CarlZeiss).

Construction of vectors with fusion gene SP-CBM11-mCherry

The CBM11 and mCherry were linked by the chymotrypsin recognition site, which facilitated both site-directed digestion in vitro and inter-domain flexibility (Fig.1a). The fusion gene SP-CBM11-mCherry was cloned in vector pUC57-CBM11mCherry (Fig.1b) and verified by digestions of KpnI and SpeI restriction endonuclease (Fig.1f). The structure prediction of fusion protein displayed that the spatial structure of CBM11 and mCherry was independent of each other without cross-folding, and the two domains formed their active spatial conformations, respectively (Fig.1c). The vectors pC3300-Epsps-UbiCBM11mCherry (Fig.1d) and pC3300-Epsps-35SCBM11mCherry (Fig.1e) were constructed based on pC3300-Epsps-UbiCry1Ca and pC3300-Epsps-35SCry1Ca respectively, and the construction of them was verified to be successful by digestion of restriction enzymes (Fig.1g).

Identification of rice transformants

The regenerated plantlets were produced after herbicide selection and differentiation (Fig.2a~2c), and the seeds with red fluorescence were harvested after the regenerated plants grew in pots for about three months (Fig.2d). The integrations of genes SP-CBM11-mCherry and Epsps in regenerated plants from transformation of two expression vectors were verified by use of primers Epsps-gF/Epsps-gR and mCherry-gF/mCherry-gR (Table 1), respectively (Fig.2e, 2f). The results showed that the regenerated plants from transformation of pC3300-Epsps-UbiCBM11mCherry can amplified 1363 bp and 704 bp target fragments. Most of the regenerated plants from transformation of pC3300-Epsps-35SCBM11mCherry could detect the target fragments of 1363 bp and 704 bp. The offspring were selected in successive generations to seek stable transformants by herbicide stress and PCR selection (Fig.2g, 2h), and the expression of target genes was also identified by RT-PCR (Fig.2j). The above results demonstrated that the exogenous target genes Epsps and mCherry were successfully transferred into the rice genome.

Selection by red fluorescence and glyphosate resistance

Although some regenerated plants harbored the mCherry gene, their seeds did not display red fluorescence. Thus, phenotyping was necessary. The transformants bearing seeds with intensively red fluorescence were chosen for further analysis. Finally, three lines named as OE-1, OE-2 and OE-3 from transformation of pC3300-Epsps-UbiCBM11mCherry, and three lines named as OE-4, OE-5 and OE-6 from transformation of pC3300-Epsps-35SCBM11mCherry were selected out (Fig.3a, 3b). Both the seeds (Fig.3a) and endosperm (Fig.3b) of them displayed a cherry pink color under natural light, and both the unhusked rice and brown rice of them showed dark red fluorescence under red light (Fig.3c), that indicated the mCherry protein was a useful reporter in genetic transformation.

The herbicide resistance was verified on a solid MS medium containing 340 mg/L glyphosate. The results displayed that the transformants normally germinated and grew under glyphosate stress, while the wild type did not germinate under same stress (Fig.4a), that was in accord with the results of fluorescence screening (Fig.4b). The root length (Fig.4c), shoot length (Fig.4d), and fresh mass (Fig.4e) of transformants were not significantly different to those of wild type without herbicide stress respectively, whereas the growth of wild type with herbicide stress was severely inhibited (Fig.4a). The above results indicated both the glyphosate tolerance and red fluorescence could be used for transformant selection.

Cytological observation of red fluorescence in leaves and roots

The transformant OE-1 was used to confirm the expression of mCherry gene by observation of red fluorescence on its leaf (Fig.5a), root elongation zone (Fig.5b) and root tip (Fig.5c). In leaf section, the red fluorescence existed mainly in the cell wall and vascular bundles, as well as scattered lightly in cytoplasm of transformant, whereas the wild type did not show red fluorescence (Fig.5a). In section of root elongation zone, the red fluorescence distributed along the profile of cell wall (Fig.5b). In root tip section, the red fluorescence should distributed on the cell wall, but that looked like filling in the whole cell due to the low resolution or over exposure (Fig.5c).

Observation of callus fluorescence and immunofluorescence of leaf section

At in vitro selection and differentiation stage, the transformed calli showed a visible red color (Fig.2a, 2b). Microscopic observations indicated that the red fluorescence of transformed calli existed in the cell wall of parenchyma cells, whereas the calli of wild type did not show red fluorescence (Fig.6a). The immunofluorescent observations indicated that the fluorescence signals localized at the vascular bundle sheath cell wall and phloem, where were rich in polysaccharides that overlayed the cell wall structure (Fig.6b).

Observation of protoplast fluorescence

The protoplasts from rice stable transformants harboring fusion gene were isolated for red fluorescence observation. Before protoplast isolation, the cells were outlined by cell walls with red fluorescence (Fig.7a). After the cell walls were removed, there was no red fluorescence surrounding the protoplasts, and the protoplasts became spherosome without restriction of cell walls (Fig.7b). The above results indicated that the fusion protein with red fluorescence was secreted and anchored on the cell wall.

The signal peptide is crucial for the localization and stability of foreign proteins. By use of transit peptide of chloroplast, the subcellular localization of proteins Cry1Ac and Cry2A provided an effective alternative way for insect management in cotton (Muzaffar et al. 2015). The modified Cp4-EPSPS with an N-terminal chloroplast targeting peptide increased glyphosate tolerance (Karthik et al. 2020). By using the retention signal peptide of endoplasmic reticulum, the CpTI protein accumulated more in transgenic tobacco (Deng et al. 2003). Using endosperm-specific promoter Gt13a and a signal peptide targeting the OsrhGM-CSF to the protein bodies, Ning et al. achieved the high expression level of OsrhGM-CSF protein in rice endosperm (Ning et al. 2008). Wang et al. also reported that a novel phytase-lactoferricin fusion gene driven by endosperm-specific promoter Gt13aP with its signal peptide sequence Gt13aSP could improve the phosphorus availability and antibacterial activity of rice seeds (Wang et al. 2017). However, the loading of exogenous proteins inside the cell is limited, the cell wall may be a good subcellular structure for directed accumulation of exogenous proteins. Actually, the cell wall is also one of the sites for protein accumulation (Calderan Rodrigues et al. 2019). Extensins are hydroxyproline-rich glycoproteins and the most abundant structural proteins in the cell wall (Liu et al. 2016). Their signal peptides at the N-terminus were responsible for the secretion of extensin into the extracellular matrix (M. et al. 2010). For example, the β-expansins GmEXPB2 (Guo et al. 2011) and OsEXPB2 (Zou et al. 2015) in root were characterized as secretory proteins located on the cell wall, and both of them were presumed to comprise signal peptides at N-terminus. By fusing a signal peptide from Arabidopsis expansion AtEXP8 at the N-terminal of CBM, the fusion protein CBMFaEXP2 was targeted to the cell wall (Nardi et al. 2015). In this study, the signal peptide from N. plumbuginifolia (De Loose et al. 1991) was used for secretion of red fluorescent protein mCherry to the extracellular, that was confirmed by red fluorescence detection in rice endosperm (Fig. 3b) and cell wall (Fig. 5, Fig. 6). Furthermore, when the plant cell wall was degraded by cellulase and pectinase, there was no red fluorescence surrounding the protoplasts (Fig. 7b), that proved on the other hand the fusion protein was secreted to the cell walls.

When the foreign protein was shunted into the secretion pathway, it was randomly diffused into the extracellular matrix. Therefore, the adherence of foreign protein is also crucial for its accumulation. The CBMs are independently structural domains that can recognize polysaccharides, such as cellulose and starch (Armenta et al. 2017). The position of CBM located at N-terminal or C-terminal of the fusion protein does not affect the function of CBM (Foumani et al. 2015). In this study, the CtCBM11 was used to anchor the red fluorescent protein to cellulose in the cell walls, that was derived from Clostridium thermocellum and could specifically bind the glucans linked by 1,4-β and 1,3 − 1,4-β glycosidic bond (Carvalho et al. 2004; Ribeiro et al. 2020; Viegas et al. 2013). The structure prediction of CtCBM11 demonstrated that it consisted of a β-sandwich that formed a concave of the substrate-binding cleft (Fig. 1c), and the fluorescence analysis showed that the fusion protein accumulated in rice endosperm that was rich in starch (Fig. 3a ~ 3b) or cell walls that were abundant in carbohydrates such as cellulose (Fig. 5). Moreover, callus fluorescence and leaf sheath immunofluorescence demonstrated that the fusion protein localized on the cell wall and leaf vascular bundle sheath, respectively (Fig. 6). In summary, our study demonstrated that the extensin signal peptide guided the secretion of the fusion protein to the extracellular matrix, and the CBM domain anchored the fusion protein on the cell walls.

The promoter is like a switch in regulating the activity of downstream genes, playing an important role in gene expression. Application of constitutive promoters endows the plants with constant and high expression level in whole tissues (Feike et al. 2019). The CaMV35S promoter was frequently implemented in dicot plants such as soybean (Yang et al. 2021) and cotton (Sufyan Tahir et al. 2021), whereas the maize ubiquitin promoter was mostly used in cereals such as rice (Achary et al. 2020) and maize (Peterson et al. 2021). In this study, the fusion gene SP-CBM11-mCherry was driven by ubiquitin promoter and CaMV35S promoter, respectively. Both of the promoters could get a satisfactory expression level of the fusion protein based on the observation of naked eyes (Fig. 3a ~ 3b). The application of red fluorescent protein in tracking gene expression in plant could decline the interference of chlorophyll in green tissue (Fig. 5a) and be convenient for visual selection (Fig. 2a ~ 2d, Fig. 3a ~ 3b), that would save labor and speed up the selection process of transformants. Contrary to the positive selection by visible red protein, the expression of herbicide resistance gene Epsps was convenient for killing wild-type cells by herbicide at an early stage when the positive selection was invalid or inefficient even though the cells showed the visible red color. At the seedling stage, the herbicide resistance of genetically modified plants also facilitated the selection on MS medium containing glyphosate (Fig. 4a, Fig. 4c-e) and in the fields. In terms of efficiency, we thought the negative selection like herbicide selection was irreplaceable.

Author contributions: LH designed, did the experiments and wrote the manuscript; XGY revised this manuscript; DLH, WLS, LJJ and YJH contributed to the planting management in the field. All authors have read and agreed to the published version of the manuscript.

Funding: This research was jointly supported by Hainan Yazhou Bay Seed Lab (Grant No. B21HJ0107), National Science and Technology Major Project on Breeding of New Genetically Modified Organisms (2016ZX08001003-001) and Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDA24030201).

Conflict of interest All authors declare no conflicts of interests.

Achary VMM, Sheri V, Manna M, Panditi V, Borphukan B, Ram B, Agarwal A, Fartyal D, Teotia D, Masakapalli SK, Agrawal PK & Reddy MK (2020) Overexpression of improved EPSPS gene results in field level glyphosate tolerance and higher grain yield in rice. Plant Biotechnol J 18(12):2504-2519.https://doi.org10.1111/pbi.13428
Armenta S, Moreno Mendieta S, Sanchez Cuapio Z, Sanchez S & Rodriguez Sanoja R (2017) Advances in molecular engineering of carbohydrate-binding modules. Proteins 85(9):1602-1617.https://doi.org10.1002/prot.25327
Blake AW, McCartney L, Flint JE, Bolam DN, Boraston AB, Gilbert HJ & Knox JP (2006) Understanding the biological rationale for the diversity of cellulose-directed carbohydrate-binding modules in prokaryotic enzymes. J Biol Chem 281(39):29321-9.https://doi.org10.1074/jbc.M605903200
Boraston AB, Bolam DN, Gilbert HJ & Davies GJ (2004) Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem J 382(Pt 3):769-81.https://doi.org10.1042/BJ20040892
Calderan Rodrigues MJ, Guimaraes Fonseca J, de Moraes FE, Vaz Setem L, Carmanhanis Begossi A & Labate CA (2019) Plant Cell Wall Proteomics: A Focus on Monocot Species, Brachypodium distachyon, Saccharum spp. and Oryza sativa. Int J Mol Sci 20(8).https://doi.org10.3390/ijms20081975
Carvalho AL, Goyal A, Prates JA, Bolam DN, Gilbert HJ, Pires VM, Ferreira LM, Planas A, Romao MJ & Fontes CM (2004) The family 11 carbohydrate-binding module of Clostridium thermocellum Lic26A-Cel5E accommodates beta-1,4- and beta-1,3-1,4-mixed linked glucans at a single binding site. J Biol Chem 279(33):34785-93.https://doi.org10.1074/jbc.M405867200
Cassab GI (1998) Plant Cell Wall Proteins. Annu Rev Plant Physiol Plant Mol Biol 49:281-309.https://doi.org10.1146/annurev.arplant.49.1.281
Cattaneo C, Cesaro P, Spertino S, Icardi S & Cavaletto M (2018) Enhanced features of Dictyoglomus turgidum Cellulase A engineered with carbohydrate binding module 11 from Clostridium thermocellum. Sci Rep 8(1):4402.https://doi.org10.1038/s41598-018-22769-w
De Loose M, Gheysen G, Tire C, Gielen J, Villarroel R, Genetello C, Van Montagu M, Depicker A & Inze D (1991) The extensin signal peptide allows secretion of a heterologous protein from protoplasts. Gene 99(1):95-100.https://doi.org10.1016/0378-1119(91)90038-d
Deng C, Song G, Xu J & Zhu Z (2003) Increasing accumulation level of foreign protein in transgenic plants through protein targeting. Acta Botanica Sinica 45(9):1084-1089
Feike D, Korolev AV, Soumpourou E, Murakami E, Reid D, Breakspear A, Rogers C, Radutoiu S, Stougaard J, Harwood WA, Oldroyd GED & Miller JB (2019) Characterizing standard genetic parts and establishing common principles for engineering legume and cereal roots. Plant Biotechnol J 17(12):2234-2245.https://doi.org10.1111/pbi.13135
Fonseca Maldonado R, Meleiro LP, Mendes LFS, Alves LF, Carli S, Morero LD, Basso LGM, Costa-Filho AJ & Ward RJ (2017) Lignocellulose binding of a Cel5A-RtCBM11 chimera with enhanced beta-glucanase activity monitored by electron paramagnetic resonance. Biotechnol Biofuels 10(1):269.https://doi.org10.1186/s13068-017-0964-0
Foumani M, Vuong TV, MacCormick B & Master ER (2015) Enhanced Polysaccharide Binding and Activity on Linear beta-Glucans through Addition of Carbohydrate-Binding Modules to Either Terminus of a Glucooligosaccharide Oxidase. PLoS One 10(5):e0125398.https://doi.org10.1371/journal.pone.0125398
Fu J & Liu B (2020) Enhanced yield performance of transgenic cry1C* rice in saline-alkaline soil. GM Crops Food 11(2):97-112.https://doi.org10.1080/21645698.2019.1709383
Gigli Bisceglia N, Engelsdorf T & Hamann T (2020) Plant cell wall integrity maintenance in model plants and crop species-relevant cell wall components and underlying guiding principles. Cell Mol Life Sci 77(11):2049-2077.https://doi.org10.1007/s00018-019-03388-8
Gilbert HJ, Knox JP & Boraston AB (2013) Advances in understanding the molecular basis of plant cell wall polysaccharide recognition by carbohydrate-binding modules. Curr Opin Struct Biol 23(5):669-77.https://doi.org10.1016/j.sbi.2013.05.005
Guillen D, Sanchez S & Rodriguez Sanoja R (2010) Carbohydrate-binding domains: multiplicity of biological roles. Appl Microbiol Biotechnol 85(5):1241-9.https://doi.org10.1007/s00253-009-2331-y
Guo W, Zhao J, Li X, Qin L, Yan X & Liao H (2011) A soybean β-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses. Plant J 66(3):541-52.https://doi.org10.1111/j.1365-313X.2011.04511.x
He F, Chen S, Ning Y & Wang G (2016) Rice (oryza sativa) protoplast isolation and its application for transient expression analysis. Curr Protoc Plant Biol 1(2):373-383.https://doi.org10.1002/cppb.20026
Hiei Y & Komari T (2008) Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed. Nat Protoc 3:824-34.https://doi.org10.1038/nprot.2008.46
Karthik K, Nandiganti M, Thangaraj A, Singh S, Mishra P, Rathinam M, Sharma M, Singh NK, Dash PK & Sreevathsa R (2020) Transgenic Cotton (Gossypium hirsutum L.) to Combat Weed Vagaries: Utility of an Apical Meristem-Targeted in planta Transformation Strategy to Introgress a Modified CP4-EPSPS Gene for Glyphosate Tolerance. Front Plant Sci 11:768.https://doi.org10.3389/fpls.2020.00768
Le Gall H, Philippe F, Domon J-M, Gillet F, Pelloux J & Rayon C (2015) Cell Wall Metabolism in Response to Abiotic Stress. Plants 4(1):112-66.https://doi.org10.3390/plants4010112
Liu JW, Sun D, Zhu JR, Liu C & Liu WJ (2021) Carbohydrate-binding modules targeting branched polysaccharides: overcoming side-chain recalcitrance in a non-catalytic approach. Bioresources and Bioprocessing 8(1).https://doi.org10.1186/s40643-021-00381-7
Liu X, Wolfe R, Welch LR, Domozych DS, Popper ZA & Showalter AM (2016) Bioinformatic Identification and Analysis of Extensins in the Plant Kingdom. PLoS One 11(2):e0150177.https://doi.org10.1371/journal.pone.0150177
M. SA, B. K, J. L, D. G & R. WL (2010) A bioinformatics approach to the identification, classification, and analysis of hydroxyproline-rich glycoproteins. Plant Physiol 153(2):485-513.https://doi.org10.1104/pp.110.156554
M.G.Murray & W.F.Thompson (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8(19).https://doi.org10.1093/nar/8.19.4321
Muzaffar A, Kiani S, Khan MA, Rao AQ, Ali A, Awan MF, Iqbal A, Nasir IA, Shahid AA & Husnain T (2015) Chloroplast localization of Cry1Ac and Cry2A protein-an alternative way of insect control in cotton. Biol Res 48:14.https://doi.org10.1186/s40659-015-0005-z
Nardi CF, Villarreal NM, Rossi FR, Martinez S, Martinez GA & Civello PM (2015) Overexpression of the carbohydrate binding module of strawberry expansin2 in Arabidopsis thaliana modifies plant growth and cell wall metabolism. Plant Mol Biol 88(1-2):101-17.https://doi.org10.1007/s11103-015-0311-4
Ning T, Xie T, Qiu Q, Yang W, Zhou S, Zhou L & Zheng C (2008) Oral administration of recombinant human granulocyte-macrophage colony stimulating factor expressed in rice endosperm can increase leukocytes in mice. Biotechnol Lett 30(9):1679-86.https://doi.org10.1007/s10529-008-9717-2
Peterson D, Barone P, Lenderts B, Schwartz C, Feigenbutz L, St Clair G, Jones S & Svitashev S (2021) Advances in Agrobacterium transformation and vector design result in high-frequency targeted gene insertion in maize. Plant Biotechnol J 19(10):2000-2010.https://doi.org10.1111/pbi.13613
Ribeiro DO, Viegas A, Pires VMR, Medeiros-Silva J, Bule P, Chai W, Marcelo F, Fontes C, Cabrita EJ, Palma AS & Carvalho AL (2020) Molecular basis for the preferential recognition of beta1,3-1,4-glucans by the family 11 carbohydrate-binding module from Clostridium thermocellum. FEBS J 287(13):2723-2743.https://doi.org10.1111/febs.15162
Ringer P, Weissl A, Cost AL, Freikamp A, Sabass B, Mehlich A, Tramier M, Rief M & Grashoff C (2017) Multiplexing molecular tension sensors reveals piconewton force gradient across talin-1. Nat Methods 14(11):1090-1096.https://doi.org10.1038/nmeth.4431
Scheller HV & Ulvskov P (2010) Hemicelluloses. Annu Rev Plant Biol 61:263-89.https://doi.org10.1146/annurev-arplant-042809-112315
Showalter AM (1993) Structure and function of plant cell wall proteins. Plant Cell 5(1):9-23.https://doi.org10.1105/tpc.5.1.9
Sidar A, Albuquerque ED, Voshol GP, Ram AFJ, Vijgenboom E & Punt PJ (2020) Carbohydrate Binding Modules: Diversity of Domain Architecture in Amylases and Cellulases From Filamentous Microorganisms. Front Bioeng Biotechnol 8:871.https://doi.org10.3389/fbioe.2020.00871
Stiefel V, RuizAvila L, Raz R, Valles MP, Gómez J, Pages M, Martinez-lzquierdo JA, Ludevid MD, Langdale JA, Nelson T & Puigdomenech P (1991) Expression of a maize cell wall hydroxyproline-rich glycoprotein gene in early leaf and root vascular differentiation. The Plant Cell 2:785-793.https://doi.org10.1105/tpc.2.8.785
Sufyan Tahir M, Latif A, Bashir S, Shad M, Khan MAU, Gul A, Shahid N, Husnain T, Rao AQ & Ali Shahid A (2021) Transformation and evaluation of Broad-Spectrum insect and weedicide resistant genes in Gossypium arboreum (Desi Cotton). GM Crops Food 12(1):292-302.https://doi.org10.1080/21645698.2021.1885288
Tan L, Qu M, Zhu Y, Peng C, Wang J, Gao D & Chen C (2020) ZINC TRANSPORTER5 and ZINC TRANSPORTER9 Function Synergistically in Zinc/Cadmium Uptake. Plant Physiol 183(3):1235-1249.https://doi.org10.1104/pp.19.01569
Viegas A, Bras NF, Cerqueira NM, Fernandes PA, Prates JA, Fontes CM, Bruix M, Romao MJ, Carvalho AL, Ramos MJ, Macedo AL & Cabrita EJ (2008) Molecular determinants of ligand specificity in family 11 carbohydrate binding modules: an NMR, X-ray crystallography and computational chemistry approach. FEBS J 275(10):2524-35.https://doi.org10.1111/j.1742-4658.2008.06401.x
Viegas A, Sardinha J, Freire F, Duarte DF, Carvalho AL, Fontes CM, Romao MJ, Macedo AL & Cabrita EJ (2013) Solution structure, dynamics and binding studies of a family 11 carbohydrate-binding module from Clostridium thermocellum (CtCBM11). Biochem J 451(2):289-300.https://doi.org10.1042/BJ20120627
Wang Z, Deng L, Weng L, Deng X, Fu X, Xin Y & Xiao G (2017) Transgenic rice expressing a novel phytase-lactoferricin fusion gene to improve phosphorus availability and antibacterial activity. Journal of Integrative Agriculture 16(4):774-788.https://doi.org10.1016/s2095-3119(16)61468-5
Wycoff KL, Powell PA, Gonzales RA, Corbin DR, Lamb C & Dixon RA (1995) Stress Activation of a Bean Hydroxyproline-Rich Glycoprotein Promoter Is Superimposed on a Pattern of Tissue-Specific Developmental Expression. Plant Physiology 109(1):41-52.https://doi.org10.1104/pp.109.1.41
Yang H, Wei H, Ma G, Antunes MS, Vogt S, Cox J, Zhang X, Liu X, Bu L, Gleber SC, Carpita NC, Makowski L, Himmel ME, Tucker MP, McCann MC, Murphy AS & Peer WA (2016) Cell wall targeted in planta iron accumulation enhances biomass conversion and seed iron concentration in Arabidopsis and rice. Plant Biotechnol J 14(10):1998-2009.https://doi.org10.1111/pbi.12557
Yang J, Xun H, Niu L, He H, Cheng Y, Zhong X, Zhao Q, Xing G & Liu J (2021) Elastin-like polypeptide and gamma-zein fusions significantly increase recombinant protein accumulation in soybean seeds. Transgenic Res.https://doi.org10.1007/s11248-021-00258-7
Zeng Q, Deng L, Hu W, He X, Meng Q, Yu J, Li J, Weng L & Xiao G (2020) Verification of Glyphosate Resistance, Lepidopteran Resistance and Wide Compatibility of Male Sterile Line E1C4008S in Rice. Rice Science 27(3):215-226.https://doi.org10.1016/j.rsci.2020.04.004
Zeng Q, Meng Q, Deng L, Weng L, Li J & Xiao G (2019) Identification and Analysis of Important Phenotypes of E1C608 with Glyphosate Resistance and Lepidopteran Resistance in Rice. China Biotechnology 39(11):31-38.https://doi.org10.13523/j.cb.20191104
Zou H, Wenwen Y, Kang Z, Wang G, Zhang Z, Zang G & Huang J (2015) OsEXPB2, a β-expansin gene, is involved in rice root system architecture. Molecular Breeding 35(1).https://doi.org10.1007/s11032-015-0203-y

Download PDF

Journal Publication

published 24 Mar, 2023

Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) →

Reviewers agreed at journal
29 Nov, 2022
Reviewers invited by journal
17 Nov, 2022
Editor assigned by journal
15 Nov, 2022
First submitted to journal
08 Nov, 2022

You are reading this latest preprint version

The carbohydrate-binding module mediates mCherry protein anchoring on the cell wall in rice

Status:

Journal Publication

Version 1

Abstract

Figures

Key Message

Introduction

Materials And Methods

Fusion protein design and vector construction

Transformation And Identification Of Rice Transformants

Total Rna Extraction And Rt-pcr

Glyphosate Tolerance Assay

Fluorescence Analysis

Subcellular Localization Of Fusion Protein

Protoplast Observation

Results

Discussion

Declarations

References

Status:

Journal Publication

Version 1