Adenosine A2a receptor mediate anti-inflammation and collagen protection via cAMP/CREB/NFκB pathway in nucleus pulposus cells

doi:10.21203/rs.3.rs-2253450/v1

Download PDF

Research Article

Adenosine A2a receptor mediate anti-inflammation and collagen protection via cAMP/CREB/NFκB pathway in nucleus pulposus cells

https://doi.org/10.21203/rs.3.rs-2253450/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose of the study:

Clinical and animal studies had indicated that both inflammation and extracellular matrix metabolism took part in intervertebral disk degeneration. In this study, we investigated the role of adenosine A2a receptor (A2aR) in intervertebral disk and intend to clarify its mechanism.

Materials and methods

Rat nucleus pulposus (NP) cells were cultured in complete medium, when cells proliferated to the third passage, cells were divided into different groups. Sterile PBS treated for control group, 10ng/ml IL-1β treated NP cells as experimental group, 10ng/ml IL-1β and 10µmol CGS-21680 were added into NP cells, NC siRNA, PKA siRNA and NFκB siRNA stimulated NP cells 24 hours respectively then treated with IL-1β and CGS-21680. Cell proliferation and inflammatory cytokines, collagen, A2aR and their signaling molecules were evaluated.

Results

IL-1β induced inflammatory cytokine (IL-6 and TNF-α) released and collagen degrading protease (MMP3) overexpression, and A2aR was decreased in NP cells. Protein expression of cAMP, PKA and CREB were decreased, but NFκB was increased. These changes could be reversed by A2aR agonist (CGS-21680). Inflammatory cytokine, MMP3 and NFκB were upregulated in NP cells treated by PKA siRNA, but collagen II was downregulated. Inflammatory cytokine and MMP3 were downregulated in NFκB siRNA treated NP cells, while the expression of collagen II increased.

Conclusion

Our study hinted that IL-1β induced inflammation and collagen degradation through A2aR, A2aR was a protective receptor. CGS-21680 as the A2aR agonist could alleviate the damage caused by IL-1β. A2aR regulated inflammation and collagen via cAMP-CREB-NFκB axis pathway in NP cells.

adenosine A2a receptors

nucleus pulposus cells

cAMP

CREB

NFκB

Low back pain (LBP) was a common clinical symptom and multifactorial debilitating disease around the world, leading to activity limitation, disability and socio-economic burden¹. About 50–85% of the population was suffered by back pain in some period in their whole life ². Intervertebral disk degeneration (IVDD) was one of the major reasons contributed to LBP. However, as a progressive and irreversible process, the mechanism of IVDD was still not clarified. Intervertebral disks were composed with three different tissues: the annulus fibrosus (AF), nucleus pulposus (NP) and endplates (EP). NP was surrounded by AF in the anterior, posterior, left and right orientations. EP was attached on the superior and inferior of NP³. NP was composed of nucleus pulposus cells and extracellular matrix (ECM) components, played a key role in the function of intervertebral disk (IVD)⁴.

Adenosine acted as a potent endogenous mediator of anti-inflammatory in some tissues and cells⁵. Adenosine receptors (ARs) belonged to superfamily of G-protein-coupled receptors, and interactions with the four ARs, A1, A2a, A2b and A3 had been validated to mediate various physiological functions of adenosine⁶. In recent years, extensive progress had been made to elucidate the function of adenosine and ARs in pain regulation⁷. Recent studies had pointed out the important role of adenosine in the process of inflammation in rheumatoid arthritis⁸. Adenosine produces anti-inflammatory action through the A2aR and A3aR, which were found in excess within the inflammatory tissue and lymphocytes of rheumatoid arthritis patients⁹. A2aRs were Gs-coupled receptors, and their activation could promote the formation of cyclic adenosine monophosphate (cAMP), cAMP was a very important second messenger in cells that can activate cAMP-dependent protein kinase A (PKA), which can phosphorylate cAMP response element protein (CREB) and then regulated the expression of target genes¹⁰. The knowledge of cAMP/PKA and NFkB signaling pathways were important to understand the anti-inflammatory targets in diseases ¹¹.

To our knowledge, the potential role of adenosine and ARs in IVDD has not been known. The aim of this study is to study the effect of A2aR and its regulating pathway in NP cells.

2.1 Cell culture and treatment

Rat nucleus pulposus cells (CP-R145, Procell Life Science & Technology, China) were cultured in complete medium (CM-R145, Procell Life Science & Technology, China) supplemented with basal medium, 15% fetal bovine serum, 1% P/S Solution, and nucleus pulposus cell growth supplement, in a humidified atmosphere of 5% CO₂ at 37℃. Cells from the third passage were used in downstream experiments.

The cells were treated with IL-1β (400-01B, PeproTech, USA) 10ng/ml, and co-cultured with CGS-21680 (HY-13201A, MedChemExpress, USA) 0.1, 1, 10μmol respectively, in order to choose the most appropriate concentration of CGS-21680 stimulation, and cultured for 24 h.

2.2 Cell transfection

PKA siRNA, NFκB siRNA, and corresponding negative controls (NC) were synthesized by RiboBio (Guangzhou, China). For transfection, Lipofectamine 2000 (Invitrogen, USA) was used to transfect cells as the manufacturer’s instructions. NC siRNA, PKA siRNA and NFκB siRNA were transfected for 24h, 48h and 72h respectively, to choose the most effective time.

2.3 Cell proliferation

The cells were seeded at a density of 5×10³cells in a 96-well plate, NC siRNA, PKA siRNA and NFκB siRNA were transfected for 24h respectively. Then cells were co-cultured with IL-1β and CGS-21680, and quantify the cell proliferation after 24h. The water-soluble tetrazolium (WST)-8 assay using a sulfonated tetrazolium salt (Cell Counting Kit-8, Biosharp, China) was performed as recommended in the manufacturer’s instructions. The absorbance was recorded at 450 nm.

2.4 Enzyme-Linked Immunosorbent Assay

Cells were seeded at a density of 1×10⁶in a 6-well plate, treated with siRNA or NC for 24h. Changed the culture medium and treated with IL-1β or co-cultured with CGS-21680 for 24 h. Collecting supernatant and centrifuged at 3,000g, after that drawn up supernatant into some tubes by pipette for future ELISA examinations. We detected the concentration of cAMP (ELK8207, ELK Biotechnology, China), IL-6 (ELK1158, ELK Biotechnology, China) and TNF-α (ELK1396, ELK Biotechnology, China) in supernatant with the ELISA kit following the manufacturer’s instructions. The absorbance was recorded at 450 nm.

2.5 Quantitative real-time RT -PCR

Cells were seeded at a density of 1×10⁶in a 6-well plate, treated with siRNA or NC for 24h. Changed the culture medium and treated with IL-1β or co-cultured with CGS-21680 for 24 h. Collecting supernatant for ELISA then washed cells by sterile PBS. Total RNA was extracted from cells with the RNeasy Mini Kit (EP014-50T, ELK Biotechnology, China), following the manufacturer’s instructions. PrimeScript RT Master Mix Perfect Real Time (Takara, RR037A, Kusatsu, Japan) was used for reverse transcription and cDNA synthesis. Expression of various cytokines were detected by QuantiFast SYBR Green PCR Kit (Qiagen, 204057, Hilden, Germany) and Bio-Rad CFX96 (Bio-Rad, C1000, Hercules, CA, United States), following the manufacturer’s instructions. Computation of fold changes in the messenger RNA (mRNA) levels from CT values was done using 2^−ΔΔCTmethods. GAPDH mRNA levels were used as an internal reference standard. Primer sequences are provided in Table 1.

2.6 Western blotting

Cells were seeded at a density of 1×10⁶in a 6-well plate, treated with siRNA or NC for 24h. Changed the culture medium and treated with IL-1β or co-cultured with CGS-21680 for 24 h. Collecting supernatant and washed cells by sterile PBS. Cells were lysed for 5 min using cold RIPA buffer, samples were then centrifuged at 12,000 rpm for 10 min at 4℃, protein concentrations in supernatants were determined through bicin choninic acid (BCA) method. Equal protein amounts were then separated on 10% SDS-PAGE gels and transferred to PVDF membranes (Millipore, Billerica, MA, USA). Blots were blocked using 5% non-fat milk in TBST and then probed using anti-CREB (1:500, 12208-1-AP, Proteintech, China), anti-NFκB (1:500, GTX102090, GeneTex, China), anti-PKA (ab32390, Abcam, UK), anti-A2aR (1:500, 51092-1-AP, Proteintech, China), anti-MMP3 (1:500, 66338-1-lg, Proteintech, China), anti-IL-6 (1:500, GTX110527, GeneTex, China) and anti-β-actin (1:1000, ANT010, Antgene, China) overnight at 4℃. Blots were then washed and probed using secondary antibody (Goat‐anti‐rabbit, Goat‐anti‐mouse, KPL, Milford, MA, USA), and colouration, immunoreactive bands were obtained. Then the images were captured and semi-quantitatively analyzed by the ChemiDoc XRS+ System (Bio-Rad, Hercules, CA, United States). All samples were assessed at least three times.

2.7 Immunofluorescence staining

Cells were seeded in a 12-well plate with the slides of cells and treated with siRNA or NC for 24h. Changed the culture medium and treated with IL-1β or co-cultured with CGS-21680 for 24 h. After the supernatant was discarded, the cell were fixed with paraformaldehyde, then treated with Triton X-100, and blocked with serum. After incubation with the first antibody A2aR (1:200, 51092-1-AP, Proteintech, China) and collagen II (1:200, 28459-1-AP, Proteintech, China), then the second antibody, the cells were then treated with DAPI and observed using a fluorescence microscope.

Analysis Data were shown as the mean ± SD. All data were evaluated for normal distribution using the Shapiro–Wilk test. A nonparametric test was used to analyze non-normal distribution of the data. One-way ANOVA, Tukey’s post hoc test, or Games– Howell test was performed to test for differences among the means of various groups. P < 0.05 was considered as statistically significant (SPSS Statistics 21.0).

4.1 Proliferation of nucleus pulposus cultured with IL-1β and CGS-21680 in vitro

In vitro, NP cells were stimulated by 10ng/ml IL-1β, co-cultured with 0.1, 1, 10µmol CGS-21680 respectively. The results showed that co-cultured with 10µmol CGS-21680, cell proliferationin increased compared to IL-1β treated (Fig. 1A). Therefore NP cells were stimulated with 10µmol CGS-21680. Before IL-1β treated, NC siRNA, PKA siRNA and NFκB siRNA were transfected into NP cells for 24h, 48h, 72h respectively, the result showed that 24h was the most effective time. After NP cells were transfected by siRNA, IL-1β or IL-1β with CGS-21680 stimulated for 24h, cells proliferation reduced by IL-1β but increased after added CGS-21680. PKA siRNA decreased cells proliferation compared to NC siRNA treated cells, NFκB siRNA increased cells proliferation compared PKA siRNA but still less than NC siRNA treated cells (Fig. 1B).

4.2 Inflammatory cytokines expression in supernatant and NP cells

Inflammatory cytokines IL-6 and TNF-ɑ were increased when stimulated by IL-1β and were decreased added CGS-21680 in supernatant (Fig. 2B-C) and NP cells (Fig. 3A-B). Used PKA siRNA effected IL-1β and CGS-21680 co-cultured NP cells, IL-6 and TNF-ɑ upregulated. The expressions were downregulated while affected by NFκB siRNA. In supernatant, cAMP was reduced when NP cells treated with IL-1β and increased co-treated with CGS-21680 (Fig. 2A). In NP cells, NFκB mRNA was increased by IL-1β and decreased with CGS-21680, PKA siRNA upregulated NFκB expression (Fig. 3C).

4.3 A2aR protein contributed to CREB-NFκB signaling pathway

We detected A2aR downregulated in NP cells treated IL-1β and upregulated while added CGS-21680, inhibited PKA could reduce A2aR protein. CREB and PKA protein expression was similar as A2aR. Protein NFκB, IL-6 and MMP3 were increased by IL-1β and decreased when co-cultured with CGS-21680, PKA siRNA upregulated these proteins expression. Blocking NFκB could decrease these proteins (Fig. 4).

4.4 The result of A2aR and collagen II detection by Immunofluorescence staining

The immunofluorescence results showed that A2aR and collagen II were significantly downregulated after stimulation with IL-1β in NP cells in vitro. The integrated option density (IOD) of A2aR and collagen II were upregulated when co-treated with CGS-21680, and the IOD of A2aR and collagen II were reduced after co-treatment with PKA siRNA. NFκB siRNA upregulated the expression of collagen II (Fig. 5).

These results confirmed that IL-1β treated NP cells in vitro induced inflammation and collagen degradation. A2aR played an important role in anti-inflammatory action through the cAMP-CREB-NFκB signaling pathway. In the study, we found that A2aR was significantly downregulated after stimulation with IL-1β in NP cells. CGS-21680, the agonist of A2aR, co-cultured with IL-1β in NP cells could upregulated A2aR expression. IL-1β induced A2aR expression decreasing, this resulting cAMP and CREB downregulated, but NFκB upregulated, these results caused inflammatory cytokine (IL-6 and TNF-ɑ increased) and collagen degradation (collagen II reduced and MMP3 increased). To the best of our knowledge, this was the first report on the impact of IL-1β on the A2aR mediated cAMP-CREB-NFκB signaling pathway in NP cells in vitro (Fig. 6).

Several novel observations had been obtained from the present study. Firstly, we demonstrated that A2aR action as an important anti-inflammatory role in NP cells. Previous study reported that adenosine produces anti-inflammatory action through the A2aR in excess within the inflammatory tissue and lymphocytes of rheumatoid arthritis patients⁹. While the function of A2aR in intervertebral disk remains unknow. The pathogenesis of IVD is complication, the resident NP cells serve for producing proteoglycan and type II collagen to control the ECM metabolism. The highly specialized ECM within the IVD is essential for transmitting mechanical load and permitting movement of the spine¹². In this study, we found that IL-1β was degradated collagen II and increased MMP3, through reduced the expression A2aR. Meanwhile, large amounts of inflammatory factors released. CGS-21680 is the agonist of A2aR, reduced collagen II degradation and inhibited inflammatory factors releasing. These suggested the protection of A2aR in NP cells.

Secondly, results from this study reveal the signaling pathway of A2aR in NP cells protection. In rheumatoid arthritis A2aR is involved in inflammation through cAMP and PKA protein¹³. Phosphorylated cyclic AMP response elementbinding (CREB) protein is the member of cAMP dependent protein kinase related pathways, have potential activation of biomolecules such as collagens and cytokines in NP cells^{14, 15}. CREB is a major transcriptional factor in immune related signaling downstream of PKA¹⁶. Receptor activator of NFκB ligand was the important pathway involved in neurotrophins secretion by nucleus pulposus cells under the degenerated IVD-like acidic microenvironment¹⁷. We found that A2aR reduced when NP cells stimulated by IL-1β, meanwhile, cAMP and CREB downregulated but NFκB upregulated. CGS-21680 promoted A2aR expression. PKA siRNA blocking, NFκB and inflammation cytokine expression increased and collagen degradation. Herein, A2aR protected NP cells from inflammation and collagen degradation through cAMP-CREB-NFκB axion in this study.

In conclusion, this was the first study to evaluate the protection effects of A2aR in IVDD in vitro. We found that A2aR was involved in cAMP-CREB-NFκB axion regulating inflammation and collagen deposition in NP cells.

Ethics Statement

This research used rat nucleus pulposus cells from commercial, its according with ethics.

Disclosure

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Author Contributions

Weijun Liu conception and design of research, Qingbo Li and Lei Cai analyzed data, Zhengkun Wang interpreted results of experiments, Weijun Liu drafted manuscript, Weijun Liu edited and revised manuscript, Weijun Liu, Weizhi Fang, Xincheng Yi, Zhi Yao, Ling Zhang and Lu Bai performed experiments. All authors approved the submitted version of manuscript.

Funding

This work was supported by Hubei Province Natural Science Foundation Project [Grant NO.2021CFB522] and Wuhan Municipal Health and Family Planing Commission, China [Grant NO. WX10C20].

Shishen P. Jinwei Ying,Yan Zhang,Linhao Su,Shi Cheng,Dike Ruan. Rhtsg-6 inhibits il-1beta-induced extracellular matrix degradation and apoptosis by suppressing the p38, and jnk pathways in nucleus pulposus cells. Folia Histochem Cytobiol. 2020;58:227–34. doi:10.5603/FHC.a2020.0019.
Fatoye F, Gebrye T, Odeyemi I. Real-world incidence and prevalence of low back pain using routinely collected data. Rheumatol Int. 2019;39:619–26. doi:10.1007/s00296-019-04273-0.
Zhang Y. Fan He,Zhi Chen,Qihang Su,Meijun Yan,Qiang Zhang,Jun Tan,Lie Qian,Yingchao Han. Melatonin modulates il-1β-induced extracellular matrix remodeling in human nucleus pulposus cells and attenuates rat intervertebral disc degeneration and inflammation. Aging. 2019;26:10499–512. doi:10.18632/aging.102472.
Wu RHe,ZheWang,MinCui,ShengLiu,Wei. Mo Chen,Yongchao Wu,Yanji Qu,Hui Lin,Sheng Chen,Baichuan Wang,Zengwu Shao. Hif1a alleviates compression-induced apoptosis of nucleus pulposus derived stem cells via upregulating autophagy. Autophagy. 2021;17(11):3338–60. doi:10.1080/15548627.2021.1872227.
Li Qi-HuiLi,Wen-XiaXie,Xiao-Pei,Ka-Te Huang,Zhong-Heng Du,Wen-Jie Cong,Long-Hua Zhou,Tian-Shen Ye,Jiang-Fan Chen. Adenosine a2a receptors mediate anti-inflammatory effects of electroacupuncture on synovitis in mice with collagen-induced arthritis. Evid Based Complement Alternat Med. 2015;2015:809560. doi:10.1155/2015/809560.
Yang X, Heitman LH, IJzerman AP, van der Es D. Molecular probes for the human adenosine receptors. Purinergic Signal. 2021;17(1):85–108. doi:10.1007/s11302-020-09753-8.
Vincenzi F, Pasquini S, Borea PA, Varani K. Targeting adenosine receptors:A potential pharmacological avenue for acute and chronic pain. Int J Mol Sci. 2020;21(22):8710. doi:10.3390/ijms21228710.
da Silva JLG, Passos DF, Bernardes VM, Daniela BR, Leal. Atp and adenosine: Role in the immunopathogenesis of rheumatoid arthritis. Immunol Lett. 2019;214:55–64. doi:10.1016/j.imlet.2019.08.009.
Pal Y, Bandyopadhyay N, Pal RS, Ahmed S, Bandopadhyay S. Perspective and potential of a2a and a3 adenosine receptors as therapeutic targets for the treatment of rheumatoid arthritis. Curr Pharm Des. 2019;25(26):2859–74. doi:10.2174/1381612825666190710111658.
Qiaoyun Wu,Jie Chen,Jingjing Yue,Xinwang Ying,Ye Zhou,Xiaolong Chen,Wenzhan Tu,Xinfa Lou,Guanhu Yang,Kecheng Zhou,Songhe Jiang. Electroacupuncture improves neuronal plasticity through the A2AR/cAMP/PKA signaling pathway in SNL rats. Neurochem Int. 2021;145:104983. doi: 10.1016/j.neuint.2021.104983.
Newell EA, Verrier JD, Jackson TC, Travis C, Jackson,Delbert G, Gillespie,Keri Janesko-Feldman,Patrick M, Kochanek EK. Jackson. 2',3'-camp, 3'-amp, 2'-amp and adenosine inhibit tnf-α and cxcl10 production from activated primary murine microglia via a2a receptors. Brain Res. 2015;1594:27–35. doi:10.1016/j.brainres.2014.10.059.
Sun K, Jing X, Guo J, Yao X, Guo F. Mitophagy in degenerative joint diseases. Autophagy. 2021;17:2082–92. doi:10.1080/15548627.2020.1822097.
Campo GM, D'Ascola A, Prestipino V, Scuruchi M, Nastasi G, Calatroni A, Campo S. The stimulation of adenosine 2a receptor reduces inflammatory response in mouse articular chondrocytes treated with hyaluronan oligosaccharides. Matrix Biol. 2012;31(6):338–51. doi:10.1016/j.matbio.2012.07.001.
Leung VYL, Zhou L, Tam WK, Yi Sun,Fengjuan LV, Guangqian Zhou,Kenneth MC, Cheung. Bone morphogenetic protein-2 and – 7 mediate the anabolic function of nucleus pulposus cells with discrete mechanisms. Connect Tissue Res. 2017;58(6):573–85. doi: 10.1080/ 03008207.2017.1282951.
Sun Y, Zhang W, Li X. Induced pluripotent stem cell-derived mesenchymal stem cells deliver exogenous mir-105-5p via small extracellular vesicles to rejuvenate senescent nucleus pulposus cells and attenuate intervertebral disc degeneration. Stem Cell Res Ther. 2021;12(1):286. doi:10.1186/s13287-021-02362-1.
Yang S, Li L, Zhu L, Zhang C, Li Z, Guo Y, Nie Y, Luo Z. Aucubin inhibits il-1β- or tnf-α-induced extracellular matrix degradation in nucleus pulposus cell through blocking the mir-140-5p/creb1 axis. J Cell Physiol. 2019;234(8):13639–48. doi: 10.1002/jcp. 28044.
Li H, Liu H, Zhang N, Zhu Z. Involvement of the g-protein-coupled receptor 4 in the increased expression of rank/rankl/opg system and neurotrophins by nucleus pulposus cells under the degenerated intervertebral disc-like acidic microenvironment. Biomed Res Int. 2020:1328436. doi:10.1155/2020/1328436.

Table 1 RT-PCR Primers

Genes

Sequence 5’-3’

IL-6

TNF-a

NFkB

GAPDH

Forward: GCCAGAGTCATTCAGAGCAAT

Reverse: CTTGGTCCTTAGCCACTCCT

Forward: CACCACGCTCTTCTGTCTACTG

Reverse: GCTACGGGCTTGTCACTCG

Forward: CAACCTGTGCCTACACTTCAAC

Reverse: CGTCTGGCAGCTTGATGGT

Forward: CGCTAACATCAAATGGGGTG

Reverse: TTGCTGACAATCTTGAGGGAG

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Adenosine A2a receptor mediate anti-inflammation and collagen protection via cAMP/CREB/NFκB pathway in nucleus pulposus cells

Status:

Version 1

Abstract

Purpose of the study:

Materials and methods

Results

Conclusion

Figures

1. Introduction

2. Materials And Methods

3. Statistical

4. Results

4.1 Proliferation of nucleus pulposus cultured with IL-1β and CGS-21680 in vitro

4.2 Inflammatory cytokines expression in supernatant and NP cells

4.3 A2aR protein contributed to CREB-NFκB signaling pathway

4.4 The result of A2aR and collagen II detection by Immunofluorescence staining

5. Discussion

6. Conclusion

Declarations

References

Tables

Additional Declarations

Status:

Version 1