Cells
Fibroblast MRC-5 cells (American Type Culture Collection [ATCC® CCL-171]) were used. The MRC-5 cells were grown in Eagle’s minimum essential medium (MEM) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, Carlsbad, CA), L-glutamine and sodium bicarbonate and 1% penicillin-streptomycin (MEM-10FBS). The retinal pigment epithelial cell line ARPE-19 (ATCC® CRL-2302™) and hTERT (human telomerase reverse transcriptase)-immortalized RPE-1 (ATCC® CRL-4000™), both of which were epithelial cell lines, were cultured in Dulbecco’s modified Eagle medium (DMEM)/F-12 (1:1), including L-glutamine and 2.438g/L sodium bicarbonate (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (Gibco or Hyclone, GE Healthcare UK Ltd, UK) (DMEM-10FBS). The culture medium for RPE-1 was additionally supplemented with hygromycin B at a concentration of 0.01 mg/mL. 293FT cells (Thermo Fisher Scientific, Waltham, MA) were grown in DMEM (Wako, JAPAN) supplemented with 5% fetal bovine serum (Gibco) (DMEM-5FBS). The 293FT cells were cultured in collagen-coated plates (TOYOBO, Osaka, JAPAN).
Viruses
HCMV strain Merlin (ME, ATCC® VR-1590™) was used as the source for constructing plasmids and for NT antibody analyses in MRC-5 cells. For the measurement of NT titers in ECs, HCMV clinical strain 1612, which was isolated in our laboratory from the urine of a 2-month-old baby with symptomatic HCMV disease was used. The HCMV 1612 strain was propagated in MRC-5 cells with three passages followed by five passages in ARPE-19 cells. In ARPE-19 cells infected with the 1612 strain, clear CPE was confirmed at 1 week after passage. The ME strain was mass-cultured following two passages in MRC-5 cells. The ME strain- or 1612 strain-infected cells were harvested at full CPE and suspended in FBS-free medium before being stored at -80°C. The stored cells were repeated freezing and thawing twice, and then the infectious dose in the supernatant was determined by counting CPE using MRC-5 cells. The titers of ME strain and 1612 strain measured using MRC-5 cells were 3.6 × 104 plaque forming unit (PFU)/mL and 3.5 × 105 PFU/mL, respectively. HCMV 1612 strain was used to measure the NT antibody titers in ECs, because the strain possessed the capacity to infect ECs.
Serum sampling (subject selection) and ethical considerations
Seventy-eight healthy volunteers were recruited. The age of the volunteers ranged from 20 to 60 years (Table 1). All serum samples were first tested for HCMV IgG antibody positivity against total HCMV proteins with a commercially available enzyme-linked immunosorbent assay (ELISA) kit (DENKA SEIKEN, Tokyo, Japan), and the HCMV-IgG ELISA titers were determined according to the manufacturer’s instructions. The HCMV-IgG-positive sera were then further tested for HCMV-antibody titers by an indirect immunofluorescence assay (IIFA) and an HCMV-NT assay, as described below. The serum samples were heat-inactivated at 56°C for 30 min before testing antibody titers with any assays.
HCMV neutralization assay
HCMV-NT titers of each serum were assessed with a conventional plaque reduction assay. In brief, serum samples were serially diluted with maintenance medium, MEM-2FBS or DMEM-2FBS. Sixty µL of the diluted serum sample and an equal volume of virus solution containing 60 plaque forming units (PFUs) of HCMV were mixed and incubated in a U-bottomed 96-well plate (Greiner Bio-One JAPAN, Tokyo, Japan) at 37°C for 1 hour. One hundred microliters of the mixture was then added to monolayers of ECs (RPE-1) or fibroblast (MRC-5) cells. The cell sheets were prepared by seeding cells to 15,000 cells per well in 96-well plates (CORNING, Corning, NY) on a day before performing the neutralization process. HCMV ME was used for the HCMV-NT assay in MRC-5 cells, while HCMV 1612 was used for the HCMV-NT assays in RPE-1 cells and MRC-5 cells. Fixation, staining with crystal violet, formalin and methanol treatment, and washing of the HCMV ME-MRC-5 plates were carried out at 4 days post inoculation, while the processing and measuring of NT antibody titers against HCMV 1612 in RPE-1 cells and MRC-5 cells were fixed at 2 days post inoculation. After staining, washing, and drying, CPE consisting of agglomerated cells were observed by stereomicroscopy. The 50% virus-NT titers (NT50) were defined as the reciprocal of the highest dilution level, at which the plaque number became less than half of the control. Each test was run in triplicate.
HCMV glycoprotein genome amplification with polymerase chain reaction for plasmid construction
Each open reading frame (ORF) of the gP of HCMV ME was amplified by polymerase chain reaction (PCR) using primer sets that were designed with reference to the ME sequence (GenBank Accession no; AY446894.2.). All primers and oligonucleotides were purchased from Eurofins Genomics (Tokyo, Japan). The 30-μL reaction was composed of 15 μL Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA), 0.5μM of each primer, and template DNA. PCR amplicon bands were isolated from 10% agarose electrophoresis gel and were purified using the FastGene Gel/PCR Extraction Kit (NIPPON Genetics, Tokyo, JAPAN). Purified DNA was quantitated using a NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific).
Plasmid construction
First, the ORF of each gP of HCMV ME was amplified from cDNA, which was derived from RNA purified from the HCMV-ME-infecting MRC-5 cells by two step conventional reverse transcription. The synthetic DNA oligonucleotide of ME-UL128 wt (G>A in UL128 was fixed) was purchased from Integrated DNA Technologies (Coralville, IA). Each of the ORF genes was cloned into the cloning site of the modified pHEK293 ULTRA Expression vector II (Takara Bio Inc., Shiga, Japan), which was used for the recombinant protein expression in mammalian cells as a form of fusion protein with a designated tag at the carboxy-terminal (Fig. 1A). The insertion of the gene of interest was carried out using Fusion™ HD (Takara Bio Inc) according to the manufacturer's instructions.
Sanger DNA sequencing
The nucleotide sequence was determined using an ABI Prism 3130 Avant Genetic Analyzer (Applied Biosystems, Foster City, CA). The sequences were aligned to the reference using DNA Dynamo (Blue-Tractor Software, North Wales, UK). The nucleotide sequence of the constructed plasmids was confirmed to be the original sequence by Sanger DNA sequencing.
The sequence of the UL128L (UL128-131A locus) in strain 1612 was determined by Sanger sequencing, in which the PCR product was amplified using primers UL128L-F (GCGTATTTCGGACAAACACACA) and UL128L-R (CGCATGTTGCAGACTGAGAAAGA) [22]. It was confirmed that there were no mutations in the UL128L gene of the HCMV 1612.
Antigen preparations for the indirect immunofluorescence assay
293FT cells were transfected with pHEK293-gB for the expression of recombinant gB. The same cells were also co-transfected with pHEK-gM and pHEK-gN, with pHEK-gH, pHEK-gL, and pHEK-gO , and with pHEK-gH, pHEK-gL, pUL128, pUL130, and pUL131A for the expression of gM/gN, gH/gL/gO, and PC, respectively, using pHEK293 Enhancer Vector (Takara Bio Inc.) and HuGENE HD (Promega).
The 293FT cells transfected with each designated plasmid or the combination of the plasmids were washed with phosphate buffered saline (PBS) (-), spotted on glass slides (Matsunami Glass IND., Ltd., Osaka, Japan), and fixed with a methanol and acetone mixture mixed at a ratio of 1:1.
The expression of gc was confirmed by IIFA by detecting the respective tags. The antibodies, which were used for the detection of histidine affinity tag (HAT)-fusion protein, c-myc-fusion protein, and FLAG-tag fusion protein, were rabbit anti-HAT-tag polyclonal antibody (GenScript, Piscataway, NJ), mouse MYC-monoclonal antibody (Aviva Systems Biology, San Diego, CA), and anti-FLAG M2 monoclonal antibody (Sigma-Aldrich Japan, Tokyo, Japan), respectively. The secondary antibodies were Alexa Fluor DyLight 488-conjugated goat anti-mouse IgG H + L antibody or DyLight 594-conjugated goat anti-rabbit IgG H + L antibody (Invitrogen). Anti-gO peptide rabbit antibodies (peptide sequence: KLKRKQALVKEQPQKKNKKS [23]) were produced by Eurofins Genomics (Tokyo, Japan).
Detection of antibodies to each gc in indirect immunofluorescence assay
To measure each gc-specific IIFA titer in sera, the serum samples were two-fold serially diluted with PBS and added onto the glass slides. After incubation at 37°C for 1 hour, the cells were washed with PBS 3 times, and were then reacted with fluorescein isothiocyanate (FITC)-conjugated goat anti-human IgG H+L (Invitrogen, Carlsbad, CA). The antibody titer was defined as the reciprocal of the highest dilution level, at which the specific fluorescent signal was detected. The cells transfected with plasmid vectors without each gp insert were used as negative control. Two samples of CMV-IgG-negative sera were tested negative for antibody detection in IIFA. Since there was a concern about subjectivity with regard to the measurement of specific antibody titers in IIFA, the FITC-specific signal was observed by two experts to ensure consistency. To avoid detecting artifacts as much as possible, the signals in the fixed cells were observed at a lower magnification first, and they were again observed at a higher magnification. Clearly positive signals, which were different from those of the negative control, were determined positive.
Statistical analysis
Statistical analyses were performed using the Stata15 software program (STATA Corporation, College Station, TX). Non-parametric analyses of the correlations were performed using Spearman’s test. P values of <0.05 were considered to indicate statistical significance.
Next generation sequencing
Amino-acid sequence homology of HCMV ME and HCMV 1612 was confirmed following base sequence determination using a next generation sequencer (NGS). Genomic DNA of HCMV 1612 was extracted from ARPE-19 cells infected with HCMV 1612 using a QIAmp DNA Mini Kit (QIAGEN, Hilden, Germany) after repeated freeze-thaw cycle treatment 2 times. The sequencing libraries were then prepared by an Ion Xpress Plus Fragment Library Kit (Thermo Fisher Scientific) in accordance with the manufacturer’s instructions. The library concentration was quantified using the Ion Library TaqMan Quantification Kit (Thermo Fisher Scientific). An emulsion PCR was performed on the library, which was adjusted to a 50-pM concentration, pooled in equimolar amounts, and mixed with capture beads on the Ion Chef System (Thermo Fisher Scientific) supplemented with the Ion Torrent Personal Genome Machine (PGM) template 200 kit (Thermo Fisher Scientific). The template libraries were sequenced with the Ion Torrent PGM using the Ion 314 Chip Kit v2 (Thermo Fisher Scientific) and the Ion Torrent PGM Sequencing 200 Kit v2 (Thermo Fisher Scientific), according to the manufacturer's instructions. The resulting FASTQ format files were imported into CLC Genomics Workbench 9.0.1 (QIAGEN) for a homology analysis. Each gP sequence of 1612 strains were registered in GenBank with the accession numbers LC425070-LC425078.