KAP1 modulates osteogenic differentiation via the ERK/Runx2 cascade in vascular smooth muscle cells

doi:10.21203/rs.3.rs-2251112/v1

Download PDF

Research Article

KAP1 modulates osteogenic differentiation via the ERK/Runx2 cascade in vascular smooth muscle cells

https://doi.org/10.21203/rs.3.rs-2251112/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 27 Jan, 2023

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Background Osteoblast phenotypic transition in vascular smooth muscle cells (VSMCs) has been unveiled as a common cause of vascular calcification (VC). Krüppel-Associated Box (KRAB)-Associated Protein 1(KAP1) is a transcriptional corepressor that modulates various intracellular pathological processes from gene expression to DNA repair to signal transduction. However, the function and mechanism of KAP1 on the osteoblastic differentiation of VSMCs have not been evaluated yet.

Methods and results We demonstrate that the expression of KAP1 in VSMCs is significantly enhanced in vivo and in vitro calcification models. Downregulating the expression of KAP1 suppresses the osteoblast phenotypic transition of VSMCs, which is indicated by a decrease in the expression of osteoblast marker collagenase type I (COL I) and an increase in the expression of VSMC marker α-smooth muscle actin (α-SMA). Conversely, exogenous overexpression of KAP1 could promote osteoblast phenotypic transition of VSMCs. Moreover, KAP1 upregulated the expression of RUNX family transcription factor 2 (Runx2), an inducer of osteoblast that positively regulates many osteoblast-related genes, such as COL I. Evaluation of the potential mechanism demonstrated that KAP1 promoted osteoblast phenotypic transition of VSMCs by activating the extracellular regulated protein kinases (ERK) signaling pathway, which could activate Runx2. In support of this finding, KAP1-induced cell osteoblast phenotypic transition is abolished by treatment with PD0325901, a specific ERK inhibitor.

Conclusions The present study suggested that KAP1 participated in the osteoblast differentiation of VSMCs via the ERK/Runx2 cascade and served as a potential diagnostics and therapeutics target for vascular calcification.

vascular calcification

KAP1

osteoblast differentiation

Runx2

ERK.

Vascular calcification (VC), characterized by calcium and phosphate deposition in blood vessels, has been a life-threatening complication of atherosclerosis, diabetes, chronic kidney failure, and aging[1–3]. Studies have reported that VC is an active and tightly regulated process, sharing many similarities with physiology bone formation[4]. Vascular smooth muscle cells (VSMCs) are the major cell type of arterial media and essential regulators of vascular function. The transformation of VSMCs to an osteoblast-like phenotype is pivotal to the development of VC. This osteogenic transformation is demonstrated by the loss of SMC markers, including α-smooth muscle actin (α-SMA), and gain of osteochondrogenic markers, such as RUNX family transcription factor 2 (Runx2), collagenase type I (COL I), alkaline phosphatase (ALP) and osteopontin (OPN)[5]. In this regard, Runx2 plays a central role which is responsible for the expression of other bone-forming genes. [6, 7].

RAS-RAF-MEK-ERK is a major signaling pathway for cell proliferation, differentiation, apoptosis, and stress response under normal and pathological conditions[8–10]. Accumulating evidence has suggested that ERK signaling cascade is a key downstream pathway involved in cancer progression[11–13]. Likewise, the ERK pathway also participates in VC development and bone homeostasis[14]. A previous study has confirmed that inhibition of the ERK signaling pathway can reduce osteoblast differentiation of VSMCs[15].

Krüppel-associated box (KRAB)-associated protein1 (KAP1), also called triple motif protein 28 (TRIM28) or transcriptional intermediary factor 1 beta (TIF1-β), is an important cofactor of KRAB zinc finger proteins (KRAB-ZFPs)[16]. Its most described function is to target KRAB domain-containing-zinc finger proteins (KZFPs) to transposable elements (TE) by sequence-specific targeting and induce gene silencing [17–22]. In addition, transcription factors that lack a KRAB domain or any silencing complex also have been demonstrated to be regulated by KAP1[23–27]. Evidence is increasing for the importance of KAP1 in a variety of intracellular processes. For instance, KAP1 directly bound to BCL2A1 and promoted BCL2A1 ubiquitination and subsequent proteasomal degradation to modulate cell death[28]. KAP1 enhances cell proliferation in glioblastoma by promoting autophagy[29]. In addition, knockdown of KAP1 abolished the effect of OxLDL on vascular endothelial dysfunction[30]. The positive expression of KAP1 is relative to phenotypic switching of human aortic smooth muscle cells (HASMCs) stimulated by platelet-derived growth factor subunit B homodimer (PDGF-BB). Knockdown of KAP1 prevented phenotypic switching of HASMCs induced by PDGF-BB[31]. Therefore, we speculate that KAP1 may also regulate the osteogenic differentiation in VSMCs after exposure to high phosphorus environment. Furthermore, KAP1 serves as a c-Raf binding partner, regulating the Ras-Raf-ERK signaling cascade to induce the growth of tumor [32]. Nevertheless, it is unclear whether KAP1 regulates the osteoblastic differentiation process of VSMCs through ERK pathway.

In the present study, we found that KAP1 expression was greatly increased in the aortas of calcified rats and VSMCs cultured in high phosphorus. In vitro experiment further demonstrated that KAP1 overexpression was promoted, whereas KAP1 deficiency attenuated high Pi-induced osteoblast phenotypic transition. Last, mechanistic analysis revealed that KAP1 induced VSMCs osteoblast differentiation via the ERK/Runx2 cascade.

Reagents and antibodies

β-GP (G9422) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). ERK inhibitor PD0325901 was purchased from APExBIO Technology LLC (Houston, Texas, USA). TRIzol reagent (15596026) was obtained from Invitrogen Life Technology (Grand Island, NY, USA). PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A) and TB Green Premix Ex Taq™ II (TliRNaseH Plus) (RR820A) were purchased from Takara Co. (Otsu, Shiga, Japan). Lipofectamine 3000 (L3000015) was purchased from Invitrogen Co. (Carlsbad, CA, USA). Immunohistochemistry kits (SP-9001 and SP9002) were purchased from Zhongshan Golden Bridge Technology Co. (Beijing, China). For Western blot (WB), immunofluorescence (IF), and immunohistochemistry (IHC), antibody against KAP1(1:4000 for WB; 1:100 for IF; 1:200 for IHC) was purchased from HUABIO Co. Ltd. (Hangzhou, Zhejiang, China). Antibody against Runx2 (1:1000 for WB; 1:100 for IF) was obtained from Abcam (Cambridge, MA, USA). Antibodies against COL I (1:2000 for WB), a-SMA (1:2000 for WB) and GAPDH (1:1000 for WB) were purchased from Affinity (Biosciences, LNC, USA). Antibodies against p-ERK (1:2000 for WB) and ERK (1:2000 for WB) were provided by Cell Signaling Technology (Beverly, MA, USA).

Animals and groups

Twenty male Sprague–Dawley rats (aged 8-weeks) were purchased from Lab Animal Center of Hebei Medical University (Hebei Province, China). All the rats were kept in standard laboratory conditions (at 22 ± 2°C in 55 to 60% relative humidity, under 12-h light/dark circadian cycle) and they had free access to standard food and tap water and food. After acclimatization, rats were randomly divided into two groups (n = 10): namely control group and VC group. Rat model of VC was constructed by 5/6 nephrectomy combined with a high phosphate diet protocol as previously described[33]. Briefly, first, rats were anesthetized and underwent a 2/3 left nephrectomy. One week later, the total right kidney was removed to achieve 5/6 nephrectomy. The control group underwent surgery to expose the kidneys, but no further procedures were performed. After surgery, the VC group was supplemented with calcitriol (600 ng/kg/day), while the control group was fed with standard rodent chow for 20 weeks.

Cell culture

Isolation of VSMCs was performed from the aortas of Sprague–Dawley rats (8-weeks old) with the use of the explant method as described in a previous study[33]. After cultured in Dulbecco's Modified Eagle Medium containing 10% fetal bovine serum, cells were incubated at 37° C in humidified 5% CO2. VSMCs were used from passages 3–6. For calcification, induction of VSMCs was conducted by meas of incubation in calcifying media containing 10 mM β-GP for 7 d. The medium was changed every 2 d. To explore whether the ERK pathway was involved in the VSMC phenotypic switching, VSMCs were treated with PD 0325901 (5 µM) for 48 h.

Cells transfection

The small hairpin RNA against rat KAP1 (shKAP1) and negative control shRNA (Scramble) were obtained from GenePharma Biotechnology Co. Ltd. (Shanghai, China). The target sequence of the shKAP1 was GCTCTCTAAGAAGCTGATTTA. KAP1 expression plasmid (pcDNA3.1-KAP1(OE KAP1)) was obtained from YouBio Biotechnology Co. Ltd. (Chongqing, China). The shRNAs or vectors were transfected into VSMCs with the use of Lipofectamine 3000™ for 48 h following the manufacturer’s instructions.

Immunohistochemistry staining

Paraffin-embedded sections of thoracic aorta were permeabilized and dehydrated. Next, 3% H2O2 was added to block endogenous peroxidase. After being blocked by goat serum, the incubation of sections was performed with primary antibody overnight at 4°C. The next day, after returning to room temperature, the sections were incubated with biotin-bound secondary antibodies for 30 min at 37°C, followed by staining with DAB. Finally, nuclei were counterstained with hematoxylin. The images were collected under an Olympus microscope.

Von kossa staining

Paraffin-embedded sections of thoracic aorta were permeabilized, dehydrated, incubated with a solution of 5% silver nitrate, and then irradiated with ultraviolet rays for 1h. Then the samples were soaked in 5% sodium thiosulfate solution for 5 min, and in 0.1% hematoxylin-eosin for 2 min. Dehydrated samples were observed by light microscopy.

Alizarin red staining

After the medium had been removed, the cells were washed and then fixed in 4% paraformaldehyde at room temperature for 30 min, followed by incubation with 1% Alizarin red-Tris-HCL solution pH 4.2 (Solarbio Technology Co.; G1452) at 37°C for 30 min. Then, calcified nodules were observed and photographed under an upright microscope.

Calcium content

Calcium content was determined with the use of a commercial kit (Beyotime, China), according to the manufacturer’s protocol. Normalization of the results was performed to the total protein concentration (Solarbio, China).

ALP activity

Alkaline phosphatase (ALP) activity was measured using an ALP assay kit (Nanjing Jiancheng, China) according to the manufacturer’s instructions. Calculated the results using curves generated from standard samples.

Immunofluorescence

The VSMCs were washed, and fixed, followed by permeabilization with 0.3% Triton X-100 for 10 min, and blockage with goat serum at room temperature for 1h. Then incubation of the cells was performed with primary antibodies at 4 ℃ overnight. On the second day, after washing, fluorescent secondary antibodies were used to incubate cells at 37°C in the dark for 30 min. Fluorescence signal was detected after incubation with DAPI.

RNA Isolation and Quantitation

Total RNA was extracted from VSMCs with the use of TRIzol reagent, followed by amplification of cDNA with the use of a TB Green® Premix Ex Taq™ II Kit (Takara, China). Real-time qPCR was conducted to explore mRNA expression in triplicate and repeated in at least three separate experiments. The primer sequences with KAP1, Runx2, COL I, α-SMA, and GAPDH were provided by Sangon Biotech (Shanghai, China), which are shown in Table 1.

Table 1

The sequences of primers used for RT-qPCR.
Gene	Forward primer	Reverse primer
KAP1 Runx2 COL I a-SMA GAPDH	GGGCTATGGCTTTGGGACAGATG CCGCACGACAACCGCACCAT GGTTTGGAGAGAGCATGACC CATCCGACCTTGCTAACGGA CAAGGTCATCCATGACAACTTTG	GATCCAGGCGTTCAAGGCTCAC CGCTCCGGCCCACAAATCTC TTTGGGGAAATGAGTTTGG GTCCAGAGCGACATAGCACA GTCCACCACCCTGTTGCTGTAG

Western blotting analysis

Total cell protein was obtained with RIPA cell lysis buffer and collected by centrifugation. The protein concentrations in VSMCs were measured by BCA method (Solarbio, China). 30ug protein per lane was loaded on 10% SDS-PAGE, which was then transferred to PVDF membranes. After blockage in 5% skim milk at 37℃ for 1 h, incubation of the membranes was performed with specific primary antibodies overnight at 4°C. The next day, after rinse in Tris buffered saline containing 1% Tween, the membranes were incubated with secondary antibodies at room temperature for 1 h. Antibody binding was measured using ECL detection reagent (Thermo, USA) and the intensity of protein bands was analyzed by using Image J software.

Statistical analysis

The analysis of results was performed by two-tailed Student’s t-test and one-way analysis of variance (ANOVA). All statistical analyses were conducted with the use of software SPSS 17.0 and p < 0.05 was considered as statistically significant.

The expression of KAP1 was increased in calcified arteries and VSMCs.

A VC rat model was successfully induced, as evidenced by obvious von Kossa staining (Fig. 1A). The osteogenic marker COL I was distinctly upregulated in the calcified arteries compared to the control group (Fig. 1B). Meanwhile, the KAP1 was increased (Fig. 1B), whereas the VSMC marker α-SMA was markedly decreased in calcified arteries (Fig. 1B). VSMC calcification was evidenced by obvious Alizarin red S staining and increased calcium deposition in vitro (Fig. 1C and 1D). The protein levels of KAP1 increased in calcified VSMCs, as indicated by western blot analysis (Fig. 1E), which is in parallel with the upregulation of COL I and downregulation of a-SMA protein expression (Fig. 1H). KAP1 mRNA was also upregulated (Fig. 1F), likewise, COL I mRNA was upregulated while a-SMA mRNA was downregulated (Fig. 1I) in calcified VSMCs. Immunofluorescence also revealed an increase in KAP1 in high-Pi induced VSMCs (Fig. 1G, green). These results suggest that KAP1 may be participate in the calcification process through its connection with the osteoblast phenotypic transition of VSMCs.

KAP1 promoted osteogenic differentiation and calcification in VSMCs

To determine whether KAP1 is required for osteoblast differentiation and calcification of VSMCs, shRNA was used to knock down KAP1 in high Pi-treated VSMCs. As shown in Fig. 2A, KAP1 silencing markedly alleviated COL I expression in high Pi-induced VSMC, but a-SMA was increased. Similarly, the results of ALP activity, Alizarin red S staining and calcium deposition further verified the effect of KAP1 on osteoblast differentiation and calcification (Fig. 2B, 2C and 2D).

To further explore the relationship of KAP1 with osteoblast differentiation, we constructed an overexpression plasmid of KAP1. Western blot analysis indicated that COL I expression was significantly upregulated, while a-SMA was downregulated in VSMCs cultured under normal conditions after overexpression of KAP1 (Fig. 2E). Moreover, overexpression of KAP1 further aggravated ALP activity, Alizarin red S staining and calcium deposition of VSMCs (Fig. 2F, 2G and 2H). These results suggest that osteochondrogenic markers expression and calcification were regulated by KAP1 in VSMCs.

ERK pathway was involved in osteoblast differentiation and calcification of VSMCs

In view of the ERK signaling pathway that has been reported to mediate the functional effect of osteogenesis[14, 15, 34], we questioned whether KAP1 affected ERK expression under osteogenic induction. First, we found that the ERK pathway was activated in calcified arteries and VSMCs stimulated by high phosphorus. As indicated in Fig. 3A, compared with paired control aortas, the intensity of p-ERK immunoreactivity was increased in calcified arteries. And again, western blot results showed p-ERK was increased in high Pi-induced VSMCs, but it did not alter ERK expression (Fig. 3B). To confirm the role of ERK in phenotypic switch regulation of VSMC, we applied the ERK pathway inhibitor PD0325901. As shown in Fig. 3C, PD0325901 significantly decreased p-ERK expression without any significant alteration in the expression of ERK, as compared with the control group with DMSO. Moreover, COL I was reduced by 24.6%, a-SMA was increased by 29.8% with the treatment of PD0325901 in VSMCs compared with the control group treated with DMSO. These findings demonstrated activation of the ERK pathway in calcified arteries and VSMCs.

The expression of Runx2 was controlled by KAP1 in VSMCs

Runx2 is an essential transcription factor which can regulate the downstream osteogenesis-related gene expression. Previous reports have shown that p-ERK could positively regulate Runx2 expression [35–37] and Runx2 could enhance CLO I expression[6, 7]. Our results indicated that overexpression KAP1 upregulated the mRNA and protein levels of Runx2, whereas knockdown of KAP1 suppressed the expression of Runx2 (Fig. 4A and 4C). Correlation analysis was performed to assess the relationship between the expression of KAP1 and Runx2. (Fig. 4B). The result showed that KAP1 was positively correlated with Runx2. Similarly, the results of the fluorescence intensity were consistent with the above indicators (Fig. 4D). These findings indicate that the expression of Runx2 is regulated by KAP1 in VSMCs.

KAP1 modulated osteogenic differentiation via the ERK-Runx2 cascade

To determine whether KAP1 affected ERK expression or activation, we transfected VSMCs with OE KAP1. The results indicated that KAP1 overexpression raised the protein level of p-ERK and the ERK expression remained unchanged (Fig. 5A). Moreover, no obvious alteration was witnessed in the expression of p38 with or without overexpression of KAP1, suggesting that p38 pathway was independent of KAP1(Fig. 5A). In addition, correlation analysis showed KAP1 overexpression was significantly positively associated with p-ERK expression (Fig. 5B). These results revealed that during osteogenesis differentiation, ERK served as downstream of KAP1, whose regulatory function depended on the activity of p-ERK in high-Pi-induced VSMC.

To further verify the dependence of KAP1 on ERK signaling in VSMCs osteoblast differentiation, we transfected cells with KAP1 overexpression plasmid with or without ERK inhibitor PD0325901, then observing the alteration of Runx2, COL I and a- SMA of VSMCs. Western blot analysis suggested that KAP1 overexpression promoted Runx2 and COL I expression, and this effect was inhibited by blocking the ERK pathway using PD0325901 (Fig. 5C). Again, the alizarin red staining was consistent with these results (Fig. 5D). Taken together, these findings suggest that KAP1 accelerates osteoblast activity by modulating the ERK/Runx2 cascade (Fig. 5E).

In the current study, we elucidated the effect of KAP1 on the osteoblast differentiation and calcification of VSMCs. The findings suggested that KAP1 overexpression was enhanced, whereas KAP1 deficiency attenuated β-GP-induced osteoblast differentiation and calcification. Moreover, high-phosphate induced the activation of the ERK signaling pathway, and ERK signaling inhibition could alleviate osteoblast differentiation and calcification. Furthermore, KAP1 overexpression promoted the expression of Runx2 and COL I, which could be inhibited by blocking the ERK pathway. Thus, we summarized that KAP1 promotes the calcification of VSMC in a high-phosphorus environment by activating the ERK pathway-mediated effect of promoting osteoblast differentiation. The current study highlights the key role of KAP1 in VC development.

KAP1, also known as TRIM28 or TIF1-β, is a large multi-domain protein that plays a multifaceted role in various organismal processes. Mouse embryos lacking KAP1 fail to develop into gastrulate, suggesting that KAP1 is vital for early post-implantation development [38]. The upregulation of KAP1 was detected in various types of tumors, including gastric, cervical, ovarian and breast cancers [39–42]; an increase in KAP1 expression enhanced the cell proliferation and migration, indicating that KAP1 promoted phenotypic transformation of tumor cells. Importantly, overexpression of KAP1 has been reported to induce the migration and invasion of HASMCs after exposure to PDGF-BB[31]. However, opposite conclusions were also reported. KAP1 and TRIM27 cooperatively maintain the contractile phenotype of human VSMCs, knockdown of KAP1 and TRIM27 cause phenotypic conversion of the contractile VSMCs to a synthetic phenotype [43], which suggested that the roles of KAP1 were divergent with cell-type-specific and the types of stimuli. In the current study, our results indicated KAP1 was significantly increased in calcified arteries and VSMCs. High KAP1 expression was correlated to the increase of ALP activity and calcium content, the formation of calcified nodules, and the expression of Runx2 and COL I. These findings suggest that high KAP1 expression is one of the biomarkers indicating the osteoblast differentiation and calcification of VSMCs and KAP1 might play a role in pro-vascular calcification in high-Pi induced VSMCs.

VC that is similar to bone formation is regulated by a number of signaling pathways, including ERK pathway[15, 44]. Earlier research has found the activation of ERK signaling pathways promotes VC [45]. Moreover, it has reported that ERK signaling pathway is a crucial mechanism in osteoblast differentiation, and ERK inhibitors could weaken Runx2 expression and ALP activities[34]. Correspond to these findings, we demonstrated that ERK signaling pathway is highly activated in high-Pi induced VSMCs. Moreover, we also found that upregulation of KAP1 significantly increased the phosphorylation of ERK. Furthermore, we evaluated the effect of PD0325901, a specific ERK inhibitor, on KAP1-overexpressing VSMCs. The results revealed that treatment with 5 µM PD0325901 significantly inhibited the KAP1-overexpression-mediated increase in Runx2 and COL I expression, suggesting that ERK pathway may be the main downstream effector of KAP1 in promoting osteoblast differentiation and calcification of VSMCs.

VC that occurs in the end-stage of CKD mainly refers to the medial calcification, which is a cell-mediated process associated with mineral metabolic disorders and no efficient methods for pharmacotherapy [46]. Based on accumulating evidence, VC is an active and multifaceted biological process, including chronic inflammation, autophagy defects, endoplasmic reticulum (ER) stress, and osteoblast differentiation of VSMCs, suggesting that efforts at these cellular events should be made to develop new therapeutic strategies towards a more efficient targeting of VC[47]. This study indicates that KAP1 is highly expressed in calcified arteries and VSMCs and may play a role in pro-vascular calcification, which might be a potential novel target for the treatment of VC. Therefore, our findings would provide new insights into the pathophysiological mechanisms of VC, aiming to reduce the risk of cardiovascular complications. However, extensive in vivo and human researches are needed to confirm these findings and to pinpoint the exact molecular mechanism involved.

This study indicates that KAP1 is highly expressed in calcified arteries and VSMCs and may play a role in pro-vascular calcification in high-Pi induced VSMCs, and ERK pathway plays an important role in this process. Extensive in vivo and human researches are needed to confirm these findings and to pinpoint the exact molecular mechanism involved.

Author contributions

YLB and JSX conceived the study. WWB and DXZ performed the follow-up experiments and wrote the manuscript. LML performed data collections and calculations. MJC and JJJ oversaw language editing. All authors read and approved the final manuscript.

Fundings

This work was supported by The Project of Hebei Clinical Medicine Outstanding Personnel Training (2019139), Hebei Province Medical Technology Tracking Project (G2018050), Hebei Province Key Research and Development Project (20377704D), and Hebei Province Innovation Capacity Improvement Project (20577701D)

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.

Declarations Conflict of interest The authors declare that there are no conflict of interest associated with the manuscript. Ethical approval The experimental protocols were reviewed and approved by the Animal Care and Use Institutional Committee of The Fourth Affiliated Hospital of Hebei Medical University (No. 2020ky189).

Vervloet M, Cozzolino M (2017) Vascular calcification in chronic kidney disease: different bricks in the wall? Kidney Int 91:808–817
Lanzer P, Boehm M, Sorribas V, Thiriet M, Janzen J, Zeller T, St Hilaire C, Shanahan C (2014) Medial vascular calcification revisited: review and perspectives. Eur Heart J 35:1515–1525
Rennenberg RJMW, Kessels AGH, Schurgers LJ, van Engelshoven JMA, de Leeuw PW, Kroon AA (2009) Vascular calcifications as a marker of increased cardiovascular risk: a meta-analysis. Vasc Health Risk Manag 5:185–197
Cozzolino M, Ciceri P, Galassi A, Mangano M, Carugo S, Capelli I, Cianciolo G (2019) The Key Role of Phosphate on Vascular Calcification. Toxins (Basel) 11:213
Smith ER (2016) : Vascular Calcification in Uremia: New-Age Concepts about an Old-Age Problem. Methods In Molecular Biology (Clifton, NJ) 1397:175–208
Lee KS, Kim HJ, Li QL, Chi XZ, Ueta C, Komori T, Wozney JM, Kim EG, Choi JY, Ryoo HM, Bae SC (2000) Runx2 is a common target of transforming growth factor beta1 and bone morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast-specific gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol 20:8783–8792
Zhang X, Yang M, Lin L, Chen P, Ma KT, Zhou CY, Ao YF (2006) Runx2 overexpression enhances osteoblastic differentiation and mineralization in adipose–derived stem cells in vitro and in vivo. Calcif Tissue Int 79:169–178
Samatar AA, Poulikakos PI (2014) Targeting RAS-ERK signalling in cancer: promises and challenges. Nat Rev Drug Discovery 13:928–942
Matallanas D, Birtwistle M, Romano D, Zebisch A, Rauch J, von Kriegsheim A, Kolch W (2011) Raf family kinases: old dogs have learned new tricks. Genes & Cancer 2:232–260
Degirmenci U, Wang M, Hu J (2020) Targeting Aberrant RAS/RAF/MEK/ERK Signaling for Cancer Therapy. Cells 9:198
Martinelli E, Morgillo F, Troiani T, Ciardiello F (2017) Cancer resistance to therapies against the EGFR-RAS-RAF pathway: The role of MEK. Cancer Treat Rev 53:61–69
Amann VC, Ramelyte E, Thurneysen S, Pitocco R, Bentele-Jaberg N, Goldinger SM, Dummer R, Mangana J (2017) Developments in targeted therapy in melanoma. Eur J Surg Oncology: J Eur Soc Surg Oncol Br Association Surg Oncol 43:581–593
Cantwell-Dorris ER, O'Leary JJ, Sheils OM (2011) BRAFV600E: implications for carcinogenesis and molecular therapy. Mol Cancer Ther 10:385–394
Li B, Zhao J, Ma J-X, Li G-M, Zhang Y, Xing G-S, Liu J, Ma X-L (2018) Overexpression of DNMT1 leads to hypermethylation of H19 promoter and inhibition of Erk signaling pathway in disuse osteoporosis. Bone 111:82–91
Liu H, Li X, Qin F, Huang K (2014) Selenium suppresses oxidative-stress-enhanced vascular smooth muscle cell calcification by inhibiting the activation of the PI3K/AKT and ERK signaling pathways and endoplasmic reticulum stress. J Biol Inorg Chemistry: JBIC : Publication Soc Biol Inorg Chem 19:375–388
Friedman JR, Fredericks WJ, Jensen DE, Speicher DW, Huang XP, Neilson EG, Rauscher FJ (1996) KAP-1, a novel corepressor for the highly conserved KRAB repression domain. Genes Dev 10:2067–2078
Matsui T, Leung D, Miyashita H, Maksakova IA, Miyachi H, Kimura H, Tachibana M, Lorincz MC, Shinkai Y (2010) Proviral silencing in embryonic stem cells requires the histone methyltransferase ESET. Nature 464:927–931
Castro-Diaz N, Ecco G, Coluccio A, Kapopoulou A, Yazdanpanah B, Friedli M, Duc J, Jang SM, Turelli P, Trono D (2014) Evolutionally dynamic L1 regulation in embryonic stem cells. Genes Dev 28:1397–1409
Ecco G, Cassano M, Kauzlaric A, Duc J, Coluccio A, Offner S, Imbeault M, Rowe HM, Turelli P, Trono D (2016) Transposable Elements and Their KRAB-ZFP Controllers Regulate Gene Expression in Adult Tissues. Dev Cell 36:611–623
Rowe HM, Jakobsson J, Mesnard D, Rougemont J, Reynard S, Aktas T, Maillard PV, Layard-Liesching H, Verp S, Marquis J et al (2010) KAP1 controls endogenous retroviruses in embryonic stem cells. Nature 463:237–240
Wolf D, Goff SP (2009) Embryonic stem cells use ZFP809 to silence retroviral DNAs. Nature 458:1201–1204
Wolf D, Goff SP (2007) TRIM28 mediates primer binding site-targeted silencing of murine leukemia virus in embryonic cells. Cell 131:46–57
Iyengar S, Ivanov AV, Jin VX, Rauscher FJ, Farnham PJ (2011) Functional analysis of KAP1 genomic recruitment. Mol Cell Biol 31:1833–1847
Bunch H, Zheng X, Burkholder A, Dillon ST, Motola S, Birrane G, Ebmeier CC, Levine S, Fargo D, Hu G et al (2014) TRIM28 regulates RNA polymerase II promoter-proximal pausing and pause release. Nat Struct Mol Biol 21:876–883
Bunch H, Calderwood SK (2015) TRIM28 as a novel transcriptional elongation factor. BMC Mol Biol 16:14
McNamara RP, Reeder JE, McMillan EA, Bacon CW, McCann JL, D'Orso I (2016) KAP1 Recruitment of the 7SK snRNP Complex to Promoters Enables Transcription Elongation by RNA Polymerase II. Mol Cell 61:39–53
D'Orso I (2016) 7SKiing on chromatin: Move globally, act locally. RNA Biol 13:545–553
Lionnard L, Duc P, Brennan MS, Kueh AJ, Pal M, Guardia F, Mojsa B, Damiano M-A, Mora S, Lassot I et al (2019) TRIM17 and TRIM28 antagonistically regulate the ubiquitination and anti-apoptotic activity of BCL2A1. Cell Death Differ 26:902–917
Peng Y, Zhang M, Jiang Z, Jiang Y (2019) TRIM28 activates autophagy and promotes cell proliferation in glioblastoma. OncoTargets and Therapy 12:397–404
Yan T, Liang C, Fan H, Zhou W, Huang L, Qi S, Wang W, Ma P (2020) KAP1 silencing relieves OxLDL-induced vascular endothelial dysfunction by down-regulating LOX-1. Biosci Rep 40:BRS20200821
Liu H, Chen H, Deng X, Peng Y, Zeng Q, Song Z, He W, Zhang L, Xiao T, Gao G, Li B (2019) Knockdown of TRIM28 inhibits PDGF-BB-induced vascular smooth muscle cell proliferation and migration. Chemico-Biol Interact 311:108772
Wu G-J, Pen J, Huang Y, An S, Liu Y, Yang Y, Hao Q, Guo X-X, Xu T-R (2018) KAP1 inhibits the Raf-MEK-ERK pathway to promote tumorigenesis in A549 lung cancer cells. Mol Carcinog 57:1396–1407
Bai Y, Cheng M, Jin J, Zhang H, He L, Zhou W, Zhang S, Xu J (2022) SET8, a novel regulator to ameliorate vascular calcification via activating PI3K/Akt mediated anti-apoptotic effects. Biochem Cell Biology = Biochimie Et Biol Cellulaire 100:104–114
Lee JY, Park SJ, Kim DA, Lee SH, Koh J-M, Kim B-J (2020) Muscle-Derived Lumican Stimulates Bone Formation via Integrin α2β1 and the Downstream ERK Signal. Front Cell Dev Biology 8:565826
Son H-E, Jang W-G (2021) Cip2A modulates osteogenic differentiation via the ERK-Runx2 pathway in MG63 cells. Biofactors 47:658–664
Katsianou M, Papavassiliou KA, Zoi I, Gargalionis AN, Panagopoulos D, Themistocleous MS, Piperi C, Papavassiliou AG, Basdra EK (2021) Polycystin-1 modulates RUNX2 activation and osteocalcin gene expression via ERK signalling in a human craniosynostosis cell model. J Cell Mol Med 25:3216–3225
Yan Y, Liu Y, Lu R (2021) PELP1 promotes the expression of RUNX2 via the ERK pathway during the osteogenic differentiation of human periodontal ligament stem cells. Arch Oral Biol 124:105078
Cammas F, Mark M, Dollé P, Dierich A, Chambon P, Losson R (2000) Mice lacking the transcriptional corepressor TIF1beta are defective in early postimplantation development. Development 127:2955–2963
Yokoe T, Toiyama Y, Okugawa Y, Tanaka K, Ohi M, Inoue Y, Mohri Y, Miki C, Kusunoki M (2010) KAP1 is associated with peritoneal carcinomatosis in gastric cancer. Ann Surg Oncol 17:821–828
Lin L-F, Li C-F, Wang W-J, Yang W-M, Wang DD-H, Chang W-C, Lee W-H, Wang J-M (2013) Loss of ZBRK1 contributes to the increase of KAP1 and promotes KAP1-mediated metastasis and invasion in cervical cancer. PLoS ONE 8:e73033
Hu M, Fu X, Cui Y, Xu S, Xu Y, Dong Q, Sun L (2015) Expression of KAP1 in epithelial ovarian cancer and its correlation with drug-resistance. Int J Clin Exp Med 8:17308–17320
Wei C, Cheng J, Zhou B, Zhu L, Khan MA, He T, Zhou S, He J, Lu X, Chen H et al (2016) Tripartite motif containing 28 (TRIM28) promotes breast cancer metastasis by stabilizing TWIST1 protein. Sci Rep 6:29822
Wang Y, Hao Y, Zhao Y, Huang Y, Lai D, Du T, Wan X, Zhu Y, Liu Z, Wang Y et al (2020) TRIM28 and TRIM27 are required for expressions of PDGFRβ and contractile phenotypic genes by vascular smooth muscle cells. FASEB journal: official publication of the Federation of American Societies for Experimental Biology 34:6271–6283
Blanc A, Pandey NR, Srivastava AK (2004) Distinct roles of Ca2+, calmodulin, and protein kinase C in H2O2-induced activation of ERK1/2, p38 MAPK, and protein kinase B signaling in vascular smooth muscle cells. Antioxid Redox Signal 6:353–366
Chavkin NW, Chia JJ, Crouthamel MH, Giachelli CM (2015) Phosphate uptake-independent signaling functions of the type III sodium-dependent phosphate transporter, PiT-1, in vascular smooth muscle cells. Exp Cell Res 333:39–48
Sedaghat S, Hoorn EJ, Ikram MA, Koop-Nieuwelink C, Kavousi M, Franco OH, van der Lugt A, Vernooij MW, Bos D (2019) Kidney Function and Arterial Calcification in Major Vascular Beds. J Am Heart Association 8:e010930
Lee SJ, Lee I-K, Jeon J-H (2020) : Vascular Calcification-New Insights Into Its Mechanism.International Journal of Molecular Sciences21

Download PDF

Journal Publication

published 27 Jan, 2023

Read the published version in Molecular Biology Reports →

Reviewers agreed at journal
16 Nov, 2022
Reviewers invited by journal
15 Nov, 2022
Editor assigned by journal
14 Nov, 2022
First submitted to journal
08 Nov, 2022

You are reading this latest preprint version

KAP1 modulates osteogenic differentiation via the ERK/Runx2 cascade in vascular smooth muscle cells

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and Methods

Reagents and antibodies

Animals and groups

Cell culture

Cells transfection

Immunohistochemistry staining

Von kossa staining

Alizarin red staining

Calcium content

ALP activity

Immunofluorescence

RNA Isolation and Quantitation

Western blotting analysis

Statistical analysis

Results

KAP1 promoted osteogenic differentiation and calcification in VSMCs

ERK pathway was involved in osteoblast differentiation and calcification of VSMCs

The expression of Runx2 was controlled by KAP1 in VSMCs

KAP1 modulated osteogenic differentiation via the ERK-Runx2 cascade

Discussion

Conclusions

Declarations

References

Status:

Journal Publication

Version 1