Research Article
Metformin Regulates Autophagy to Attenuate Mitochondrial Dysfunction in High Glucose-stimulated H9C2 Cardiomyocytes via the AMPKα/Sirt1/Parkin Signaling Axis
https://doi.org/10.21203/rs.3.rs-2281485/v1
This work is licensed under a CC BY 4.0 License
posted
You are reading this latest preprint version
metformin
AMPK
Parkin
mitophagy
diabetic cardiomyopathy
Diabetic cardiomyopathy (DCM) refers to the occurrence of myocardial dysfunction in patients with diabetes in the absence of coronary artery disease, hypertension, valvular, or congenital heart disease (1, 2), which is a progressive, irreversible process that eventually leads to heart failure (3). Multiple mechanisms are involved in the pathogenesis of DCM, such as inflammation, cardiomyocyte apoptosis, mitochondrial dysfunction, oxidative stress, and autophagy deficiency (4). Among these, convincing evidence indicates that autophagy deficiency and mitochondrial dysfunction play crucial roles in the pathogenesis of DCM (5).
The mitochondria are important energy-generating organelles in cells. The biosynthesis and degradation of mitochondria continuously form a dynamic network to maintain the balance in mitochondrial quantity and quality (6), which are crucial for many cellular processes such as ROS signaling, calcium hemostasis, cell cycle, autophagy, and apoptosis (7). Mitophagy, a special type of macroautophagy, removes damaged mitochondria by targeting the lysosomes (8). Two pathways that are involved in mitophagy have been identified: Pink1/Parkin-dependent and Pink1/Parkin-independent (9). PINK1 is a serine/threonine kinase that is degraded in the mitochondria (10). When mitochondrial depolarization occurs, PINK1 aggregates in the mitochondrial outer membrane and activates Parkin, which ubiquitinates mitochondrial outer membrane proteins, such as voltage-dependent anion channel protein1/2/3 (VDAC1/2/3) and mitofusin-1/2 (MFN1/2) (11, 12). Consequently, LC3-1 is conjugated to phosphatidylethanolamine to transform LC3-II (13). Activated LC3-II accumulates on the autophagosomal membranes, fuses with lysosomes to form autolysosomes, and degrades dysfunctional mitochondria (14). PINK1/Parkin-independent mitophagy is mainly regulated by autophagy receptors in the mitochondrial outer membrane, including Bcl-2 interacting protein 3 (BNIP3), NIX, and Fun14 domain-containing 1 (FUNDC1) (15). These autophagy receptors have an Lc3-interacting region (LIR) that can bind to LC3-II and initiate a cascade reaction (16, 17).
Metformin is widely used in patients with type 2 diabetes because of its good hypoglycemic effect and relatively few side effects (18). A previous study showed that metformin could improve cardiac function in diabetic rats (19). Meanwhile, metformin can also promote autophagy and improve DCM by activating the AMPK pathway (20). However, there is no evidence that metformin is involved in the regulation of Parkin-dependent mitophagy in cardiomyocytes. Therefore, the purpose of the present study was to investigate the effect of metformin on mitophagy in cardiomyocytes treated with high amounts of glucose.
2.1 Culture of H9C2 cells
Embryonic rat heart-derived cardiac myoblast (H9C2) cardiomyocytes were obtained from Shanghai Zhong Qiao Xin Zhou Biotechnology Co. (ZQXZ, Shanghai, China). Cells were cultured in low-glucose Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA), containing 5.5 mmol/L glucose, supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco, USA) and 1% (v/v) penicillin-streptomycin (10,000 U/mL, Gibco, USA). Cultures were maintained in a humidified incubator at 37°C with 5% carbon dioxide. The culture medium was replaced every two days.
H9C2 cells were treated with high glucose (30 mM,) for 6, 12, 24, 48, or 72 h. For the high glucose group, H9C2 cells were exposed to high glucose for 48 h and co-treated with metformin (30 mM, MedChemExpress, USA) for 24 h, compound c (5 µM, AMPK inhibitor, MedChemExpress, USA) for 24 h, and EX-527 (1 µM, Sirt1 inhibitor, MedChemExpress, USA) for 24 h.
2.2 Short interfering RNA (siRNA) transfection
H9C2 cardiomyocytes were transiently transfected with AMPKα siRNA (#6620, Cell Signaling Technology, USA) and Sirt1 siRNA (#12241,Cell Signaling Technology, USA) using Lipofectamine 3000 Transfection Reagent (Invitrogen, USA) according to the manufacturer’s instructions. The cells were cultured in medium without penicillin-streptomycin. After 48 h of transfection, the cells were prepared for the subsequent experiments.
2.3 Western blot
Cells were lysed using radioimmunoprecipitation assay (RIPA, Beyotime, China) buffer. The supernatant of the lysate was collected and the protein concentration was determined using the bicinchoninic acid (BCA) method. The protein samples were then stored in a refrigerator at -80°C until further analysis. Proteins were separated via 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF, Millipore, USA) membranes. The membranes were blotted with specific antibodies: anti-Sirt1 (1:1000, #8469, Cell Signaling Technology, USA), AMPKα (1:1000, #5831, Cell Signaling Technology, USA), p-AMPKα (1:1000, #50081, Cell Signaling Technology, USA), Parkin (1:1000, #4211, Cell Signaling Technology, USA), and LC3-II (1:1000, #3868, Cell Signaling Technology, USA). The same membrane was stripped and re-blotted with an anti-GAPDH antibody (1:1000, #5174, Cell Signaling Technology, USA) as a loading control. After incubation with HRP-conjugated secondary antibodies (1:5000, Boster, China), the membranes were developed with SuperSignal West Dura Chemiluminescence Substrate (Thermo Fisher Scientific, USA) using the Bio Imaging System (Syngene, Frederick, MD, USA). The bands were semi-quantified via densitometry analysis.
2.4 qRT-PCR
The total RNA in cardiomyocytes was extracted using TRIzol (Thermo, USA) and reverse transcribed to cDNA. The mRNA concentrations were determined using the LightCycler480 System. GAPDH was used to normalize mRNA expression levels. Primers are listed in Table 1.
Target |
Forward primer |
Reverse primer |
---|---|---|
Sirt1 |
TCGGCTACCGAGGTCCATA |
ACAATCTGCCACAGCGTCAT |
Parkin |
GGGATTCAGAAGCAGCCAGA |
CAGCAAGATGGGCCCTGG |
LC3-II |
GAGGGGACCCTAACCCCATA |
TCGCTCTATAATCACCCGCC |
GAPDH |
ACCCTTAAGAGGGATGCTGC |
CCCAATACGGCCAAATCCGT |
2.5 Detection of ROS and mitochondrial membrane potential (ΔΨm)
Changes in ROS and mitochondrial membrane potential (ΔΨm) were detected using a DCFH-DA (Beyotime, China) and a JC-1 (Nanjing Jiancheng, China) assay, respectively. Cells were loaded with 10 µM DCFH-DA in FBS-free DMEM for 30 min at 37°C. After washing with PBS three times, the cells in phenol red-free DMEM were observed under an inverted fluorescence microscope. JC-1 was used to detect ΔΨm. H9C2 cells were treated with 5 µM JC-1 in phenol red-free DMEM containing 2% BSA for 30 min at 37°C. After washing, the cells in phenol red-free DMEM containing 0.25% BSA were illuminated with filter sets designed to detect rhodamine (540/570 nm) and filter sets designed to detect FITC (488/535 nm) using an inverted fluorescence microscope. Dual emission images represent signals from monomeric (green) and J-aggregate (red) JC-1 fluorescence in cells.
2.6 Analysis of mitophagy
The level of mitophagy was analyzed via immunofluorescence co-localization analysis. The translocase of outer mitochondrial membrane 20 (TOM20) is marked with red fluorescence, which represents mitochondria. LC3-II is labeled with green fluorescence, which represents the lysosomes. Determination of the level of mitophagy according to the co-localization coefficient.
2.7 Detection of apoptosis
The Annexin V-FITC/PI double staining apoptosis kit was purchased from Jingxin Biotechnology (Guangzhou, China). The level of apoptosis was analyzed via flow cytometry, according to the manufacturer’s instructions.
All data are represented as the mean ± standard deviation (SD) of at least three independent experiments and analyzed using GraphPad Prism 8.0 software. Statistical significance between groups was determined using one-way analysis of variance and the t-test. Statistical significance was set at p < 0.05.
3.1 Dynamic changes of mitophagy and mitochondrial function in high glucose-treated H9C2 cardiomyocytes
To investigate the effects of mitophagy in DCM, we first determined the expression of mitophagy-related proteins in H9C2 cells treated with high glucose (Fig. 1A-C). Western blot analysis showed that the levels of Parkin and LC3-II increased at 6 h and 12 h after high glucose treatment in H9C2 cells, then began to decrease gradually with continued high glucose challenge, and eventually it was lower than that in the control group after 48 h.
To assess the association between mitophagy and mitochondrial function, we next assessed the changes in intracellular ROS and mitochondrial membrane potential (ΔΨm) of H9C2 cardiomyocytes after high glucose stimulation (Fig. 1D and E). Intracellular ROS accumulated after treatment with high glucose (Fig. 1D). Mitochondrial depolarization is indicated by an increase in the green/red fluorescence intensity ratio in JC-1 staining. Consistently, the green/red fluorescence intensity ratio of JC-1 staining in H9C2 cardiomyocytes with high glucose stimulation was significantly increased compared to that in the control (Fig. 1E). These results indicated that exposure to a high amount of glucose could activate mitophagy in cardiomyocytes at an early stage to remove abnormal mitochondria, thus maintaining a relatively low level of ROS to prevent hyperglycemia-induced cell injury. With a continuous high glucose challenge, the level of mitophagy began to decrease, failing to clear up the damaged mitochondria in cells, leading to an increase in ROS, causing cell injury.
3.2 Metformin relieves high glucose-induced mitochondrial dysfunction and cell apoptosis through mitophagy in H9C2 cardiomyocytes
To investigate the effect of metformin on DCM, we treated cardiomyocytes cultured in a medium with high levels of glucose containing metformin and detected the mitochondrial function and homeostasis in these cells. As shown in Fig. 2, metformin significantly reduced intracellular ROS levels (Fig. 2A and B) and depolarized the mitochondria in H9C2 cardiomyocytes after high glucose stimulation (Fig. 2C). In addition, metformin prevented high glucose-induced cell apoptosis, as measured by Annexin V/PI staining in cardiomyocytes (Fig. 2D and E). Meanwhile, concomitant labeling of mitochondria (TOM20) and autophagosomes (LC3-II) was used to detect mitophagy in H9C2 cardiomyocytes. Immunofluorescence analysis showed that the co-localization of TOM20 and LC3-II was markedly decreased in cardiomyocytes treated with high glucose, while the application of metformin restored the activation of mitophagy (Fig. 2F).
Taken together, these findings demonstrate the protective effect of metformin against apoptosis in high glucose-induced cardiomyocytes, possibly by activating mitophagy and improving mitochondrial function.
3.3 Metformin regulates mitophagy through the AMPK/Sirt1/Parkin pathway in high glucose-treated H9C2 cardiomyocytes
To further explore the mechanism by which metformin improves mitochondrial homeostasis, we measured the expression of mitophagy-related proteins and their mRNA levels. Western blot analysis showed that metformin treatment in cardiomyocytes with 48 h of HG stimulation could rescue the expression of Parkin and LC3-II, accompanied by an increase in the expression of p-AMPKα and Sirt1 (Fig. 3A-E). We found that both the AMPK inhibitor (compound c) and Sirt1 inhibitor (EX-527) reduced the expression of p-AMPKα, Parkin, and LC3-II. In addition, the effects of metformin on mitophagy-related proteins were abolished when AMPKα or Sirt1 was inhibited (Fig. 3A-E). Additionally, immunofluorescence co-localization analysis revealed that metformin failed to activate mitophagy in H9C2 cardiomyocytes treated with high glucose after the inhibition of AMPK and Sirt1 (Fig. 3I). Similarly, the mRNA expressions of Parkin, LC3-II, and Sirt1 were increased after metformin treatment, and decreased after inhibition of AMPKα and Sirt1 (Fig. 3F-H). Together, these results provide evidence that the AMPK/Sirt1 pathway is involved in the regulation of mitophagy by metformin in cardiomyocytes treated with high glucose.
3.4 Knockdown of AMPKα and Sirt1 blocks the activation of metformin-induced mitophagy
To further confirm the effect of the AMPKα/Sirt1 pathway in the activation of mitophagy by metformin, we used siRNA to knockdown the expression of AMPKα and Sirt1. As shown in Fig. 4, the knockdown efficiency of both AMPKα and Sirt1 were about 50%, as observed via western blot analysis. The levels of Parkin and LC3-II decreased significantly after the knockdown of AMPKα or Sitr1. We have shown that metformin treatment can activate mitophagy in cardiomyocytes. However, metformin failed to enhance the expression of Parkin and LC3-II after silencing AMPKα (Fig. 4D and E). Of note, metformin upregulated the expression of Parkin and LC3-II mildly, although Sirt1 was knocked down (Fig. 4D and E). Collectively, our results confirmed that metformin can enhance the activation of mitophagy, partly through the AMPKα/Sirt1 signaling pathway.
One of the most important mechanisms of DCM is mitochondrial dysfunction, which lead to elevated ROS levels, the abnormal energy metabolism of cardiomyocytes, and increased apoptosis (5). Mitophagy can remove damaged mitochondria, reduce intracellular ROS, improve mitochondrial function, and reduce the incidence of apoptosis. Some studies have confirmed that mitophagy is activated in the early stages of DCM (21). The level of PINK1/Parkin-mediated mitophagy in the submandibular glands of patients with type 2 diabetes is also significantly increased (22). However, there are some contradictory results regarding the effects of mitophagy on DCM. Previous studies have shown that mitophagy is suppressed in the myocardium of diabetic rats, since the expressions of Pink1 and Parkin were decreased (23, 24). Moreover, studies have reported that the levels of Pink1 and Parkin decreased in the peripheral blood, heart, and renal tubules of patients with type 2 diabetes (25).
In the present study, we found that after 6 h of exposure to high levels of glucose, mitophagy was increased in H9C2 cardiomyocytes, while after 48 h of continuous high glucose stimulation, mitophagy was decreased, suggesting that mitophagy is a dynamic process in hyperglycemia. In the early stages of hyperglycemia, mitochondria begin to depolarize. Some autophagy receptors are recruited in the depolarized mitochondrial outer membrane, including Parkin, optineurin (OPTN), nuclear dot protein 52 (NDP52), and sequestosome 1 (p62/SQSTM1) (26). These autophagy receptors interact with the ATG8 protein family members to initiate mitophagy and clear damaged mitochondria (27). With a continuous stimulation at high glucose levels, elevated ROS and depolarized mitochondria hinder the process of oxidative phosphorylation and produce abundant ROS, which in turn damage the mitochondria, leading to a vicious cycle (3). High levels of ROS can lead to DNA breakage, protein damage, and the inhibition of mitophagy (28). Eventually, mitophagy began to decrease. In the later stages of hyperglycemia, mitophagy is not sufficient to remove the damaged mitochondria, resulting in the accumulation of a large number of dysfunctional mitochondria. The dysregulation of mitochondria and the disturbance of oxidative phosphorylation contribute to insufficient energy supply to the myocardium. Eventually, this results in a decrease in myocardial contractility. Mitochondrial dysfunction, oxidative stress, and disorders in energy metabolism lead to cardiomyocyte injury.
Metformin has a variety of myocardial protective functions, such as improving oxidative stress and reducing apoptosis (29, 30). To further verify the therapeutic effect of metformin on DCM, we performed an in vitro study and confirmed that metformin can activate mitophagy, reduce the levels of intracellular ROS, improve mitochondrial function, and reduce apoptosis. Several studies have shown that metformin can also activate mitophagy. In the peripheral blood mononuclear cells of patients with type 2 diabetes, metformin can reduce the level of oxidative stress by activating mitophagy (31). In chondrocytes, metformin activates mitophagy in osteoarthritis (32).
Our study also found that metformin can activate mitophagy, reduce intracellular ROS, and increase mitochondrial membrane potential, partly through the AMPKα/Sirt1 signaling pathway. AMPK interacts with Sirt1 to regulate autophagy. However, it remains controversial whether the activation of AMPK upregulates Parkin expression to promote mitophagy. Some studies have confirmed that AMPKα and Sirt1 can regulate PINK1/Parkin-mediated mitophagy in neurocytes, gliomas, and intervertebral disc nucleus pulposus cells (33–35). In skeletal muscle cells, the activation of AMPKα promoted mitophagy, but it did not change the expression of PINK1/Parkin (36). AMPKα activation promotes mitophagy in a PINK1-Parkin-independent manner by activating tank binding kinase 1 (TBK1) (37). In other words, in neurocytes, multiple types of tumor cells, and articular chondrocytes, the activation of AMPK can directly upregulate PINK1/Parkin, which accumulates on the outer mitochondrial membrane (OMM) and ubiquitinates mitochondrial outer membrane proteins, such as Mfn1/2 and VADCI, promoting the binding of these proteins to autophagy receptors (OPTN/P62/NDP52). Finally, this complex interacts with LC3-II to degrade mitochondria. Nevertheless, in skeletal muscle cells, activation of AMPK indirectly leads to the phosphorylation of mitochondrial fission factor (MFF) and the activation of dynamin-related protein 1 (Drp1), which promotes mitochondrial division. Damaged mitochondria are fragmented after division and are easily engulfed by lysosomes. AMPK activates the ULK1 complex indirectly by inhibiting the mammalian target of rapamycin (mTOR) and directly activating ULK1. The ULK1 complex then activates downstream receptors such as TBK1, which binds to autophagy receptors such as OPTN/p62, and finally initiates mitophagy.
In our experiment, metformin enhanced the expression of Parkin/LC3-II by activating AMPKα and Sirt1 in H9C2 cardiomyocytes under hyperglycemia, which could be blocked through the silencing or inhibition of AMPKα and Sirt1. Utilizing the co-localization of TOM20 and LC3-II, we further proved that metformin regulates mitophagy in cardiomyocytes through the AMPKα/Sirt1 pathway.
In summary, to the best of our knowledge, our study was the first to demonstrate that metformin activates mitophagy through the AMPKα/Sirt1/Parkin pathway in H9C2 cardiomyocytes. Metformin promotes mitophagy to clear damaged mitochondria, reduce the level of intracellular ROS, improve mitochondrial function, reduce apoptosis, counteract damage to cardiomyocytes caused by high glucose levels, and provide a protective effect on cardiomyocytes.
Funding
This work was supported by the Guangdong Basic and Applied Basic Research Foundation (A2022361 and 2020A1515010599),and the fostering of special funding projects of the National Natural Science Foundation of China in the Third Affiliated Hospital of SYSU (2021GZRPYQN11).
Competing Interests
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Availability of data and material
Not applicable
Code availability
Not applicable
Authors' Contributions
ZLZ and YSL contributed to the experimental studies, data acquisition, and drafted the manuscript; ZSH contributed to the data analysis; JLZ and QC contributed to statistical analysis; JLL and XXT contributed to the literature research and revised the manuscript; LP contributed to the study concepts, study design, and definition of intellectual content. All authors critically reviewed the manuscript and contributed to the content.
posted
You are reading this latest preprint version