Metallothionein gene deficiency facilitates the differentiation of C2C12 myoblasts into slow-twitch myotubes

doi:10.21203/rs.3.rs-2254411/v1

Download PDF

Research Article

Metallothionein gene deficiency facilitates the differentiation of C2C12 myoblasts into slow-twitch myotubes

https://doi.org/10.21203/rs.3.rs-2254411/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 31 Aug, 2023

Read the published version in Biological and Pharmaceutical Bulletin →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Metallothionein (MT) 1 and 2 are ubiquitously expressed cysteine-rich, low molecular weight proteins. MT expression is upregulated in skeletal muscle during aging. MTs also play role in multiple types of skeletal muscle atrophy. Meanwhile, it has been reported that MT1 and MT2 gene deficiency increases myogenesis in MT knockout (MTKO) mice. However, little is known about the effect of MTs on muscle formation and atrophy. In this study, we investigated the effect of MT1 and MT2 gene knock-out using the CRISPR-Cas9 system in an in vitro skeletal muscle differentiation model (C2C12 cell line). Although the number of myotubes in C2C12 MTKO cells was comparable to that of mock-transfected cells, MT deficiency promoted myocyte fusion. Muscle-specific transcription factors myoD and myogenin were found to be upregulated at the late stage of myotube differentiation. Furthermore, the fast-twitch myosin heavy chain (MyHC) protein expression was similar in MTKO and mock-transfected myotubes, but slow-MyHC expression was higher in MTKO cells than in mock cells. The MT gene deletion did not affect the number of fast MyHC-positive myotubes but increased the number of slow MyHC-positive myotubes. Treatment with the antioxidant N-acetylcysteine (NAC) inhibited the increase in the number of slow MyHC-positive myotubes as well as slow-MyHC expression in MTKO cells. In contrast, NAC treatment did not alter the number of fast MyHC-positive myotubes or the expression of fast-MyHC in MTKO cells. These results suggest that the antioxidant effects of MTs may be involved in slow-twitch myofiber formation in skeletal muscle.

Metallothionein

C2C12 cells

myotube

slow-twitch myosin heavy chain

skeletal muscle

Skeletal muscle, which is responsible for voluntary movements, can regenerate after trauma or other injuries by activating muscle stem cells called muscle satellite cells (Dumont et al. 2015). However, aging impairs one's ability to self-repair. Skeletal muscle dysfunction causes significant physical disability in the elderly (Dodds and Sayer 2014). Sarcopenia, or the loss of muscle mass and functions while aging, is a major public health issue because it predicts frailty, a reduced quality of life, and death (Larsson et al. 2019).

Metallothionein (MT) family proteins are low-molecular-weight cysteine-rich proteins that regulate the homeostasis of essential trace metals like zinc and copper, detoxify heavy metals like cadmium and mercury, and have antioxidant properties (Thirumoorthy et al. 2007). There are at least four mammalian subfamily members: MT1, MT2, MT3, and MT4. MT1 and MT2 are ubiquitously expressed, MT3 is mainly expressed in the brain, and MT4 is specifically expressed in the squamous epithelium. MTs are induced by various stimuli, including metals, reactive oxygen species (ROS), reactive nitrate species (NOS), inflammatory cytokines, and hormones (Ruttkay-Nedecky et al. 2013). We have previously observed that the deficiency of MT1 and MT2 shortens the lifespan in mice (Kadota et al. 2015). Older male MT1 and MT2 knockout (MTKO) mice that lived longer than the average lifespan exhibited excessive and extraordinary symptoms of senescence, and body weight, including muscle weight, decreased drastically with age. Since the cause of decreased muscle weight in MTKO mice is unknown, we have focused on the role of MT1 and MT2 in muscle development and aging.

MT expression is upregulated in skeletal muscles during aging in rats (Altun et al. 2007) and humans (Welle et al. 2003). MTs also contribute to multiple types of skeletal muscle atrophy (Lecker et al. 2004; Kondo et al. 1992). The levels of MT1 and MT2 increase in the gastrocnemius muscle in superoxide dismutase 1 (SOD1) knockout mice with aging and denervation, suggesting that MTs protect the muscle from oxidative stress in the absence of SOD1(Kostrominova 2010). Meanwhile, deficiency of the MT1 and MT2 genes increased myogenesis in MTKO mice (Summermatter et al. 2017). However, little is known about the effect of MTs on muscle formation and atrophy. In this study, we investigated the effect of ubiquitously expressing MTs on muscle differentiation by deleting the MT1 and MT2 genes using the CRISPR-Cas9 system in the C2C12 cell line, an in vitro model of muscle differentiation.

Construction Of Genome Editing Vector Plasmids For Mt1 And Mt2 Genes

ChopChop software (https://chopchop.cbu.uib.no/) was used to design single guide RNAs (sgRNAs) targeting exon 1 of the mouse MT1 gene (NM_013602) and the mouse MT2 gene (NM_008630). The pairs of synthetic oligo DNA for CRISPR RNA (crRNA) targeting MT1 (5’-CCGGAGGATCGGGAGTCTTACCGG-3’ and 5’-AAACCCGGTAAGACTCCCGATCCT-3’) and MT2 (5’-CCGGGTCCCCCTTACCGGAGGCAC-3’ and 5’-AAACGTGCCTCCGGTAAGGGGGAC-3’) were annealed to form double-stranded DNAs and cloned into the pGuide-it-ZsGreen 1 vector and pGuide-it-tdTomato vector (Clontech Laboratories, Mountain View, CA, USA), respectively. They were named the pGuide-it-ZsGreen 1 MT1 sgRNA vector and the pGuide-it-tdTomato MT2 sgRNA vector. To construct a vector containing a drug resistance gene as a selection marker, the pEF6/Myc-His vector (ThermoFisher Scientific, Waltham, MA, USA) was used as a template for PCR to amplify the SV40 promoter and coding region of the blasticidin resistant gene (BSD) and to create an EcoRI-EcoRV restriction site at the 5’ and 3’ ends with the following primers: forward primer, 5’- CCGAATTCCTGTGGAATGTGTGTCAGTTAG − 3’ and reverse primer, 5’-GAGATATCTTAGCCCTCCCACACATAAC − 3’. Furthermore, the amplified cDNA was subcloned into the EcoRI-EcoRV fragment of the pGuide-it ZsGreen 1 vector with and without the target sequence for MT1, termed the pGuide-it bsd MT1 vector and pGuide-it sgRNA bsd vector, respectively.

Cell culture of the C2C12 cell line, establishment of MT knockout cells using the CRISPR-Cas9 system, and differentiation into myotubes

The C2C12 cell line was obtained from the American Type Culture Collection (ATCC, VA, USA). The C2C12 myoblasts were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich) at 37°C in the presence of 5% CO₂. For genome editing, undifferentiated C2C12 cells (1 × 10⁵) were seeded onto 6-well plates one day prior to the addition of plasmid DNA. The lipofection reagent Lipofectamine 3000 (Life Technologies, Carlsbad, CA, USA) and a total of 2.5 µg of plasmid DNA (pGuide-it MT1 sgRNA bsd vector; pGuide-it MT2 sgRNA tdTomato vector = 0.83 µg; 1.67 µg for MT1 and MT2 knockout; pGuide-it bsd vector; pGuide-it tdTomato vector = 0.83 µg; 1.67 µg for mock-transfection) were used to transfect the cells. After day 2, the cells were trypsinized and seeded into 100-mm dishes. Blasticidin A-resistant cell lines were then selected using DMEM containing 10% FBS and blasticidin A at a final concentration of 10 µg/mL. Genomic DNA was isolated from the cells using NucleoSpin Tissue (TAKARA Bio Inc., Kusatsu, Japan), and the region surrounding the sgRNA target site was amplified using primers for MT1 (5’-CAACGACTATAAAGAGGGCAGG-3’ and 5’-GCAAGAGCGGATTCTAGAAAGA-3’) and MT2 (5’-AACTCTTCAAACCGATCTCTCG-3’ and 5’-CTAGGAAGGTGAGGCAAATCAC-3’). Sequence data for the PCR products was obtained by Contract Analysis (Eurofins Genomics, Tokyo, Japan). The efficacy of genome editing was determined by quantifying the frequency of insertion/deletion (indel) formation using DEcomposition (TIDE: http://tide.nki.nl). Confluent cells were cultured in the differentiation medium (DM), DMEM supplemented with 2% horse serum (HS; Sigma-Aldrich), for five days to induce myotube differentiation. The medium was replaced with fresh DM every two days.

Measurement Of Intracellular Ros Generation

Intracellular ROS generation was assessed using CellRox Green (Thermo Fisher Scientific). The cells were then incubated with 5 µM CellROX in a CO₂ incubator. After washing three times with phosphate-buffered saline (PBS), the cells were trypsinized and fixed in 4% paraformaldehyde in PBS. The rate of oxidized CellRoX-positive cells was quantified using a Guava easyCyte flow cytometer (Merck Millipore, Darmstadt, Germany), after filtering the fixed cells with mini Cell Strainers II (40 µm mesh) (Biomedical Science, Tokyo, Japan).

Myotube Fusion Index Calculation

The cells were fixed in 4% paraformaldehyde. After washing with PBS, the cells were stained with May-Grünwald staining solution (FUJIFILM Wako Pure Chemical) for 5 min at room temperature (RT). The cells were washed twice with PBS and incubated with Giemsa staining solution (FUJIFILM Wako Pure Chemical) diluted 1:20 in distilled water for 20 min at RT. Images were obtained using an optical microscope camera (TrueChrome II; TUCSEN Photonics, Fuzhou, China) after washing twice with PBS. Myocytes containing more than two nuclei were counted as myotubes. The fusion index was calculated as the ratio of the number of nuclei in the myotubes to the total number of nuclei.

Rna Isolation And Real-time Rt-pcr Analysis

RNA isolation and real-time RT-PCR analysis

Cell lysates were prepared using the RNAiso Plus reagent (TAKARA Bio). After the cells were lysed, chloroform (1/5 of the volume of the RNAiso Plus reagent) was added to the samples. The samples were centrifuged (11,000 × g) at 4°C for 15 min, and the supernatants were collected before adding one volume of RNA-free water and 0.7 volume of ethanol. The lysates were then added to Nucleospin RNA Kit (TAKARA Bio) columns, and the total RNA was isolated according to the manufacturer’s instructions. For reverse transcription (RT), 2 µg of RNA from each sample was reverse transcribed using a High-Capacity cDNA RT Kit (Life Technologies, Carlsbad, CA, USA). The cDNA samples were diluted (1:10) and subjected to real-time PCR (RT-PCR) using TB Green Premix Ex Taq II (TAKARA Bio) in a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). The primer sets used in the RT-PCR assay are provided in Online Resource 1. The PCR program was performed as follows: denaturing stage at 95°C for 20 s, followed by 40 cycles at 95°C for 3 s, and 60°C for 30 s. Each sample was analyzed in triplicate. To verify specificity, melting curve analysis and agarose gel electrophoresis were performed on real-time RT-PCR products. The PCR product level was calculated using the standard curve method, which involved plotting the quantification cycle values of serial dilutions of all cDNA sample mixtures on the y-axis against the logarithm of the standard sample concentrations on the x-axis. The relative amount of GAPDH (GAPDH) mRNA as an internal control housekeeping gene was determined to compensate for variations in RT-PCR efficiency.

Immunocytochemistry

C2C12 cells were seeded at a density of 3 × 10⁴ cells per well in 48-well plate. After the differentiation, cells were fixed with 4% paraformaldehyde for 1 h at RT. After washing with PBS, blocking buffer (5% goat serum and 1 mg/mL bovine serum albumin in PBS) was added, and the cell specimens were incubated for two hours at room temperature. Samples were then treated overnight at 4°C with a primary antibody (anti-metallothionein antibody [UC1MT]; mouse monoclonal, #ab12228; Abcam, Cambridge, UK) of 1:100 dilutions in the blocking buffer, Fast Myosin Skeletal Heavy Chain [MY-32] (mouse monoclonal, #ab51263; Abcam), and Slow Myosin Skeletal Heavy Chain [NOQ7.5.4D] (mouse monoclonal, #ab11083; Abcam) of 1:500 dilutions in the blocking buffer). After washing in PBS with 0.05% Tween 20, a secondary antibody (Alexa Fluor 488 goat anti-mouse IgG (Life Technologies), 1:1000) was added. 1µg/mL Hoechest 33258 (Thermo Fisher Scientific) in PBS was used for the nuclear staining. Immunofluorescence images were captured using a BIOREVO BZ-X700 fluorescence microscope (Keyence, Osaka, Japan).

Sds-page And Western Blotting

The cells were sonicated and digested in cold mammalian protein extraction reagent (M-PER; Pierce Biotechnology, Rockford, IL, USA), which contained a complete mini protease inhibitor cocktail tablet (Roche Applied Sciences, Penzberg, Germany), and the extracts were centrifuged at 20,400 × g for 15 min at 4°C. Aliquots of the resultant supernatants containing 20 µg of total protein were treated with 25 mM mercaptoethanol and 167 mg/mL sodium dodecyl sulfate (SDS) and boiled at 100°C for 2 min. Each sample was then subjected to SDS–polyacrylamide gel electrophoresis (SDS-PAGE), followed by electroblotting onto polyvinylidene difluoride (PVDF) membranes using the Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were initially treated with a 1:1000 dilution of rabbit antibodies against β-actin (rabbit polyclonal, #ab8227; Abcam), Fast Myosin Skeletal Heavy Chain and Slow Myosin Skeletal Heavy Chain, and myogenin (rabbit polyclonal, GTX33338) and MyoD [N1N3] (rabbit polyclonal, GTX100885) (GeneTex International Corporation, Hsinchu City, Taiwan) as primary antibodies, followed by treatment with a 1:2000 dilution of horseradish peroxidase (HRP)-linked anti-rabbit IgG antibody (#7074), and HRP-linked anti-rabbit IgG antibody (#7076; Cell Signaling Technology, Danvers, MA, USA) as secondary antibody in Tris-buffered saline (TBS)-0.05% Tween 20. Membrane proteins were visualized and quantified using Amersham ImageQuant 680 and analysis software (GE Healthcare Life Sciences, Marlborough, MA, USA) and a chemiluminescent substrate (Millipore, Billerica, MA, USA). A pre-stained SDS-PAGE standard (Bio-Rad) was used as a molecular mass standard protein to calculate the molecular weight of the proteins.

Statistical Analysis

The bell curve in Microsoft Excel (Social Survey Research Information, Tokyo, Japan) was used for the statistical analysis. Data sets were compared for significant differences using the paired Student’s t-test or one-way analysis of variance (ANOVA) using Dunnett’s test and the Tukey-Kramer method. The siginificance value was set at P < 0.05.

Establishment of MT1 and MT2 knockout (MTKO) myoblast of C2C12 cell line

First, we evaluated the expression levels of MT1 and MT2 in the mouse myoblast cell line C2C12, which is a widely used model for studying myoblast differentiation into myotubes in vitro. The mRNA levels of Mt1 decreased (Fig. 1a), but those of Mt2 increased (Fig. 1b) over time after the induction of myotube differentiation. To analyze the effects of MT1 and MT2 on myotube differentiation in vitro, MT1 and MT2 knockout cells in the C2C12 cell line, termed MTKO cells, and mock-transfected cells (mock cells) were established using the CRISPR-Cas9 system. The indel rates of MT1 and MT2 were 86.9 ± 4.5% and 85.5 ± 3.5%, respectively. Immunofluorescence staining using anti-MT1 and MT2 antibodies showed signals in the cytoplasm of mock cells. Fluorescence was weak in MTKO cells (Fig. 1c), suggesting that MT1 and MT2 protein expression was inhibited by genome editing of MT1 and MT2 genes. Furthermore, the MTKO cells showed no morphological abnormalities. Because MTs are antioxidant proteins, we further evaluated the effect of MT gene deletion on the generation of intracellular ROS. Even under irritant-free culture conditions, intracellular ROS levels in MTKO cells were approximately 1.5-fold higher than those in mock cells (Fig. 1d).

MT1 and MT2 deficiency enhances differentiation into myotubes and the expression of muscle-specific markers in C2C12 cells

After treatment with DM on day 5, the number of myotubes in the MTKO cells was comparable to that in the mock cells (Figs. 2a and b). However, the fusion index was significantly higher in MTKO cells than in mock cells (Figs. 2a and c). MyoD and myogenin are muscle-specific transcription factors that belong to the MyoD family. MyoD is expressed early in myogenesis and is essential for myoblast identity (Rudnicki et al. 1992; Rudnicki et al. 1993; Perry and Rudnick 2000). Myogenin is essential for myoblasts differentiation into myocytes, and promotes myocyte fusion into myotubes (Perry and Rudnick 2000). During C2C12 myogenic differentiation, the mRNA expression level of Myod1, which encodes MyoD, was similar between MTKO cells and mock cells (Fig. 3a). The mRNA level of Myog, which encodes myogenin, was upregulated during myotube differentiation, and the level of Myog mRNA was significantly higher in MTKO cells than in mock cells after 3 and 5 days of culture in DM (Fig. 3b). The mRNA levels of myokines, which are cytokines secreted from skeletal muscles, including interleukin-6 (IL-6), encoded by the Il6 gene, and fibroblast growth factor 21 (FGF21), encoded by the Fgf21 gene, were also measured. The myokines expression levels in MTKO cells were higher than those in mock cells on day 5 (Figs. 3c and d). The amount of MyoD protein in MTKO cells was higher than that in mock cells on day 5 (Figs. 3e and f), which was not correlated with the MyoD level mRNA (Fig. 3a). On days 3 and 5, the level of myogenin protein was higher in MTKO cells than in mock cells (Figs. 3e and g).

MT1 and MT2 deficiency influences the expression of different myosin heavy chain isoforms in C2C12 myotubes

Skeletal muscle fibers are broadly classified into two types: type I (slow-twitch) and type II (fast-twitch). Myosin is a hexameric protein that consists of two identical heavy chains (myosin heavy chain, MyHC) and four light chains (myosin light chain). It is the main component of thick muscle filaments (Schiaffino and Reggiani 1994). MyHC I is expressed in slow skeletal muscle fibers. Three isoforms of MyHC II (MyHC IIa, IIb, and IId/x) are expressed in fast-twitch fibers. The mRNA levels of Myh4 and Myh2, encoding MyHC IIa and IIb, respectively, were lower in MTKO cells than in mock cells on day 5 (Figs. 4a and b). Furthermore, on day 5, MTKO cells had higher levels of Myh1 and Myh 7, encoding MyHC II d/x and MyHC I, respectively, than mock cells (Figs. 4c and d). At Day 5, the levels of fast fiber protein, total MyHC II, were similar in MTKO cells and mock cells (Figs. 4e and f), but the levels of slow fiber protein, MyHC I, were higher in MTKO cells than in mock cells (Figs. 4e and g).

Involvement Of Ros In Commitment To Slow Fiber In C2c12 Mtko Cells

MTs have antioxidant functions, and MTKO cells had higher intracellular ROS levels than mock cells (Fig. 1d). Therefore, we hypothesized that MT deficiency induces redox imbalance and promotes the formation of slow-twitch muscles. N-acetylcysteine (NAC), a glutathione precursor, was used as a substitute for the MTs. While the number of slow-MyHC-positive myotubes in MTKO cells was higher than that in mock cells (Figs. 5a and b), continuous NAC treatment during MTKO cell differentiation reduced the number of slow-twitch myotubes (Figs. 5a and b). NAC treatment did not change the number of fast-MyHC-positive myotubes (Figs. 5a and c). Moreover, NAC treatment significantly reduced slow-MyHC protein levels in MTKO cells, but it had no effect on fast-MyHC levels in MTKO myotubes (Figs. 5d, e, and f).

The present study showed that MT gene deficiency promotes myotube formation in C2C12 cells. These results are in accordance with those of an in vivo study by Summermatter et al. (2017). In contrast to our results, Hyldahl et al. showed that MT knockdown did not affect myotube diameter in differentiated C2C12 cells (Hyldahl et al. 2010). One reason the results differed from ours is that the silencing effect of siRNA on MT mRNA expression did not persist until the late differentiation of C2C12 cells. Myogenic regulatory factors, such as MyoD and myogenin, were upregulated in MTKO cells from day 3 to day 5 after induction of myocyte differentiation, which is the late stage of myotube formation. MT is thought to be involved in the late stages of myogenic differentiation of myoblasts. Myogenin is expressed at higher levels in slow-twitch muscles than in MyoD (Hughes et al. 1993; Voytik et al. 1993). Myogenin and MyoD are associated with the expression of slow- and fast-type MyHC I and fast type MyHC II, respectively (Hughes et al. 1993)(Bottinelli et al. 1994; Hughes et al. 1997). Since the mRNA and protein expression levels of myogenin and slow MyHC were higher in MTKO cells than in mock cells, MT gene knockout potentially regulates myogenesis with slow muscle fiber predominance via high expression of myogenin. In addition, antioxidant treatment of C2C12 MTKO cells inhibited the formation of slow-muscle-fiber-dominant myotubes. MTs may be related to slow muscle fiber formation via their antioxidant capacity. Following acute spinal cord transection, the soleus muscle of MTKO mice atrophied and developed contractile dysfunction (DeRuisseau et al. 2009). The soleus muscle is of the slow-twitch type, which is smaller and develops less force than the fast-twitch fibers. In acute spinal cord injury, MT gene deficiency may be more likely to affect the soleus muscle, which is a slow-twitch dominant muscle rather than a fast-twitch dominant muscle.

Excessive oxidative stress inhibits myogenic differentiation in C2C12 cells (Ardite et al. 2004; Hansen et al. 2007), whereas moderate ROS levels promote myogenesis (Youm et al. 2019; Liu et al. 2020). Genetic defects in MT appear to contribute to the promotion of muscle differentiation by moderate oxidative stress. The mRNA levels of myokines, including IL-6 and FGF21, increased in correlation with the ability of C2C12 MTKO cells to form myotubes. IL-6 and FGF21 are involved not only in glucose and lipid metabolism but also in muscle loss (Yang et al. 2022; Oost et al. 2019). The expression of these myokines induced by MT gene knockout may have little effect on muscle loss under basal conditions, but it has been suggested that they may cause muscle atrophy under high oxidative conditions, including aging and starvation. Thus, MT deficiency is not necessarily effective for myogenesis.

Fast-twitch muscles are more sensitive to aging than slow-twitch muscles. Aging triggers a myofiber-type transition from fast-twitch to slow-twitch fibers, called the “fast-to-slow muscle transition” (Ohlendieck 2011; Miljkovic et al. 2015; Olson et al. 2021). The mechanism underlying the fast-to-slow muscle fiber transition with aging is still unclear. Since the number of myotubes expressing slow-type MyHC type 1 was higher in C2C12 MTKO cells than in mock cells, MT gene deficiency may facilitate myoblast differentiation into slow-twitch muscle cells. If MT expression is low in muscle satellite cells, slow-twitch myocytes may be regenerated to replace fast-twitch myocytes shed by aging, which is associated with a slowing of contraction and relaxation in skeletal muscle in the elderly. The change in slow-twitch myofibers in the muscles may explain the extraordinary symptoms of senescence and body weight loss with age in MTKO mice.

The deletion of MT1 and MT2 genes seemingly promotes myogenesis in C2C12 cells while facilitating myoblast differentiation into slow-twitch muscle cells. This would have a negative effect on aging skeletal muscles, which undergo fast-to-slow transitions. The antioxidant effect of MT may contribute to proper muscle formation and the determination of muscle fiber type in the skeletal muscle.

Statements and declarations

Ethics approval and consent to participate

This study was approved by the Safety Committee for Recombinant DNA Experiments at Tokushima Bunri University (permission number: 92) and carried out according to the guidelines of the committee.

Consent for to publication

Not applicable.

Availability of data and materials

The datasets generated and/or analyzed during the study are available upon reasonable request from the corresponding author.

Competing interests

The authors declare that they have no competing interests.

Funding

The authors received no specific funding for this work.

Author Contributions

Yoshito Kadota, Takashige Kawakami, Masao Sato, and Shinya Suzuki contributed to the study conception and design. Material preparation, data collection and analysis were performed by Yoshito Kadota, Ryo Yamanokuchi, Nodoka Ohnishi, and Mami Matsuoka. The first draft of the manuscript was written by Yoshito Kadota and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Altun M, Edström E, Spooner E et al (2007) Iron load and redox stress in skeletal muscle of aged rats. Muscle Nerve 36:223–233. https://doi.org/10.1002/mus.20808
Ardite E, Barbera JA, Roca J, Fernández-Checa JC (2004) Glutathione depletion impairs myogenic differentiation of murine skeletal muscle C2C12 cells through sustained NF-kappaB activation. Am J Pathol 165:719–728. https://doi.org/10.1016/s0002-9440(10)63335-4
Bottinelli R, Betto R, Schiaffino S, Reggiani C (1994) Maximum shortening velocity and coexistence of myosin heavy chain isoforms in single skinned fast fibres of rat skeletal muscle. J Muscle Res Cell Motil 15:413–419. https://doi.org/10.1007/BF00122115
DeRuisseau LR, Recca DM, Mogle JA et al (2009) Metallothionein deficiency leads to soleus muscle contractile dysfunction following acute spinal cord injury in mice. Am J Physiol Regul Integr Comp Physiol 297:R1795–R1802. https://doi.org/10.1152/ajpregu.00263.2009
Dodds R, Sayer AA (2014) Sarcopenia. Arq Bras Endocrinol Metabol 58:464–469. https://doi.org/10.1590/0004-273000000
Dumont NA, Bentzinger CF, Sincennes M, Rudnicki MA (2015) Satellite Cells and Skeletal Muscle Regeneration. Compr Physiol 5:1027–1059. https://doi.org/10.1002/cphy.c140068
Hansen JM, Klass M, Harris C, Csete M (2007) A reducing redox environment promotes C2C12 myogenesis: implications for regeneration in aged muscle. Cell Biol Int 31:546–553. https://doi.org/10.1016/j.cellbi.2006.11.027
Hughes SM, Koishi K, Rudnicki M, Maggs AM (1997) MyoD protein is differentially accumulated in fast and slow skeletal muscle fibres and required for normal fibre type balance in rodents. Mech Dev 61:151–163. https://doi.org/10.1016/S0925-4773(96)00631-4
Hughes SM, Taylor JM, Tapscott SJ et al (1993) Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones. Development 118:1137–1147. https://doi.org/10.1242/dev.118.4.1137
Hyldahl RD, O’Fallon KS, Schwartz LM, Clarkson PM (2010) Knockdown of metallothionein 1 and 2 does not affect atrophy or oxidant activity in a novel in vitro model. J Appl Physiol 109:1515–1523. https://doi.org/10.1152/japplphysiol.00588.2010
Kadota Y, Aki Y, Toriuchi Y et al (2015) Deficiency of metallothionein-1 and – 2 genes shortens the lifespan of the 129/Sv mouse strain. Exp Gerontol 66:21–24. https://doi.org/10.1016/j.exger.2015.04.007
Kondo H, Miura M, Nakagaki I et al (1992) Trace element movement and oxidative stress in skeletal muscle atrophied by immobilization. Am J Physiol 262:E583–E590. https://doi.org/10.1152/ajpendo.1992.262.5.E583
Kostrominova TY (2010) Advanced age-related denervation and fiber-type grouping in skeletal muscle of SOD1 knockout mice. Free Radic Biol Med 49:1582–1593. https://doi.org/10.1016/j.freeradbiomed.2010.08.022
Larsson L, Degens H, Li M et al (2019) Sarcopenia: Aging-Related Loss of Muscle Mass and Function. Physiol Rev 99:427–511. https://doi.org/10.1152/physrev.00061.2017
Lecker SH, Jagoe RT, Gilbert A et al (2004) Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J 18:39–51. https://doi.org/10.1096/FJ.03-0610COM
Liu X, Heras G, Lauschke VM et al (2020) High glucose-induced oxidative stress accelerates myogenesis by altering SUMO reactions. Exp Cell Res 395:112234. https://doi.org/10.1016/j.yexcr.2020.112234
Miljkovic N, Lim J-Y, Miljkovic I, Frontera WR (2015) Aging of Skeletal Muscle Fibers. Ann Rehabil Med 39:155. https://doi.org/10.5535/arm.2015.39.2.155
Ohlendieck K (2011) Proteomic profiling of fast-to-slow muscle transitions during aging. Front Physiol 2:105. https://doi.org/10.3389/FPHYS.2011.00105/BIBTEX
Olson LC, Redden JT, Schwartz Z et al (2021) Advanced Glycation End-Products in Skeletal Muscle Aging. Bioengineering 8:168. https://doi.org/10.3390/BIOENGINEERING8110168
Oost LJ, Kustermann M, Armani A et al (2019) Fibroblast growth factor 21 controls mitophagy and muscle mass. J Cachexia Sarcopenia Muscle 10:630–642. https://doi.org/10.1002/JCSM.12409
Perry RL, Rudnick MA (2000) Molecular mechanisms regulating myogenic determination and differentiation. Front Biosci 5:D750–D767. https://doi.org/10.2741/perry
Rudnicki MA, Braun T, Hinuma S, Jaenisch R (1992) Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development. Cell 71:383–390. https://doi.org/10.1016/0092-8674(92)90508-A
Rudnicki MA, Schnegelsberg PNJ, Stead RH et al (1993) MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 75:1351–1359. https://doi.org/10.1016/0092-8674(93)90621-V
Ruttkay-Nedecky B, Nejdl L, Gumulec J et al (2013) The Role of Metallothionein in Oxidative Stress. Int J Mol Sci 14:6044–6066. https://doi.org/10.3390/ijms14036044
Schiaffino S, Reggiani C (1994) Myosin isoforms in mammalian skeletal muscle. J Appl Physiol 77:493–501. https://doi.org/10.1152/jappl.1994.77.2.493
Summermatter S, Bouzan A, Pierrel E et al (2017) Blockade of Metallothioneins 1 and 2 Increases Skeletal Muscle Mass and Strength. Mol Cell Biol 37:305–321. https://journals.asm.org/doi/10.1128/MCB.00305-16
Thirumoorthy N, Manisenthil Kumar KT, Sundar AS et al (2007) Metallothionein: An overview. World J Gastroenterol 13:993–996. https://doi.org/10.3748/wjg.v13.i7.993
Voytik SL, Przyborski M, Badylak SF, Konieczny SF (1993) Differential expression of muscle regulatory factor genes in normal and denervated adult rat hindlimb muscles. Dev Dyn 198:214–224. https://doi.org/10.1002/aja.1001980307
Welle S, Brooks AI, Delehanty JM et al (2003) Gene expression profile of aging in human muscle. Physiol Genomics 14:149–159. https://doi.org/10.1152/physiolgenomics.00049.2003
Yang B, Yang X, Sun X et al (2022) IL-6 Deficiency Attenuates Skeletal Muscle Atrophy by Inhibiting Mitochondrial ROS Production through the Upregulation of PGC-1α in Septic Mice. Oxid Med Cell Longev 2022:1–12. https://doi.org/10.1155/2022/9148246
Youm TH, Woo S-H, Kwon E-S, Park SS (2019) NADPH Oxidase 4 Contributes to Myoblast Fusion and Skeletal Muscle Regeneration. Oxid Med Cell Longev 2019:3585390. https://doi.org/10.1155/2019/3585390

No competing interests reported.

ESM1.pdf

Download PDF

Journal Publication

published 31 Aug, 2023

Read the published version in Biological and Pharmaceutical Bulletin →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Metallothionein gene deficiency facilitates the differentiation of C2C12 myoblasts into slow-twitch myotubes

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Construction Of Genome Editing Vector Plasmids For Mt1 And Mt2 Genes

Measurement Of Intracellular Ros Generation

Myotube Fusion Index Calculation

Rna Isolation And Real-time Rt-pcr Analysis

Immunocytochemistry

Sds-page And Western Blotting

Statistical Analysis

Results

Establishment of MT1 and MT2 knockout (MTKO) myoblast of C2C12 cell line

Involvement Of Ros In Commitment To Slow Fiber In C2c12 Mtko Cells

Discussion

Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1