RIPK3 Promotes Hantaviral Replication by Restricting JAK-STAT Signaling but not Triggering Necroptosis.

doi:10.21203/rs.3.rs-2252467/v1

Download PDF

Article

RIPK3 Promotes Hantaviral Replication by Restricting JAK-STAT Signaling but not Triggering Necroptosis.

https://doi.org/10.21203/rs.3.rs-2252467/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Hantaan virus (HTNV) is a rodent-borne virus that can cause hemorrhagic fever with renal syndrome (HFRS) with a case fatality rate of 15% and is listed as a re-emerging infectious disease (REID) in China. At present, no specific therapeutic strategies against HTNV are available. Interferon (IFN) is a crucial antiviral molecular which can trigger interferon-stimulated genes (ISGs) expression through the Janus kinase-signal transducer and activator of transcription 1 (JAK-STAT) pathway. Large quantities of IFN produced at the late stage of HTNV infection could not effectively restrain viral replication, the mechanism of which is still unclear. Here, we identified the receptor-interacting protein kinase 3 (RIPK3), a critical molecular to mediate necroptosis, could facilitate HTNV infection by blocking JAK/STAT signaling. HTNV infection promoted the total expression level of RIPK3, but not the phosphorylation of RIPK3, thus not leading to cell death. RIPK3 ablation could restrain HTNV replication by enhancing the expression of multiple ISGs, during which the type I IFN generation did not strengthened. Exogenously expressing RIPK3 might hinder the host anti-hantaviral responses. RIPK3^−/− mice also maintained a robust ability to clear HTNV promptly with enhanced innate immune responses. Mechanistically, RIPK3 restricted STAT1 activation by bonding to STAT1 and blocking its phosphorylation sites, hence interfering with host IFN responses. Overall, these observations demonstrated a noncanonical function of RIPK3 during viral infection, and shed light on the novel evasion strategy of host innate immunity by HTNV.

Hantaan virus

RIPK3

IFN-stimulated genes

STAT1

Innate immune response

Hantaan virus (HTNV) is a negative-sense RNA virus belonging to the Bunyavirales order, Hantaviridae family. HTNV is prevalent in Asia and is carried and transmitted to humans by inhaled infective aerosols from the excrement of rodents¹. HTNV causes hemorrhagic fever with renal syndrome (HFRS), with mortality rates from 5 to 15% in the human race². It has been widely believed that HFRS is a type of systemic inflammatory response syndrome for which it is difficult to explain the pathogenesis with a single factor^3,4.

Type I interferon (IFN) and ISGs participate in the host immune response against hantaviral infection. Pathogen-associated molecular patterns (PAMPs) trigger pattern recognition receptors (PRRs) to transmit innate immune signals to dock molecules, especially the Toll-like receptor 3- TIR-domain-containing adapter-inducing IFN-β (TLR3-TRIF) and Retinoic acid-inducible gene I-Mitochondrial antiviral signaling protein (RIG-I-MAVS) axes, and promote IFN secretion by monocytes and lymphocytes^5–7. IFNs then induce the transcription of ISGs through the Janus kinase-Signal transducer and activator of transcription (JAK/STAT) pathway⁷. In the progression of infection, type I (IFN-α/β) and type III (IFN-λ) IFNs activate JAK, and then JAK phosphorylates STAT1 and STAT2 to form a heterodimer. The heterodimer combine with interferon regulatory factor 9 (IRF9) to create a complex interferon-stimulated gene factor 3 (ISGF3), which is capable of binding to interferon-stimulated response elements (ISREs) and inducing the transcription of ISGs⁸. HTNV-induced high levels of IFN activate JAK and STAT1. Then, a large number of ISGs were expressed, including myxovirus resistance protein 1 (MX1), 2'-5'-oligoadenylate synthetases 1 (OAS1), and interferon-induced tetratricopeptide repeat protein 2 (IFIT2)⁹. As early as 2008, studies have demonstrated that higher levels of IFN-β occurred in the serum of HFRS patients, which was a positive correlation with disease severity. Pre-treatment with IFNα/β could block HTNV infection, while the administration of type I IFN could not affect viral replication post-infection^10–12. It has become clear that HTNV has evolved an evasion mechanism, and IFN produced in the late stage of infection cannot effectively prevent viral spread. Our previous results demonstrated that glycoprotein (Gn)-induced mitophagy inhibits type I IFN responses by degrading MAVS¹³.

Receptor-interacting protein kinase 3 (RIPK3) is a classical serine/threonine receptor-interacting protein kinase involved in necroptosis. RIPK1 activates RIPK3 by combining with the RIP homotypic interaction motif (RHIM) at the C-terminal kinase domain of RIPK3. And a kinase domain at the N-terminus of RIPK3 is used to bind and phosphorylates mixed lineage kinase domain-like (MLKL). MLKL oligomers then disrupt membrane integrity and eventually cause necroptosis. In addition to the widely accepted notion that RIPK3 performs pro-necroptotic functions, RIPK3 is involved in mediating the IFN signaling pathways post-infection. RIPK3 facilitates canonical TRIF-dependent IFN-β production downstream of the lipopolysaccharide (LPS) receptor TLR4 (independent of MLKL) in bone marrow-derived macrophages (BMDMs)¹⁴. However, we previously reported that the increased expression of RIPK3, despite participating in neuroinflammation and neuronal death, was able to inhibit the expression of IFN-induced protein 44-like gene (IFI44L), which caused neurons to become susceptible to Japanese encephalitis virus (JEV)¹⁵.

In this study, we found RIPK3 was increased post HTNV infection without triggering cell death. RIPK3 facilitated HTNV infection by regulating STAT1-mediated antiviral responses and restricting the expression of ISGs. Additionally, RIPK3^−/− mice challenged by HTNV showed virus clearance ability and enhanced inflammatory responses characterized by prominent macrophage activation. Mechanistically, this function of RIPK3 relied on the interaction between RIPK3 and STAT1, and thus inhibited the phosphorylation and translocation of STAT1. These findings demonstrated a previously unidentified role for RIPK3 in HTNV infection, and revealed a novel theory of the mechanism of immune evasion post HTNV infection.

Plasmids and transfection

All the plasmids applied here are listed in Table 1. For plasmids transfection, the hieff trans™ liposomal transfection reagent (Yeasen, China) for plasmids, and EntransterTM-R4000 (Engreen, China) was applied for siRNA.

Table 1

Plasmids used in experiments.
pISRE-TA-Luc	Beyotime	Cat #D2179
IgK-IFN-Luc	Miaolingbio	Cat #P1700
STAT1-Luc	Yeasen	Cat #11504ES03
pCMV3-C-Myc-STAT1	Sino Biological	Cat #MG53362-CM
pEGFP-N1-STAT1	Constructed in our Lab	N/A
pCMV-RIPK3-mCherry	Constructed in our Lab	N/A
pcDNA3.1-Flag-RIPK3	Constructed in our Lab	N/A

Cell Culture and Viral Infection

HEK293T (CRL-3216), Huh-7 (SNL-085), A549 (CCL-185) and Vero E6 (TIB-152) cells were purchased from the American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA), which contains 10% fatal bovine serum (HyClone, Logan, UT) and 1% Penicillin-StreptoMycin-Gentamicin Solution 100x in a humidified incubator with 95% air and 5% CO₂ at 37°C. The murine fibroblast cell line L929 cells were purchased from ATCC, which were cultured in RPMI medium 1640 with 10% or 20% FBS and 1% Penicillin-StreptoMycin-Gentamicin Solution 100x at 37°C in a humidified incubator containing 5% CO₂. BMDMs were obtained from the bone marrow of C57BL/6J mice or RIPK3^−/− mice and then were immersed in sterile Dulbecco’s phosphate-buffered saline (DPBS). After flushing out the whole bone marrow cells from the tibia and femurs, we cultured them in complete RPMI media (Gibco, USA) for 7 days (1640 with 20% FBS: L929 supernatant = 1:3 in volume)¹⁶.

HTNV strain 76–118, preserved in our Lab, was first expanded in Kunming suckling mice and subsequently propagated in Vero E6 cells. The titers of HTNV were detected by 50% tissue culture infective dose (TCID₅₀). Before HTNV infection, cells were rinsed by DPBS to remove excess serum, and then cultured with HTNV with desired MOI. After incubating for 90–120 min, the medium mentioned above was replaced by the complete medium.

Mouse Experiments and Preparation of Samples

Six to eight-week-old female C57BL/6J mice (17-21g) were purchased from the Experimental Animal Center of Air Force Medical University. The RIPK3^−/− C57BL/6J mice were kindly provided by Dr. Yazhou Wang (Department of Neurobiology and Collaborative Innovation Center for Brain Science, School of Basic Medicine, Air Force Medical University)¹⁵. All animals received care according to institutional guidelines. (The number of the table of animal experimental welfare and ethical inspiration: 20210405)

The DNA samples from newborn mice were amplified through PCR, and the products were analyzed by agarose gel electrophoresis to screen for RIPK3^−/− descendants. The primer sequences used for RIPK3 are shown below.

forward, 5′-AGAAGATGCAGCAGCCTCAGCT-3′,

reverse1, 5'-ACGGACCCAGGCTGACTTATCTC-3,

reverse2, 5'- GGCACGTGCACAGGAAATAGC-3'.

RIPK3^−/− and WT mice were infected with HTNV through intravenous injection. Body weights and anal temperatures were detected daily. Mice were anesthetized for testing other indicators after infection for 9 days (The routine blood tests and pathological detection in organs).

RNA Extraction and Quantitative real-time PCR (qRT-PCR) Analysis

Total cellular RNA was extracted from cultured cells or fresh tissue samples with TRIZOL (Invitrogen, 15596026), and the concentration of RNA was measured by BioTek Epoch. Reverse transcription (RT) was performed with Hifair® Ⅱ 1st Strand cDNA Synthesis SuperMix (Yeasen, 11120ES60) according to the instructions. Real-time PCR was carried out by using Hieff® qPCR SYBR Green Master Mix (No Rox) (Yeasen, 11201ES08) under a CFX96™ instrument (Bio-rad, USA) as follows:

Each cDNA was denatured at 95°C for 10s and amplified for 40 cycles of 10s at 95°C, and 30s at 60°C in LightCycler 96 (Roche). The mRNA expression level of each target gene was normalized to the respective GAPDH and analyzed. The primer sequences are shown in Table 2:

Table 2

The sequences for qRT-PCR primers and siRNAs.
HTNV S	forward, 5′-TCTAGTTGTATCCCCATCGACTG-3′ reverse, 5′-ACATGCGGAATACAATTATGGC-3′
mus-Ripk3	forward, 5′-TCTGTCAAGTTATGGCCTACTGG-3′ reverse, 5′-GGAACACGACTCCGAACCC-3′
mus-Mlkl	forward, 5′-AATTGTACTCTGGGAAATTGCCA-3′ reverse, 5′-TCTCCAAGATTCCGTCCACAG-3′
mus-Tlr3	forward, 5′- GTGAGATACAACGTAGCTGACTG-3′ reverse, 5′- TCCTGCATCCAAGATAGCAAGT-3′
mus-Tlr4	forward, 5′- ATGGCATGGCTTACACCACC − 3′ reverse, 5′- GAGGCCAATTTTGTCTCCACA − 3′
mus-Il-6	forward, 5′-AAGAGCCAGAGTGTCAGAATCT-3′ reverse, 5′-AGCTCCAGTTGGTAATTTCTTGG-3′
mus-Il-10	forward, 5′-GCCTGGAACGTAGACGACAT-3′ reverse, 5′-TTCCCATGGTGCCTGAATCC-3′
mus-Mx1	forward, 5′- GACCATAGGGGTCTTGACCAA − 3′ reverse, 5′- AGACTTGCTCTTTCTGAAAAGCC − 3′
mus-Mx2	forward, 5′- CAAGGAACACCCTCATTTCAGAG-3′ reverse, 5′- GCAGCTCCTCACTTGCACT − 3′
mus-Ifit1	forward, 5′- GCCTATCGCCAAGATTTAGATGA − 3′ reverse, 5′-TTCTGGATTTAACCGGACAGC-3′
mus-Isg15	forward, 5′-GGTGTCCGTGACTAACTCCAT-3′ reverse, 5′-CTGTACCACTAGCATCACTGTG-3′
mus-Gapdh	forward, 5′-ACCCAAAGACTGTGGATGG-3′ reverse, 5′-ACACATTGGGGGTAGGAACA-3′
homo-MX1	forward, 5′-GTTTCCGAAGTGGACATCGCA-3′ reverse, 5′-CTGCCAGGTTGTTCTCAGC-3′
homo-IFIT2	forward, 5′- AAGCACCTCAAAGGGCAAAAC-3′ reverse, 5′- TCGGCCCATGTGATAGTAGAC-3′
homo-IFITM3	forward, 5′- ACTGTCCAAACCTTCTTCTCTCC-3′ reverse, 5′- TCGCCAACCATCTTCCTGTC-3′
homo-ISG15	forward, 5′- CGCAGATCACCCAGAAGATCG-3′ reverse, 5′- TTCGTCGCATTTGTCCACCA-3′
Homo-GAPDH	forward, 5′- GGAGCGAGATCCCTCCAAAAT-3′ reverse, 5′- GGCTGTTGTCATACTTCTCATGG-3′

Immunoblot Assays and co-immunoprecipitation (co-IP)

The tissue and cell lysates were prepared in radio immunoprecipitation assay (RIPA lysis buffer, Beyotime), containing protease inhibitor cocktail (Targetmoi) and phosphatase inhibitor cocktail I and II (Targetmoi). The concentration of collected proteins was measured by Pierce™ BCA Protein Assay Kit (Thermo). Protein samples were separated by 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes (PVDF). Then, 5% non-fat milk solution was used for blocking at room temperature for 1.5h. Next, diluted the primary antibody (1:1000) was added at 4°C overnight and the secondary antibody (1:10000) labeled with infrared dyes was incubated for 1h at room temperature. The signals on the PVDF membrane were visualized using the Odyssey Infrared Imaging System (LI-COR Biosciences). Densitometric analysis of protein band intensity was performed by using Image J software (NIH, USA). GAPDH was used as a loading control for normalization. For co-IP, cells transfected with plasmids for 48 h were harvested and lysed with IP-lysis buffer for 1 h. The supernatants were collected via centrifugation at 12,000 rpm for 20 min at 4°C. Then the supernatants were incubated with the magnetic beads with tag antibody, overnight at 4°C with rotation. Beads were collected and washed three times with washing buffer. Then, the beads were boiled at 100°C for 5 min in 5 × SDS protein loading buffer and analyzed by immunoblot mentioned above. The antibodies are shown in Table 3.

Table 3

The antibodies for immunoblot assays and immunofluorescence assays.
mouse monoclonal anti-GAPDH	Proteintech	Cat #60004-1-Ig
mouse monoclonal anti-HTNV NP	Prepared in our Lab (1A8)	N/A
rabbit polyclonal anti-RIPK1	Proteintech	Cat #17519-1-AP
rabbit monoclonal anti-p-RIPK1 (ser166)	Proteintech	Cat #28252-1-AP
rabbit polyclonal anti-RIPK3	Proteintech	Cat #17563-1-AP
rabbit monoclonal anti-p-RIPK3 (ser232)	Abcam	Cat #ab195117
rabbit monoclonal anti-MLKL	Abcam	Cat #ab184718
rabbit monoclonal anti-p-MLKL (ser345)	Abcam	Cat #ab196436
mouse monoclonal anti-IRF3	Proteintech	Cat #66670-1-Ig
rabbit monoclonal anti-p-IRF3 (ser386)	Cell Signaling Technology	Cat #37829S
rabbit monoclonal anti-JAK2	Absmart	Cat #T55287
rabbit monoclonal anti-p-JAK2 (Y1007, Y1008)	Absmart	Cat #TU390534
mouse monoclonal anti-STAT1	Proteintech	Cat #66545-1-Ig
rabbit monoclonal anti-p-STAT1 (Ser727)	Cell Signaling Technology	Cat #8826S
mouse monoclonal anti-Myc tag	Absmart	Cat #M20012
rabbit monoclonal anti-Flag tag	Proteintech	Cat #80010-1-RR
goat Anti-Rabbit 800CW	LI-COR	Cat #C70426-05
Goat Anti-Mouse 680RD	LI-COR	Cat #C70427-05
Goat Anti-Rabbit IgG, Cy3 Conjugated	ZhuangZhi Biotechnology	Cat #EK022
Goat Anti-Mouse IgG, Alexa Fluor 488	ZhuangZhi Biotechnology	Cat #EK011

Absolute Quantification of Viral Load

HTNV-S standard was obtained by pcDNA 3.1-HTNV-S plasmid through in vitro transcription system, and the copy number of HTNV-S was calculated according to the following formula: Copy number (Copies/µL) = ng×10^− 9×6.02×1023 ÷ base number ÷ 345. The gradient. After diluting the standard, the Cq value was determined by qRT-PCR, at the same time, the Cq value of HTNV-S in serums was obtained. The copy number of HTNV-S is calculated according to the standard curve and related formula above.

Histology Examination

Tissue samples (liver, lung and kidney) were preserved in 4% neutral buffered formalin for histopathological analysis. Tissues were then dehydrated, paraffin-embedded, and sectioned. The sectioned tissue slides were stained with H&E, and images were acquired using 3DHISTECH (Hungary), and analyzed by CaseViewer2.4. The tissue sections were observed in detail at different multiples, and the fundamental pathological changes in the sections, such as congestion, congestion, bleeding, edema, degeneration, necrosis, hyperplasia, fibrosis, mechanization, granulation tissue and inflammatory changes were marked.

immunohistochemistry (IHE) Assay and Immunofluorescence Assay

After the tissue was embedded, the slices were cut into slices with a thickness of 4 mm on the slicer. After antigen-repaired, the diluted serum (3% BSA) was used for sealing. Tissues were then incubated with monoclonal antibody against HTNV-NP, STAT1 and F4/80 overnight at 4℃. Then the samples were incubated with the secondary antibody, followed by DAPI staining at room temperature for 5–10 min and images were acquired using 3DHISTECH (Hungary), analyzed by CaseViewer2.4.

Cells were placed on small discs (24-well plates) and treated according to experiment purposes. Samples were washed two times with DPBS 5 min each time before fix with 4% paraformaldehye (Sangon biotech, China) for 15 min at room temperature, and then permeabilized samples with 0.5% triton x-100 (Sangon biotech, China) for 15 min. Using DPBS to rinse the discs two times. 3% BSA was used to incubate samples for 1 h at room temperature, and incubate sections with the primary antibody at appropriate dilution in 3% BSA overnight at 4°C. Fluorochrome-conjugated secondary antibody was used to bind with primary antibody (antibodies are shown in Table 3). The cellular nucleus was stained with DAPI (Sangon biotech, China), and all samples were examined under the laser scanning confocal microscope (FV3000, OLYMPUS).

Transmission Electron Microscopy Assay

Tissue samples (lungs) were sliced in 1×1×3 mm³ and soaked in glutaraldehyde fixation solution immediately, the volume of which should not be less than 40 times the tissue volume. The air should be removed using a syringe until the lung tissue is entirely below the fluid level. Treated tissues were block mounted and thinly sliced (Leica, China). The slices were firstly stained with uranyl acetate for 30 min, and rinsed 3–5 times with double-distilled water. The slices were secondly stained with lead citrate for 10 min. Sections were photographed using a Hitachi HT7700 transmission electron microscope (Hitachi, Japan), and the images were processed with Hitachi TEM system. The experiment came from on-campus technical support¹³.

Dual-Luciferase Assays

The plasmids used for Luciferase assays were as follows: pGL3 basic, IRES-Luc and STAT1-Luc were stored in our Lab; the reporter plasmids for IFN-Luc were purchased from miaolingbiology. HEK293T cells in 24-well plates were transfected with different Luciferase plasmids (100 ng), pRL-TK (10 ng), as well as other desired plasmids (400 ng) each well by hieff trans™ liposomal transfection reagent (Yeasen, China), and then stimulated with poly I:C (MedChenExpress, USA) or not. After lysing the cells, the Renilla and firefly Luciferase activities were measured using the dual-Luciferase assay system (Promega, USA).

Flow Cytometry for Annexin V-propidium iodide (PI) Staining

Cells were digested and collected in the centrifuge tube, and were washed with PBS twice and centrifuged at 1000 rpm at room temperature for 3 min each time. Treating cells follow the Annexin V-PI staining protocol (BD, USA). Add Annexin V (5 µl) and PI (5 µl) respectively and complete the volume to 1 mL with 1x binding buffer. Incubate at room temperature away from light for 15–20 min. The cells were detected by flow cytometry (FACSCanto II, BD, USA) as soon as possible (within 1 hour).

ATP Assay and Calcein/PI Cell Viability/Cytotoxicity Assay

The culture medium was removed and the cells were lysed by adding 50 µl lysate in each well of the 96-well plate. In order to lysis the cells adequately, a pipette can be used to repeatedly blow or shake the culture plate. Centrifugation at 12000 rpm at 4℃ for 5 min after lysis, the supernatant was taken for subsequent determination (ATP Assay Kit, beyotime).

For adherent cells, the culture medium was removed and the cells were washed with DPBS once. An appropriate volume of Calcein AM/PI working fluid was added (usually 50 µL to each well of the 96-well plate). After incubation at 37℃ for 30 min away from light, the staining effect was observed under a fluorescence microscope (Calcein AM was green fluorescence, Ex/Em = 494/517nm; PI is red fluorescence, Ex/Em = 535/617nm). Image J was used to calculate cell number, and all samples were counted at least three visual fields (Calcein/PI Cell Viability/Cytotoxicity Assay Kit, beyotime).

Enzyme-Linked Immunosorbent Assay (ELISA)

Reconstitute the standard substances of mouse IFNα or moues IFNβ offered from QuantiCyto® Mouse IFNα/β ELISA kit with deionized water and use the stock solution to produce a dilution series. Samples were collected from cell supernatants. (a) Add 100 µL of diluted standard or sample per well. (b) Incubate for 1.5 hours at 37℃ with fresh plate adhesive paper to seal the hole. (c) Wash five times and add 100 µL Mouse IFNα/β conjugate to each well and incubate for an hour at 37℃. (d) Add 100 µL of substrate solution to each well. Incubate for 30 minutes (protect from light). (e) Add 100 µL of stop solution to each well. Use a microplate reader set to 450 nm to determine the optical density of each well within 30 minutes.

Quantification and Statistical Analysis

Statistical analysis was performed by GraphPad Prism 9 software. Data were representative of three independent experiments and were expressed as the mean ± SEM in vitro and ± SD in vivo. Student's t-test or one-way analysis of variance (ANOVA) was used to compare the statistical differences between groups. *P < 0.05, **P < 0.01, ***P < 0.001.

HTNV infection promoted the expression of necroptosis-associated genes without triggering cell death.

Previous studies have demonstrated that programmed cell death (PCD), including apoptosis, necroptosis and pyroptosis, is a host defense against viral infection¹⁷. However, the relationship between cell death and HTNV, which causes a non-cytopathic effect (CPE), is still unclear. Interestingly, several death-associated pathways enriched according to Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis after RNA-sequencing both in HTNV and JEV infected cells (Fig. 1A). Heatmap showed that apoptosis and necroptosis-associated genes increased slightly post HTNV infection, while decreased after JEV infection (Fig. 1B). To confirm the expression level of cell death-associated genes post infection, we first collected RNA from primary macrophages after HTNV and JEV infection. qRT-PCR showed that RIPK3, a necroptosis-associate gene, presented an up-regulated trend and the expression of MLKL decreased after HTNV infection (Fig. 1C). We then investigated the dynamic expression of necroptosis-associated genes induced by HTNV infection. As shown in Fig. 1D, necroptosis-associated proteins (especially RIPK3) increased at the early stage of infection. Phosphorylated RIPK3 (Ser232) and phosphorylated MLKL (Ser345), the critical phosphorylation sites of necroptosis, did not change. Taken together, these results demonstrated that HTNV induced the expression of necroptosis-associated genes.

We then examined whether HTNV infection causes cell death. Obviously, ATP luminescence value showed no statistical difference after HTNV infection, and decreased at the early stage after JEV infection (Fig. 1E). The results of annexin V-PI staining showed that HTNV did not induce significant cell death in BMDMs. In contrast, the positive rate of annexin V-PI staining increased after JEV stimulation (Fig. 1F), which is considered to trigger cell death via activated RIPK3^15,18. We counted PI-positive cells under different conditions, and HTNV infection induced approximately 10% PI-positive cells with no significant difference compared to the uninfected group (Supplementary Fig. 1A). These observations indicated that HTNV infection could not trigger cell death and increased necroptosis-associated proteins might play noncanonical roles post-infection.

HTNV infection does not trigger cell death, and it is still unclear whether it can regulate death signaling. Flow cytometric assays showed that tumor necrosis factor α (TNF-α), smac mimetic and zVAD-fmk (TSZ) efficiently induced cell death in L929 cells compared with A549 cells (Supplementary Fig. 1B)¹⁹. The expression of MLKL and p-MLKL increased induced by TSZ (Fig. 1G). In addition, the ATP luminescence assay showed that HTNV infection could not repress the reduction in ATP content after TSZ stimulation for 6 h or 12 h (Fig. 1H). We then observed cell morphology under a microscope at 6 h after TSZ stimulation. HTNV could not prevent the cells from shrinking and becoming round (Fig. 1I). These results demonstrate that HTNV neither induced necroptosis nor antagonized cell death induced by TSZ.

RIPK3 regulated HTNV replication through JAK-STAT pathways.

To determine the functions of necroptosis-associated genes in virus infection, we first transfected primary macrophages with mouse Z-DNA Binding Protein 1 (ZBP1)/RIPK3/MLKL siRNA and we observed that silencing RIPK3 expression restricted nucleocapsid protein (NP) expression (Fig. 2A). Our previous results indicated that RIPK3 served as a regulatory protein for type I IFN signaling to promote JEV replication. We hypothesized that RIPK3 might assist in immune evasion post-HTNV infection. Consistent with our hypothesis, the level of HTNV decreased both at the RNA and protein levels in the RIPK3^−/− BMDM (Fig. 2B). After transfection by RIPK3-Flag (pretreated with necrosulfonamide, an inhibitor of MLKL), the expression of NP was significantly increased (Fig. 2C).

To definitively confirm the function of RIPK3 in HTNV-infected cells, we performed RNA sequencing using infected BMDMs (wild type (WT) and RIPK3^−/−, setting three replications) (Fig. 2D(i)). Based on the principal component analysis (PCA), the results showed the good fitness and predictive power of the model (Fig. 2D(ii)). In the volcano plot, differentially expressed genes (DEGs) were represented, of which, 133 were significantly downregulated (blue plots) and 636 were upregulated (orange plots), especially Mx1, Isg15 and Stat1(Fig. 2D(iii)). Furthermore, the IFN-associated PRRs signaling pathway and JAK-STAT pathway were enriched in KEGG analysis (Fig. 2E(i)). We found that the levels of STAT1 and STAT2 increased in the RIPK3^−/− BMDMs. Knocking out RIPK3 significantly enhanced the expression of multiple inflammatory cytokines and ISGs (Fig. 2E(ii)), especially MX1, MX2, ISG15, interferon-induced protein with tetratricopeptide repeats 1 (IFIT1, also known as IFN-stimulated gene 56/ISG56), IFIT2 and IFIT3, which have been reported to be effective anti-hantaviral effectors⁹.

IFN-associated production lags behind HTNV replication at the early infection stage, and IFN responses activate at the late stage¹³. Primarily, we examined the dynamic expression of NP and IFN-associated signaling pathways post-HTNV infection. After infection with HTNV (MOI = 1), the viral level (RNA and protein) in BMDMs peaked at 48 hpi, together with the expression of PRRs (TLR3/TLR4) and IFN-α, as well as the downstream ISGs. However, the expression of p-JAK2 (Y1007, Y1008) and p-STAT1 (Ser727) increased at 12 hpi but gradually decreased from 24 to 36 hpi (Supplementary Fig. 2A, B).

To clarify the mechanism of RIPK3 in targeting IFN signaling, we used several reporter plasmids containing Luciferase activity. Interestingly, overexpression of RIPK3 in HEK293T cells downregulated STAT1-Luc and IRES-Luc expression but not IFN-Luc (Fig. 2F). Consistently, we detected IFN-α/β secretion by ELISA, and there were no differences between the WT and RIPK3^−/− BMDMs after HTNV infection (Supplementary Fig. 3A). We then identified that HTNV-induced p-JAK2 (Y1007, Y1008) and p-STAT1 (Ser727) levels substantially increased in the RIPK3^−/− BMDMs (Fig. 2G). As expected, the expression of STAT1 and p-STAT1 (Ser727) decreased after overexpressing RIPK3 (Fig. 2H). Of note, ISGs such as MX1, IFIT1 and ISG15 increased at 24 hpi in the RIPK3^−/− BMDMs compared with those of the WT BMDMs (Fig. 2I), and ISGs were inhibited once RIPK3 was overexpressed (Fig. 2J). To determine whether RIPK3 regulates inflammation, we observed that the level of IL-6 increased while the expression of IL-10, an anti-inflammatory cytokine, reduced in the RIPK3^−/− BMDMs, indicating that macrophages tended to exhibit pro-inflammatory M1 polarization (Supplementary Fig. 3B).

RIPK3 hindered anti-hantaviral ISG expression by interacting with STAT1.

Though RIPK3 could promote HTNV replication targeting JAK-STAT pathways, ambiguity remains regarding the mechanism by which they conduct it. We hypothesized that increased RIPK3 protein might interact with STAT1 and further inhibit its phosphorylation. As expected, we found that RIPK3 colocalized with STAT1 post HTNV infection (Fig. 3A). Additionally, the proportion of STAT1 which has translocated into the nucleus decreased after RIPK3 was over-expressed, indicating that RIPK3 acted as an inhibitor of the JAK-STAT pathway (Fig. 3B). Therefore, we carried out co-IP assays to determine whether RIPK3 interacts with STAT1. As expected, RIPK3-Flag physically interacted with exogenous STAT1-Myc (Fig. 3C, D). To investigate the interaction sites between RIPK3 and STAT1, we chalked out a rough sketch of the structural domains of RIPK3 and STAT1 (Fig. 3E). Mouse RIPK3 has 486aa with a kinase domain from 22 to 292aa and an RHIM motif from 440 to 461aa. Mouse STAT1 contains 750aa with an Src homolog 2 (SH2) domain from 573 to 670aa. Amino acid residues in the RIPK3 (Lys432, Thr338, Thr248 and Ser326, etc.) dynamically associate through hydrogen bond with residues of STAT1 (Thr719, Gln621, Asn530 and Arg619 etc.) (Fig. 3F). Based on the predicted interaction sites, we speculated that the interaction of RIPK3 and STAT1 might cap the phosphorylation site of STAT1, which suppress its further activation. And this noncanonical role of RIPK3 might be independent of the kinase activity and RHIM motif of RIPK3.

RIPK3-deficient mice showed clinical symptoms.

To assess the immune response of the RIPK3^−/− mice to HTNV infection, we challenged RIPK3^−/− mice with HTNV through intravenous injections on the first day and administered a booster on day six (Fig. 4A). All animals were monitored daily for clinical symptoms, body weight changes and temperature. Mice were sacrificed to analyze various laboratory parameters, viral loads, and pathology. Compared to the WT mice, RIPK3^−/− mice showed clinical symptoms, such as ruffled fur and sluggish movement, as shown in the picture (Fig. 4B). The murine sepsis score (MSS) is used to assess the severity of sepsis in mice based on observational characteristics²⁰. The results showed that murine sepsis symptoms alleviated in the RIPK3^−/− mice (Fig. 4C). Additionally, the RIPK3^−/− mice showed a slowing of weight gain (Fig. 4D). Notably, the core temperature of the RIPK3^−/− mice indicated fever in the head, back and tail (Fig. 4E, supplementary Fig. 4A). Consistently, the body temperature of the RIPK3^−/− mice were generally higher, while no fever was recorded in the WT mice, especially from 7 days to 9 days after the booster (Fig. 4F). We then performed a hematology test using whole blood collected from the RIPK3^−/− and WT mice. The number of monocytes decreased in the RIPK3^−/− mice, and neutrophils and lymphocytes increased post-infection, which indicated that there exited inflammation response in RIPK3^−/− mice. The results showed that white blood cells (WBC) counts were higher in the RIPK3^−/− group than in the WT mice. As thrombocytopenia is a common clinical feature in viral hemorrhagic fever, notably, blood platelet (PLT) counts in the infected WT mice decreased (≈ 5X10^¹⁰/L) but recovered in the RIPK3^−/− mice (≈ 1.5X10^¹²/L) (Fig. 4G). We further collected serum to examine liver and kidney disorders. Compared with the WT mice, the serum levels of ALT, AST, and serum UA showed no elevation. These findings indicated that HTNV infection did not cause significant liver and kidney damage (Fig. 4H, supplementary Fig. 4B). All results mentioned above suggested that intravenous injections of HTNV into the RIPK3^−/− mice, to some degree, alleviated the main pathological features of HTNV, which was possibly due to the activation of a robust immune response.

RIPK3-deficient mice showed HTNV clearance and an activated inflammatory response.

To evaluate the viral load in mice, we extracted HTNV RNA from the mouse serum to determine viral replication in the blood (Fig. 5A). The results showed that the viral copy number in the RIPK3^−/− mice was lower than that in the WT mice (RIPK3^−/− mice: 683.7 ± 305.5 copies per µL; WT mice: 1613 ± 273.1 copies per µL). Consistently, the expression of viral antigen in the major organs (including the lung, spleen and kidney) was significantly suppressed in the RIPK3^−/− mice at protein levels (Fig. 5B).

Pathological changes in the HTNV-infected mice were evaluated by hematoxylin and eosin (H&E) staining and found to exist in the lungs of all infected RIPK3^−/− mice, manifested as granulocyte and macrophage infiltration in the alveolus. The clinical signs caused by HTNV mainly include kidney injury characterized by acute tubulointerstitial nephritis involving infiltration of inflammatory cells²¹. However, pathological manifestations of the liver and kidney were not apparent in the HTNV-challenged RIPK3^−/− mice (Fig. 5C). To further clarify macrophage infiltration into the lungs after HTNV infection, we performed IH staining with F4/80 (macrophages) and NP. The results showed that a group of immune cells positive for F4/80 infiltrated the alveolus after HTNV infection in the RIPK3^−/− mice (Fig. 5D). We speculated that the infiltration of various inflammatory cells might cause lung damage post-infection in the RIPK3^−/− mice. The red arrows in Fig. 5E showed the signs of emptying some lamellar bodies in alveolar type II cells. Importantly, increased macrophage infiltration and slight pulmonary fibrosis confirmed that RIPK3 could participate in the inflammatory response in vivo by regulating granulocyte and macrophage enrichment.

RIPK3-deficient mice increased the expression of ISGs by promoting the phosphorylation of STAT1.

To clarify the mechanism by which HTNV is cleared in the virus-challenged RIPK3^−/− mice, we detected the expression level of STAT1 in organs. Consistent with the results in vitro, total STAT1 and p-STAT1 (Ser727) increased both in the lung and spleen with statistical analysis (Fig. 6A). We further found that the proportion of STAT1-positive cells was significantly higher in the lungs of the RIPK3^−/− mice than in the lungs of the WT mice by IHE staining. Moreover, the proportion of STAT1 in the nucleus significantly increased in both NP-positive and NP-negative cells (Fig. 6B). We previously demonstrated that RIPK3 deficiency promoted HTNV clearance in BMDMs by inducing STAT1 phosphorylation and ISGs expression. However, whether these effects are macrophage-specific or universal in organs remains incompletely understood. To clarify this point, we collected RNA from the lung and spleen for qRT-PCR analysis. The results showed that HTNV infection significantly enhanced MX1, MX2, IFIT1 and ISG15 expression in the RIPK3^−/− mice but did not affect TLR3 or TLR4, the PRRs that can be triggered by HTNV in previous reports (Fig. 6C, supplementary Fig. 4C)²². These above results indicated that RIPK3-deficient mice showed distinctive roles in clearing HTNV and promoting inflammation by regulating STAT1 activation.

The natural reservoirs and sources of infection of Hantavirus are mainly rodents, such as Rattus norvegicus and Apodemus agrarius. Hantaviruses transmitted to humankind can cause two kinds of viral hemorrhagic diseases with prominent vascular permeability defects, namely, HFRS and hantavirus pulmonary syndrome (HPS). Early studies have shown that HTNV has a specific mechanism to escape the host IFN response and successfully replicate and spread^23,24. RIPK3 is a key molecule in regulating cell death, inflammasome formation and inflammatory damage^25,26. We previously reported that RIPK3 could inhibit the expression of IFI44L to evade the cellular innate immune response, leading to the propagation of JEV in Neuro2a¹⁵. Based on our results that the expression of RIPK3 was upregulated post-infection (Fig. 1C, D), three main questions exist during the process of HTNV infection (1) What is the upstream regulatory mechanism that promotes RIPK3 expression? (2) Does HTNV infection trigger RIPK3-mediated cell death? (3) Does RIPK3 have a noncanonical function in regulating HTNV infection? Determining the answers to these questions is critical to reveal the mystery of the innate immune response against HTNV propagation and is of vital importance for developing efficient strategies for disease therapy. In the current study, we observed novel roles of RIPK3 in the regulation of IFN signaling pathways. Knockdown of RIPK3 in BMDMs led to increased antiviral ISGs production and decreased HTNV loads, and RIPK3^–/– mice were more resistant to HTNV infection, showing a higher body temperature and lower viral titers in tissues. Mechanistically, we observed that the interaction between RIPK3 and STAT1 was required for pro-infection. Thus, we speculated that the induced expression of RIPK3 in virus-infected macrophages might be a viral strategy to evade cellular innate immune clearance (Fig. 7).

In the innate immune IFN system, PRRs such as TLRs and RLRs can recognize exogenous signals (mainly PAMPs). IFN-associated transcription factors are activated through the TLR-TRIF-TBK1 pathway and RIG-I-MAVS-TBK1 pathway²⁷. Activated TBK1 then recruits and phosphorylates IRF3/IRF7 to form homodimers. The homodimers then translocate to the nucleus and initiate IFN transcription. TLR3 was reported to initiate necroptosis indirectly by TNF activation or directly by TRIF-RIPK3-MLKL axis²⁸. We suspected that HTNV-induced IFN downstream from TLR3 activation promoted RIPK3 expression, which assisted in the negative regulation of IFN-mediated antiviral immunity. Whether TLRs or other PRRs are associated with the expression of RIPK3 needs further investigation.

It has shown that RIPK3-MLKL-mediated necroptosis has antiviral functions in BMDMs during multiple viral infections by destroying viral reservoirs^29–32. Crimean-Congo hemorrhagic fever virus (CCHFV) is a member of the Nairovirus genus of the family Bunyaviridae³³. The NP of CCHFV could trigger apoptosis depending on caspase-3 activation at late stages post-infection in SW-13 cells³⁴. However, there is no evidence suggesting that hantavirus infection directly causes apparent cell death or morphological alterations either in vivo or in vitro. Here, we showed that HTNV-infected BMDMs did not show notable cell death, which is also in line with current theories that monocytes and macrophages act as viral reservoirs to facilitate hantaviral propagation³⁵. Additionally, TSZ-stimulated cell death could not be resisted by HTNV infection in L929 cells. TSZ-stimulated cell death depends on the binding of TNF-α to the TNF receptor (TNFR) in the absence of cIAP1/2 combined with caspase inhibition. Then, the downstream signal triggers the formation of the necrosome complex, composed of RIPK1 and RIPK3³⁶. Cell death can also be triggered by bacteria and viruses through recognition of the nucleic acids of viruses, LPS, lipoprotein or other PAMPs by PRRs (TLRs and NLRs), resulting in a complicated regulated network among programmed cell deaths³⁷. There still needs further exploration into the mechanism of how HTNV infection antagonizes cell death.

ISGs are the cellular factors induced by the IFN-mediated innate immune response to resist and control pathogens. ISG products have diverse roles, including antiviral effectors and negative or positive regulators of IFN signaling⁶. Additionally, RIPK3 has been reported to regulate type I IFN production in IAV-infected BMDMs via interaction with RIG-I/MAVS and protein kinase R (PKR) activation, a critical regulator of IFN-β mRNA stability³⁸. We found that RIPK3 regulated the expression of MX1, MX2, IFIT1 and ISG15. Mx, induced by type I IFN, is one of the ISGs produced by host cells and has a wide range of antiviral effects and GTPase activity. In vitro and in vivo experiments have shown that Mx genes can be transcribed and translated only in the presence of type I IFN, double-stranded RNA or viral infection, thus resisting pathogen invasion. The main mechanism of resistance is the hydrolysis of the viral nucleocapsid by its GTPase activity to restrict virus replication^39,40. IFIT1 is a member of the IFIT family, which can recognize several types of RNAs, including 5′-triphosphate RNA and 5′ capped 2′-O unmethylated mRNA⁴¹. Previous studies found that IFIT1 could inhibit JEV replication by binding to 5′ apped 2′-O unmethylated RNA⁴², and positive regulated IFN production to regulate Alphavirus genome translation⁴³. We detected the expression of IFIT1 by qRT-PCR, which was higher than that in the WT-infected group. However, research has shown that IFIT1 cannot inhibit negative-sense RNA virus replication and pathogenesis both in vitro and in vivo, including those of the Orthomyxoviridae, Bunyaviridae, and Filoviridae amilies⁴⁴. Its role in restricting Hantavirus infection remains unclear. ISG15 plays an antiviral role by covalently binding to viral and cellular target proteins, inhibiting virion release or regulating virus latency. Furthermore, the ISG15 monomer can promote the proliferation of natural killer (NK) cells and dendritic cells (DCs) as well as enhance the chemotactic activity of neutrophils⁴⁵. ISG15 has been found to inhibit the replication of a variety of viruses, such as influenza virus (IV), Newcastle disease virus (DNV), JEV, VSV, Sindbis virus (SV), Ebolavirus like-particles (VLPs) and Dengue virus (DENV)^46–52. In addition to the ISGs mentioned above, OAS1, IFIT2 and IFIT3 were increased through IRF3 translocation to activate an IFN response post-HTNV infection⁹. Some limitations of this study are the incomplete molecular detection of antiviral ISGs. We found that multiple ISGs were upregulated in RIPK3 knockout BMDMs and might defend against HTNV synergistically.

Phosphorylated STAT forms homo- or heterodimers and translocation to the nucleus is the key to initiating the transcription of ISGs. Secreted-IFNs bind to receptors on neighboring cells and trigger the JAK-STAT pathway. There are seven STAT proteins in mammals (STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6), and canonical type I IFN signaling occurs through the phosphorylation of STAT1 and STAT2. The results showed that the expression of antiviral ISGs was correlated with JAK-STAT pathways and that RIPK3 could connect and suppress STAT1 translocation⁵³. STAT1 contains an SH2 domain, which recruits STAT1 to tyrosine-phosphorylated receptors and is also required for STAT1 to form dimers⁵⁴. At the C-terminus, phosphorylation at position tyrosine 701 in the TAD region plays a vital role in STAT1 homodimer formation, nuclear translocation, and DNA binding. Furthermore, phosphorylation at position serine 727 within the TAD region has a role in the transcriptional regulatory activity of STAT1⁵⁵. We need to determine the detailed roles of RIPK3 in STAT1 kinase activity and reveal their specific interaction location. As a classical serine/threonine receptor-interacting protein kinase, the phosphorylation of Thr231 and Ser232 of RIPK3 was induced by TNF stimulation, which is required for RIPK3 to interact with MLKL⁵⁶. It is unclear whether the function in regulating STAT1 of RIPK3 is kinase activity-dependent, and the underlying mechanism requires further investigation.

In conclusion, our study confirmed that RIPK3 could directly interact with STAT1 and regulate its phosphorylation at Ser727, which affected ISGs expression, inflammation response and further regulated HTNV clearance. Given that JAK/STAT/ISGs signaling has an essential role in anti-HTNV immunity, RIPK3 may have therapeutic potential for the prevention and treatment of human diseases caused by HTNV.

Supplementary information

Funding Statement

This work was supported in whole or in part by the National Natural Science Foundation of China (82172272, 31970148 and 82222367), and the Key Research and Development Program of Shaanxi (2021ZDLSF01-05 and 2021ZDLSF01-02).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability

All data related to this paper may be requested from the authors.

Park, K. et al. A novel genotype of Hantaan orthohantavirus harbored by Apodemus agrarius chejuensis as a potential etiologic agent of hemorrhagic fever with renal syndrome in Republic of Korea. PLoS neglected tropical diseases 15, e0009400, doi:10.1371/journal.pntd.0009400 (2021).
Kariwa, H., Yoshimatsu, K. & Arikawa, J. Hantavirus infection in East Asia. Comparative immunology, microbiology and infectious diseases 30, 341-356, doi:10.1016/j.cimid.2007.05.011 (2007).
Jiang, H., Du, H., Wang, L. M., Wang, P. Z. & Bai, X. F. Hemorrhagic Fever with Renal Syndrome: Pathogenesis and Clinical Picture. Frontiers in cellular and infection microbiology 6, 1, doi:10.3389/fcimb.2016.00001 (2016).
Tariq, M. & Kim, D. M. Hemorrhagic Fever with Renal Syndrome: Literature Review, Epidemiology, Clinical Picture and Pathogenesis. Infection & chemotherapy 54, 1-19, doi:10.3947/ic.2021.0148 (2022).
Lee, A. J. & Ashkar, A. A. The Dual Nature of Type I and Type II Interferons. Frontiers in immunology 9, 2061, doi:10.3389/fimmu.2018.02061 (2018).
Schneider, W. M., Chevillotte, M. D. & Rice, C. M. Interferon-stimulated genes: a complex web of host defenses. Annual review of immunology 32, 513-545, doi:10.1146/annurev-immunol-032713-120231 (2014).
Villarino, A. V., Kanno, Y. & O'Shea, J. J. Mechanisms and consequences of Jak-STAT signaling in the immune system. Nature immunology 18, 374-384, doi:10.1038/ni.3691 (2017).
Mesev, E. V., LeDesma, R. A. & Ploss, A. Decoding type I and III interferon signalling during viral infection. Nature microbiology 4, 914-924, doi:10.1038/s41564-019-0421-x (2019).
Ye, W. et al. Hantaan virus can infect human keratinocytes and activate an interferon response through the nuclear translocation of IRF-3. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases 29, 146-155, doi:10.1016/j.meegid.2014.11.009 (2015).
Jiang, H. et al. Hantaan virus induces toll-like receptor 4 expression, leading to enhanced production of beta interferon, interleukin-6 and tumor necrosis factor-alpha. Virology 380, 52-59, doi:10.1016/j.virol.2008.07.002 (2008).
Satarker, S. et al. JAK-STAT Pathway Inhibition and their Implications in COVID-19 Therapy. Postgraduate medicine 133, 489-507, doi:10.1080/00325481.2020.1855921 (2021).
Matthys, V. & Mackow, E. R. Hantavirus regulation of type I interferon responses. Advances in virology 2012, 524024, doi:10.1155/2012/524024 (2012).
Wang, K. et al. The Glycoprotein and Nucleocapsid Protein of Hantaviruses Manipulate Autophagy Flux to Restrain Host Innate Immune Responses. Cell reports 27, 2075-2091.e2075, doi:10.1016/j.celrep.2019.04.061 (2019).
Saleh, D. et al. Kinase Activities of RIPK1 and RIPK3 Can Direct IFN-β Synthesis Induced by Lipopolysaccharide. Journal of immunology (Baltimore, Md. : 1950) 198, 4435-4447, doi:10.4049/jimmunol.1601717 (2017).
Bian, P. et al. RIPK3 Promotes JEV Replication in Neurons via Downregulation of IFI44L. Frontiers in microbiology 11, 368, doi:10.3389/fmicb.2020.00368 (2020).
Heap, R. E. et al. Proteomics characterisation of the L929 cell supernatant and its role in BMDM differentiation. Life science alliance 4, doi:10.26508/lsa.202000957 (2021).
Nguyen, L. N. & Kanneganti, T. D. PANoptosis in Viral Infection: The Missing Puzzle Piece in the Cell Death Field. Journal of molecular biology 434, 167249, doi:10.1016/j.jmb.2021.167249 (2022).
Yiang, G. T. et al. The NS3 protease and helicase domains of Japanese encephalitis virus trigger cell death via caspase‑dependent and ‑independent pathways. Molecular medicine reports 7, 826-830, doi:10.3892/mmr.2013.1261 (2013).
Zhan, Q. et al. CAMK2/CaMKII activates MLKL in short-term starvation to facilitate autophagic flux. Autophagy 18, 726-744, doi:10.1080/15548627.2021.1954348 (2022).
Sulzbacher, M. M. et al. Adapted Murine Sepsis Score: Improving the Research in Experimental Sepsis Mouse Model. BioMed research international 2022, 5700853, doi:10.1155/2022/5700853 (2022).
Ma, R. et al. Nlrc3 Knockout Mice Showed Renal Pathological Changes After HTNV Infection. Frontiers in immunology 12, 692509, doi:10.3389/fimmu.2021.692509 (2021).
Handke, W., Oelschlegel, R., Franke, R., Krüger, D. H. & Rang, A. Hantaan virus triggers TLR3-dependent innate immune responses. Journal of immunology (Baltimore, Md. : 1950) 182, 2849-2858, doi:10.4049/jimmunol.0802893 (2009).
Ma, H. et al. The Long Noncoding RNA NEAT1 Exerts Antihantaviral Effects by Acting as Positive Feedback for RIG-I Signaling. Journal of virology 91, doi:10.1128/jvi.02250-16 (2017).
Ma, H. W. et al. In-Cell Western Assays to Evaluate Hantaan Virus Replication as a Novel Approach to Screen Antiviral Molecules and Detect Neutralizing Antibody Titers. Frontiers in cellular and infection microbiology 7, 269, doi:10.3389/fcimb.2017.00269 (2017).
Yin, H. et al. Taurine inhibits necroptosis helps to alleviate inflammatory and injury induced by Klebsiella infection. Veterinary immunology and immunopathology 250, 110444, doi:10.1016/j.vetimm.2022.110444 (2022).
Christgen, S., Tweedell, R. E. & Kanneganti, T. D. Programming inflammatory cell death for therapy. Pharmacology & therapeutics 232, 108010, doi:10.1016/j.pharmthera.2021.108010 (2022).
Tartey, S. & Takeuchi, O. Pathogen recognition and Toll-like receptor targeted therapeutics in innate immune cells. International reviews of immunology 36, 57-73, doi:10.1080/08830185.2016.1261318 (2017).
Kaiser, W. J. et al. Toll-like receptor 3-mediated necrosis via TRIF, RIP3, and MLKL. The Journal of biological chemistry 288, 31268-31279, doi:10.1074/jbc.M113.462341 (2013).
Zheng, M. et al. Impaired NLRP3 inflammasome activation/pyroptosis leads to robust inflammatory cell death via caspase-8/RIPK3 during coronavirus infection. The Journal of biological chemistry 295, 14040-14052, doi:10.1074/jbc.RA120.015036 (2020).
Gaba, A. et al. The NS1 Protein of Influenza A Virus Participates in Necroptosis by Interacting with MLKL and Increasing Its Oligomerization and Membrane Translocation. Journal of virology 93, doi:10.1128/jvi.01835-18 (2019).
Bedient, L. et al. Lytic Cell Death Mechanisms in Human Respiratory Syncytial Virus-Infected Macrophages: Roles of Pyroptosis and Necroptosis. Viruses 12, doi:10.3390/v12090932 (2020).
Pasparakis, M. & Vandenabeele, P. Necroptosis and its role in inflammation. Nature 517, 311-320, doi:10.1038/nature14191 (2015).
Schnittler, H. J. & Feldmann, H. Viral hemorrhagic fever--a vascular disease? Thrombosis and haemostasis 89, 967-972 (2003).
Karlberg, H., Tan, Y. J. & Mirazimi, A. Induction of caspase activation and cleavage of the viral nucleocapsid protein in different cell types during Crimean-Congo hemorrhagic fever virus infection. The Journal of biological chemistry 286, 3227-3234, doi:10.1074/jbc.M110.149369 (2011).
Scholz, S. et al. Human hantavirus infection elicits pronounced redistribution of mononuclear phagocytes in peripheral blood and airways. PLoS pathogens 13, e1006462, doi:10.1371/journal.ppat.1006462 (2017).
Hussain, M., Zimmermann, V., van Wijk, S. J. L. & Fulda, S. Mouse lung fibroblasts are highly susceptible to necroptosis in a reactive oxygen species-dependent manner. Biochemical pharmacology 153, 242-247, doi:10.1016/j.bcp.2018.01.025 (2018).
Martinon, F., Gaide, O., Pétrilli, V., Mayor, A. & Tschopp, J. NALP inflammasomes: a central role in innate immunity. Seminars in immunopathology 29, 213-229, doi:10.1007/s00281-007-0079-y (2007).
Downey, J. et al. RIPK3 interacts with MAVS to regulate type I IFN-mediated immunity to Influenza A virus infection. PLoS pathogens 13, e1006326, doi:10.1371/journal.ppat.1006326 (2017).
Haller, O., Kochs, G. & Weber, F. Interferon, Mx, and viral countermeasures. Cytokine & growth factor reviews 18, 425-433, doi:10.1016/j.cytogfr.2007.06.001 (2007).
Fuchs, J. et al. Evolution and Antiviral Specificities of Interferon-Induced Mx Proteins of Bats against Ebola, Influenza, and Other RNA Viruses. Journal of virology 91, doi:10.1128/jvi.00361-17 (2017).
Daffis, S. et al. 2'-O methylation of the viral mRNA cap evades host restriction by IFIT family members. Nature 468, 452-456, doi:10.1038/nature09489 (2010).
Kimura, T. et al. Ifit1 inhibits Japanese encephalitis virus replication through binding to 5' capped 2'-O unmethylated RNA. Journal of virology 87, 9997-10003, doi:10.1128/jvi.00883-13 (2013).
Reynaud, J. M. et al. IFIT1 Differentially Interferes with Translation and Replication of Alphavirus Genomes and Promotes Induction of Type I Interferon. PLoS pathogens 11, e1004863, doi:10.1371/journal.ppat.1004863 (2015).
Pinto, A. K. et al. Human and Murine IFIT1 Proteins Do Not Restrict Infection of Negative-Sense RNA Viruses of the Orthomyxoviridae, Bunyaviridae, and Filoviridae Families. Journal of virology 89, 9465-9476, doi:10.1128/jvi.00996-15 (2015).
Perng, Y. C. & Lenschow, D. J. ISG15 in antiviral immunity and beyond. Nature reviews. Microbiology 16, 423-439, doi:10.1038/s41579-018-0020-5 (2018).
Hsiang, T. Y., Zhao, C. & Krug, R. M. Interferon-induced ISG15 conjugation inhibits influenza A virus gene expression and replication in human cells. Journal of virology 83, 5971-5977, doi:10.1128/jvi.01667-08 (2009).
Orinska, Z. et al. TLR3-induced activation of mast cells modulates CD8+ T-cell recruitment. Blood 106, 978-987, doi:10.1182/blood-2004-07-2656 (2005).
Hsiao, N. W. et al. ISG15 over-expression inhibits replication of the Japanese encephalitis virus in human medulloblastoma cells. Antiviral research 85, 504-511, doi:10.1016/j.antiviral.2009.12.007 (2010).
Wu, J. et al. PM(2.5) promotes replication of VSV by ubiquitination degradation of phospho-IRF3 in A549 cells. Toxicology in vitro : an international journal published in association with BIBRA 62, 104698, doi:10.1016/j.tiv.2019.104698 (2020).
Giannakopoulos, N. V. et al. ISG15 Arg151 and the ISG15-conjugating enzyme UbE1L are important for innate immune control of Sindbis virus. Journal of virology 83, 1602-1610, doi:10.1128/jvi.01590-08 (2009).
Malakhova, O. A. & Zhang, D. E. ISG15 inhibits Nedd4 ubiquitin E3 activity and enhances the innate antiviral response. The Journal of biological chemistry 283, 8783-8787, doi:10.1074/jbc.C800030200 (2008).
Dai, J., Pan, W. & Wang, P. ISG15 facilitates cellular antiviral response to dengue and west nile virus infection in vitro. Virology journal 8, 468, doi:10.1186/1743-422x-8-468 (2011).
Owen, K. L., Brockwell, N. K. & Parker, B. S. JAK-STAT Signaling: A Double-Edged Sword of Immune Regulation and Cancer Progression. Cancers 11, doi:10.3390/cancers11122002 (2019).
Göder, A. et al. STAT1 N-terminal domain discriminatively controls type I and type II IFN signaling. Cytokine 144, 155552, doi:10.1016/j.cyto.2021.155552 (2021).
Parrini, M. et al. The C-Terminal Transactivation Domain of STAT1 Has a Gene-Specific Role in Transactivation and Cofactor Recruitment. Frontiers in immunology 9, 2879, doi:10.3389/fimmu.2018.02879 (2018).
Chen, W. et al. Diverse sequence determinants control human and mouse receptor interacting protein 3 (RIP3) and mixed lineage kinase domain-like (MLKL) interaction in necroptotic signaling. The Journal of biological chemistry 288, 16247-16261, doi:10.1074/jbc.M112.435545 (2013).

(Not answered)

SupplementaryFig.1.jpg
Supplementary Fig. 1 (A) BMDMs were infected with HTNV or JEV in the 96-well plate (MOI=1), and cell death was detected by double fluorescence staining based on Calcein AM (green) and PI (red). The living cells were showed green fluorescence, and PI staining dead cells, which were showed red fluorescence. The histogram counted the proportion of dead cells post infection. (B) A549 or L929 cells were stimulated with TSZ (T: TNF, 10 ng/ml; S: SM-164, 100 nM; Z: zVAD-fmk, 20 μM). Then the cells were stained by Annexin V and PI by flow cytometry. The X and Y axes represent Annexin V and PI, respectively. Bars are means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; ns is short for no significance.
SupplementaryFig.2.jpg
Supplementary Fig. 2 BMDMs were infected with HTNV (MOI=1), and the cell lysates were then collected to analyze viral NP levels and JAK-STAT pathways indicators using immunoblot (A). Viral RNA levels and IFN-associated genes were detected by qRT–PCR (B). Bars are means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; ns is short for no significance.
SupplementaryFig.3.jpg
Supplementary Fig. 3 (A) WT/RIPK3^-/-BMDMs were infected with HTNV (MOI=1), and the medium supernatants were collected to detect IFN-α/β concentration by ELISA (B) WT/RIPK3^-/-BMDMs were infected with HTNV (MOI=1), and the cell lysates were then collected to analyze IL-6 and IL-10 by qRT–PCR. Bars are means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; ns is short for no significance.
SupplementaryFig.4.jpg
Supplementary Fig. 4 (A) The core temperature of the head (i), back (ii) and tail (iii) were recorded from 7~9 days after virus challenge. Monitor the temperature change for 10 minutes each day. (B) Shown other serological indicators used by biochemical tests. (C) RNA collected from the liver (i) and kidney (ii) samples of WT and RIPK3^-/- mice after viral challenge. Samples were collected 9 dpi to detect the level of TLRs by qRT–PCR. Bars are means ± SD. *p < 0.05; **p < 0.01; ***p < 0.001; ns is short for no significance.

Download PDF

Version 1

posted

You are reading this latest preprint version

RIPK3 Promotes Hantaviral Replication by Restricting JAK-STAT Signaling but not Triggering Necroptosis.

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Plasmids and transfection

Cell Culture and Viral Infection

Mouse Experiments and Preparation of Samples

RNA Extraction and Quantitative real-time PCR (qRT-PCR) Analysis

Immunoblot Assays and co-immunoprecipitation (co-IP)

Absolute Quantification of Viral Load

Histology Examination

immunohistochemistry (IHE) Assay and Immunofluorescence Assay

Transmission Electron Microscopy Assay

Dual-Luciferase Assays

Flow Cytometry for Annexin V-propidium iodide (PI) Staining

ATP Assay and Calcein/PI Cell Viability/Cytotoxicity Assay

Enzyme-Linked Immunosorbent Assay (ELISA)

Quantification and Statistical Analysis

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1