PM2.5 aerosol preparation and experimental Animals
The powder of PM2.5 was kindly provided by School of Public Health, Fudan University, Shanghai. Beijing Vital River Laboratory Animal Technology (Beijing, China) provided C57BL/6J male mice (64, 6 weeks old). In all animal experiments, the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research was followed. Shanghai Tenth People's Hospital's ethical committee approved all animal experiments and consented to publish. All animals were raised in a filtered air room (PM free)/ PM2.5 room for 3/7/10 weeks and were given free access to drinking water and common mice’s food (8 mice per group). They were exposed in FA/PM room for 8 hours per day.
Fluorescent Staining: fluorescein sodium ophthalmic strips (Jingming new technological development Co, Tianjing, China) with normal saline were applied to the eye surface of mice. Meanwhile, slit lamp microscopy was used to observe damage to the eye surface using cobalt blue light.
The cornea surface was divided into four quadrants: upper quadrant, lower quadrant, nasal quadrant, and temporal quadrant. The score of each quadrant was separately, and then a total score (16 points, Table 1) were added from each quadrant’s scores.
Table1. The standard of corneal fluorescein staining was as follows
Score
|
Standard
|
0
|
No staining
|
1
|
Slight spot staining but less than 30 spots
|
2
|
Dot staining more than 30 spots, without diffuse staining
|
3
|
Severe diffuse staining, but no plaque
|
4
|
Plaque staining
|
Schirmer Test: Under 1/3 of the conjunctiva, the phenol red cotton thread (PRT, Jingming new technological development Co) was bent 5 mm. We measured the red line's length after drawing it out for 20 seconds.
Hematoxylin and Eosin stain
5 mm slices were cut from the paraffin-embedded retinal tissues. The sections were graded ethanol series and deparaffinized with xylene. After staining, incubating and dehydrating, the tissues were mounted with neutral gum. A light microscope (Leica Microsystems, Wetzlar, Germany) was used to capture images.
Immunohistochemistry
Corneal tissue sections (5µm thick) were deparaffinized with xylene and an ethanol gradient. The tissues sections were blocked with goat serum after antigen retrieval. After that, the tissues sections were added with the respective primary antibodies in a volume of 100µL then incubated overnight. In the next day, biotinlabeled secondary antibody (Beyotime Biotechnology, Nanjing, Jiangsu, China) was added with the same volume. The tissues were counterstained by hematoxylin and were visualized with DAB for color appearance. Tissue images were captured by a light microscopy (Leica Microsystems).
Cell culture and treatment
Adult human corneal epithelial cell line HCE-T cell was from MEISENCTCC company (#CTCC-002-0020, Hangzhou, Zhejiang, China). DMEM/F12 culture media (#30023.01, Thermo Fisher Scientific, Waltham, MA, USA) was added with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA, USA), 10ng/mL human epidermal growth factor (hEGF; #91077C, Sigma-Aldrich, San Francisco, CA, USA) and 5µg/mL insulin (INS; #E9644 Sigma-Aldrich). Cell culture environment was under an 5% CO2 atmosphere at 37°C. The cell culture medium needs to be changed every day and cells were seeded in 96-, 24-, 12-, or 6- well plates as needed. At 80% confluence, the cells were washed and treated with vehicle/ tert-butylhydroquinone (tBHQ, 20µM; #T5364, TopScience, Shanghai, China)/ Bay11-7082 (7.5µM; #T1902, TopScience)/ N-acetyl-LL-cysteine (NAC, 10mM; #A9165, Sigma-Aldrich) for 6hr/24hr/3hr before exposure to PM2.5.
RNA isolation and sequencing
Total RNA from HCETs was isolated using FastPure® Cell/Tissue Total RNA Isolation Kit V2 (Vazyme Biotech Co, Nanjing, China) according to the manufacturer’s instructions. The libraries were established using VAHTS® Universal V8 RNA-seq Library Prep Kit for Illumina (Vazyme). Related analyses were performed by OE Biotech Co.
HCETs transfection
HECTs were transfected with plasmids and siRNA using Lipofectamine2000 (#11668019, Thermo) for 4hr according to the manufacturer’s protocol before 24hr PM2.5 exposure. RT-qPCR and western blotting were used to evaluate the effect of transfection. Sequences of siRNA used are listed as fellow: hRELA si-1 sense GGAGCACAGAUACCACCAATT; hRELA si-1 antisense UUGGUGGUAUCUGUGCUCCTC; hRELA si-2 sense CCUUUCUCAUCCCAUCUUUTT; hRELA si-2 antisense AAAGAUGGGAUGAGAAAGGAC; hRELA si-3 sense GGACAUAUGAGACCUUCAATT; hRELA si-3 antisense UUGAAGGUCUCAUAUGUCCTT.
Cell viability assay
Cell counting kit-8 (CCK-8 assay; #40203ES60, Yeasen, Shanghai, China) was used for cell viability. Procedures of related experiments was directed by the manufacturer’s instructions.
The intracellular ATP level determination
ATP Assay Kit (#S0026, Beyotime) was used to determinate the intracellular ATP level. Procedures of related experiments was directed by the manufacturer’s instructions.
Mitochondrial related fluorescence staining
HCETs were grown to 50% confluency and then incubated with each vehicle shown below before PM2.5 exposure. 2′,7′-dichlorofluorescein diacetate (DCFH-DA, 10µM; #287810, Sigma-Aldrich)/ MitoSox Superoxide Indicator (5 µM; #36008, Thermo Fisher Scientific)/ Tetramethylrhodamine Ethyl Ester Perchlorate (TMRE, 200nM; #T669, Sigma-Aldrich) incubated with HECTs in serum-free medium for 30/ 40 /10 minutes at 37°C with or without Hoecst (1µM; #33342, Thermo Fisher Scientific). Fluorescence intensity was measured using a flow cytometer or a microplate reader (BioTek) or an inverted fluorescence microscope (Nikon Corporation) as needed.
Immunofluorescence staining
HCETs were seeded and cultured in 35 mm confocal dishes with each vehicle. The cells were incubated with primary antibodies (all 1:800 dilution) overnight at 4°C and fluorescein isothiocyanate (cy3/488)-conjugated secondary antibodies (all 1:500 dilution) for an hour. Nuclei were stained with DAPI (1:1,000 dilution; #D9542, Sigma-Aldrich) for 15 minutes. Confocal microscopy (LSM710; Carl Zeiss, Jena, Germany) was used to obtain the images.
Western blotting
Protein extracted from the corneal tissues and cells were prepared by using RIPA (#P0013B, Beyotime) with a protease inhibitor (EMD Millipore, Billerica, MA, USA) and phosphatase inhibitors (50mM NaF and 100µM Na3VO4; #G2007, Servicebio, Wuhan, Hubei, China) on ice for 30 minutes. A total of 30µg protein were loaded on per channel of 10%-12.5% polyacrylamide gels and after electrophoresis, they were transferred to polyvinylidene difluoride (Whatman, United Kingdom). After blocking, the membranes were incubated with primary antibodies against Nrf2 (1:500; #A11159, ABclonal, Wuhan, Hubei, China), NF-κB P65 (1:1,000; #6956, Cell Signaling Technology), p-NF-κB pP65 (1:1,000; #3033, Cell Signaling Technology), IKBα(1:1,000; #T55026, Abmart, Shanghai, China), p-IKBα (1:2,000; #T55572, Abmart), KEAP1 (1:1,000; #8047, Cell Signaling Technology), IFNγ (1:200; #sc-8423, Santa Cruz, Dallas, Texas, USA), HO1 (1:1,000; #10701-1-AP, Proteintech, Wuhan, Hubei, China), SOD1 (1:500; #10269-1-AP, Proteintech) CAT (1:2,000; #21260-1-AP, Proteintech), TNFα (1:500; #17590-1-AP, Proteintech), IL-1β (1:500; #AF7209, Beyotime Biotechnology), Tubulin (1:5,000; #M30109, Abmart), and GAPDH (1:2,000; #GB15001, Servicebio) at 4°C overnight. After that, membranes incubated with secondary anti-rabbit/mouse antibodies (1:5,000; #926-32211/#926-32210, LI-COR Biosciences, Lincoln, NE, USA) for 1hour protected from light. Odyssey CX infrared laser imaging system (LI-COR Biosciences) was used to scan for pictures. The band intensity was estimated and analyzed by Image Studio Lite (Version 5.2.5) and ImgeJ (Version 2.0.0-rc-43/1.50e).
Quantitative PCR
EZ-press RNA purification Kit (Roseville, MN, USA) was used to extract total RNA. The primer sequences (Sangon Biotech, Shanghai, China) used are listed as fellow: human-Nrf2- F (5’- ATGTGGAGATCATTGAGCAGC- 3’), human-Nrf2- R (5’- CCTGGTCCTGTGTAGCCATT-3’); human- NF-κB- F (5’- TCAGCGACGGAAAGAGTATGA- 3’), human- NF-κB- R (5’- CCACTGGTTTCTGACTGGATGT- 3’).
Statistics analysis
Graphpad Prism 8 (Version:8.2.1) was used to perform statistical analyses and figures. All data was shwon as the mean ± SD, and one-way ANOVA analysis and t-tests were performed to determine statistically significant. P < 0.05 mean statistically significant.