Cell cultures and clinical samples
SV40 large T antigen-immortalized healthy human liver epithelial cell line, THLE-2 (ATCC, Manassas, VA) (11), was cultured in Airway Epithelial Cell Basal Medium (ATCC, Manassas, VA) with the Bronchial Epithelial Cell Growth Kit (ATCC PCS-300-040, Manassas, VA), supplemented with 70 ng/ml phosphoethanolamine, 5 ng/ml epidermal growth factor (EGF), 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/ml streptomycin (Euroclone, UK) at 37 °C with 5% CO2. Cells were maintained in pre-coated flasks with a collagen coating made of a mixture of 0.01 mg/ml fibronectin (Sigma-Aldrich, St Louis, MO, USA), 0.03 mg/ml bovine collagen type I (Advanced Biomatrix, San Diego region, California, USA), and 0.01 mg/ml bovine serum albumin (Sigma-Aldrich, St Louis, MO, USA).
The colorectal cancer cell lines SW480 (ATCC CCL-228) and SW620 (ATCC CCL-227) are isogenic cell lines derived respectively from pre-metastatic primary tumor and from lymph node metastasis. They were maintained in RPMI 1640 medium (Euroclone, UK) supplemented with 10% fetal bovine serum (FBS; Euroclone UK), 2mM L-glutamine (Euroclone, UK), 100 U/ml penicillin, and 100 µg/ml streptomycin (Euroclone, UK). Before using, FBS was ultracentrifuged for 105 min at 100,000× g in a Type 70 Ti, fixed angle rotor to eliminate bovine sEVs.
Small extracellular vesicles isolation from cell supernatant and plasma samples
The sSEVs were isolated from the conditioned culture medium of SW480 and SW620 cells maintained in the presence of EV-depleted FBS. The conditioned medium was collected after a culture period of 24h and then subjected to differential centrifugations followed by ultracentrifugation as previously described (12). Briefly, the conditioned culture medium was centrifuged for 5 min at 300×g, 15 min at 3,000×g and 30 min at 10,000×g; the supernatant was then ultracentrifuged for 105 min at 100,000×g in a Type 70 Ti, fixed angle rotor.
The sEVs were also isolated from plasma of CRC patients and healthy donors (Table 1) with Total Exosome Isolation Kit (Invitrogen) following the manufacturer’s instructions. Briefly, the plasma was centrifugated 20 min at 2000× g and 20 min at 10,000× g at room temperature (r.t.). The supernatant was mixed with 0.5 volume of 1X PBS and vortexed, then a 0.2 volume of Exosome Precipitation Reagent (from plasma) was added to the samples and vortexed again. The samples were incubated at r.t. for 10 minutes and centrifugated for 5 min at 10,000× g at r.t. The pellets of SEVs were resuspended in 1X PBS, and proteins content was determined by the Bradford assay (Pierce, Rockford, IL, USA). At the end of the isolation procedure, the SEV pellets obtained from both conditioned culture medium and plasma samples were resuspended in a range of 50-100 μl PBS, the sEV proteins were measured by the Bradford protein assay (Pierce, Rockford, IL, USA) (13) and sEV pellets were then stored at −80 °C until further use. Particles size distribution and concentration were measured by Nanoparticle Tracking Analysis (NTA) (NanoSight NS500) capturing 3 videos of 60 s per measurement. Each sEV aliquot with 1 µg/ml of protein content was properly diluted (1:5) and analyzed three times.
Small extracellular vesicle isolation from human biopsies
The sEVs were also isolated from CRC biopsy (CRC/B, Table 2) and from non-tumoral colorectal mucosa (Non-CRC biopsies: NCRC/B, Table 2) of a same patient using the protocol established previously by Crescitelli R. et al, (14) with minor modifications. The tissue pieces were gently sliced into small fragments (1–2 mm) and incubated with collagenase D (Roche, Basel, Switzerland) (2 mg/ml) and DNase I (Roche, Basel, Switzerland) (40 U/ml) dissolved in RPMI plain medium (St Louis, MO, USA) for 30 min at 37°C. After incubation, the samples were passed through a 70 µm filter. The resulting filtered liquid was centrifuged at 300 x g for 10 minutes, 2,000 × g for 20 minutes and ultracentrifuged at 16,500 × g for 6 minutes (TLA 100.3, k-factor: 404.5, Beckman Coulter, Miami, FL, USA) to remove cells, tissue debris and large EVs. The remaining supernatant was ultracentrifuged at 120,000 x g for 65 minutes (TLA 100.3, k-factor: 55.5, Beckman coulter) to pellet sEVs. The pellet was resuspended in PBS and further purified by a bottom-loaded Iodixanol density cushion (OptiPrepTM, Sigma-Aldrich, St Louis, MO, USA). Briefly, the sEVs were bottom-loaded by mixing 1 ml sample with 3 ml of 60% OptiPrepTM that was placed at the bottom of an ultracentrifuge tube. On top of this, 4 ml of 30% OptiPrepTM and 4 ml of 10% were carefully layered on top. The samples were then centrifuged at 97,000 × g for 2 hours (SW 41 Ti, k-factor: 265.1, Beckman Coulter, Miami, FL, USA). After centrifugation, the visible band containing the purified vesicles was collected from the 10%/30% interface (1.078 g/mL and 1.175 g/ml OptiPrepTM). To remove the contamination from OptiPrepTM, sEVs were further centrifuged at 120,000 x g for 65 minutes (TLA 100.3, k-factor: 55.5, Beckman coulter, Miami, FL, USA). Small EV proteins were estimated with the Qubit assay system (Thermo Fisher Scientific, Waltham, MA, USA) following manufacturer’s instructions.
Table 1 – Information about plasma samples from patients (P) with colon cancer and healthy controls (HS)
Plasma sample
|
Sex
|
Age
|
Disease status
|
Diagnosis
|
TNM-stage
|
Grading
|
|
P1
|
F
|
48
|
CRC
|
ADC
|
T3N0Mx
|
2
|
|
P2
|
M
|
75
|
CRC
|
ADC
|
T3N1aMx
|
2
|
|
P3
|
M
|
71
|
CRC
|
ADC
|
T3N0Mx
|
2
|
|
P4
|
M
|
74
|
CRC
|
ADC
|
T3N0Mx
|
2
|
|
P5
|
M
|
55
|
CRC
|
ADC
|
T3N2bMx
|
2
|
|
HS1
|
M
|
57
|
Absent
|
-
|
-
|
-
|
|
HS2
|
F
|
44
|
Absent
|
-
|
-
|
-
|
|
HS3
|
F
|
26
|
Absent
|
-
|
-
|
-
|
|
HS4
|
F
|
35
|
Absent
|
-
|
-
|
-
|
|
HS5
|
F
|
39
|
Absent
|
-
|
-
|
-
|
|
CRC: Colorectal Cancer; ADC: Adenocarcinoma
|
Table 2 - Information about biopsy samples of patients with CRC
Biopsy
|
Sex
|
Age
|
Diagnosis
|
TNM-stage
|
Grading
|
|
NCRC/B1
|
M
|
79
|
ADC
|
T3bN0Mx
|
3
|
CRC/B1
|
NCRC/B2
|
M
|
58
|
ADC
|
T3N2aMx
|
3
|
CRC/B2
|
CRC/B: Colorectal Cancer biopsy; NCRC/B: Non-Colorectal Cancer mucosa biopsy; ADC: Adenocarcinoma
|
|
Transmission electron microscopy (TEM)
TEM microscopy analyses were performed in two different labs depending on the origin of the processed samples. Since the used protocols presented some slight differences, we report both. Both of the sEV samples were negatively stained before acquisition.
1. For sEVs isolated from conditioned culture medium and plasma samples: sEVs were prepared for electron microscopy studies using negative staining. About 5μl of sEVs suspension was deposited onto the carbon-coated EM grids. After washing, the samples were fixed for 5 min in 1% glutaraldehyde and negatively stained with 2% aqueous solution of phosphotungstic acid. The grids were viewed in a JEM 1400 Plus electron microscope (Jeol, Japan) operating at 80 kV equipped with a CCD camera.
2. For sEVs isolated from tissue samples: investigation of sEVs by negative staining was performed as previously described (14). Briefly, 2.3 μg of sEVs was placed onto glow discharged 200-mesh formvar/ carbon copper grids (Electron Microscopy Sciences, Hatfield Township, PA). After two washes in H2O, sEVs were fixed in 2.5% glutaraldehyde. After two further washes in H2O, the samples were stained with 2% uranyl acetate for 1.5 min. Negative-stained samples were examined on a digitized Talos L120C electron microscope (Thermo Fisher Scientific) at 120 kV with a CCD camera.
Treatment of hepatocytes
After reaching sub-confluence, THLE-2 cells were treated for the indicated time points with about 1.5*E10 particles of sEVs derived from SW480 and SW620 cell lines corresponding to 20 μg/ml, the dose we found effective in our previous study (12). Thus, the same number of sEVs/ml was used for treating the THLE-2 cells with sEVs from plasma of healthy subjects and CRC patients, or from CRC and adjacent non-CRC biopsies. After treatment, the cells were harvested for real-time quantitative PCR, Western Blot or immunofluorescence analysis by confocal microscopy.
Lactate Dehydrogenase (LDH) Cytotoxicity Assay
THLE-2 cells were seeded into 12-well plates at 1×105 cells/well, 24h after seeding cells were treated with SW480 and SW620-derived sEVs (20 μg/ml). The conditioned media were collected after 24 and 48 hours of treatment and LDH assay was performed according to the instructions of the LDH-Glo™ Cytotoxicity Assay kit (Promega, Madison, WI, USA). The LDH-Glo Cytotoxicity Assay provides a simple bioluminescent method for quantifying lactate dehydrogenase (LDH) released into the culture medium upon plasma membrane damage. The generated luminescent signal is proportional to the amount of LDH present. Briefly, 50 µL of medium (diluted 1:100 in LDH Storage Buffer) were transferred into a 96-well plate in duplicate wells, and then 50 µL of LDH Detection Reagent were added to each well and incubated for 60 minutes at r.t. Finally, the luminescence was recorded using Glomax. The cytotoxicity was calculated using the following formula: LDH in treated cells /LDH in control cells.
Western Blot
THLE-2 cells or sEVs (from cells or plasma) were lysed using RIPA buffer with protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA, USA) (1:100 dilution) for 30 min on ice, then centrifuged at 18,800 × g for 15 min at 4 °C and. The extracted proteins were measured using Bradford protein assay (Pierce, Rockford, IL, USA). Proteins were separated on Bolt 4-12% Bis-Tris Plus precast polyacrylamide gels (Invitrogen by Thermo Fisher Scientific, Waltham, MA, USA), in reducing condition except for TGFβ1. Following electrophoresis, proteins were transferred to a Nitrocellulose Blotting Membrane (Amersham Protran Premium 0.45µm NC by GE HealthCare Life Science, Little Chalfont, Buckinghamshire, UK), blocked in 1% BSA and incubated with primary antibodies over night at 4°C. Primary antibodies used were as follows: anti-CD81 (1:1000 dilution; Santa Cruz Biotechnology, Dallas, TX, USA), anti-HSC70 (1:1000 dilution; Santa Cruz Biotechnology, Dallas, TX, USA), anti-Calnexin (1:1000; Santa Cruz Biotechnology, Dallas, TX, USA), anti-TGFβ1 antibody (1:300 dilution; Santa Cruz Biotechnology, Dallas, TX, USA), , anti-SMAD 2/3 (1:300 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-pSMAD 2/3 (1:300 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-SNAIL (1:300 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-SLUG (1:300 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-Vimentin (1:300 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-αSMA (1:300 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-CK8/18 (1:300 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-E-Cadherin (1:300 dilution; Cell Signaling), and anti-β actin (1:1000 dilution; Santa Cruz Biotechnology, Dallas, Tx, USA), anti-GAPDH (1:1000 dilution; Santa Cruz Biotechnology, Dallas, TX, USA) and anti-Tubulin (1:1000 dilution; Santa Cruz Biotechnology, Dallas, TX, USA). After washing with Tris-buffered saline +Tween 20 (TBS/T) three times, membrane was incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse secondary antibodies (1:1000 dilution; Thermo Fisher Scientific, Waltham, MA, USA) at r.t. for 1h. The protein bands were visualized by enhanced chemiluminescence (ECL™ Prime Western Blotting System Cytiva RPN2232) by using the Chemidoc imaging system (Biorad, Milan, Italy). GAPDH, Actin and tubulin were used as the loading control. Densitometric analysis of the Western Blot was performed by using the ImageJ software.
Real-Time PCR
Total RNA was extracted using illustraTM RNA spin mini-RNA isolation Kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Then, the cDNA was subjected to quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. The sequences of the used primers are reported in the Table 3. Real-time PCR was performed using Step OneTM Real time PCR System Thermal Cycling Block (Applied Biosystems, Waltham, MA, USA) in a 20 μl reaction containing 300 nM of each primer, 2 μl template cDNA, 18 μl 2X SYBR Green I Master Mix. The PCR was run at 95°C for 20 sec followed by 40 cycles of 95°C for 3 sec and 60°C for 30 sec. GAPDH was used as the endogenous control. Relative changes in gene expression between control and treated samples were determined using the ΔΔCt method.
Table 3 - Primers used in RT-PCR
Primers
|
Forward
|
Reverse
|
GAPDH
|
ATGGGGAAGGTGAAGGTCG
|
GGGTCATTGATGGCAACAATAT
|
ALB
|
GAGACCAGAGGTTGATGTGATG
|
GCCATCATCTTCTTTGACCCA
|
APOE
|
TGGCACTGGGTCGCTTTTGGG
|
TCATGGTCTCGTCCATCAGCGC
|
CYP3A4
|
AAGTCGCCTCGAAGATACACA
|
AAGGAGAGAACACTGCTCGTG
|
Albumin ELISA assay
The amount of albumin in the culture medium of THLE-2 cells treated with SW480 and SW620-derived sEVs was determined by human albumin ELISA kit (Abcam, Cambridge, UK). The ELISA assay was performed according to the manufacturer’s instructions.
Confocal fluorescent microscopy
At the end of the treatment cells were fixed by the addition with PAF 4%, permeabilized with 0.1% TritonX-100 and incubated for 1h at r.t. with primary antibodies: anti-HNF4 (1:50 dilution; Santa Cruz Biotechnology, Dallas, TX, USA), anti-CK8/18 (1:50 dilution; Cell Signaling Technology, Danvers, MA, USA), and anti-Vimentin (1:50 dilution; Cell Signaling Technology, Danvers, MA, USA). Unbound primary antibody was then removed, cells were washed with ice-cold PBS and incubated with DyLight 488 or Dylight 594 secondary antibody (1:500 dilution; Thermo Fisher Scientific, Waltham, MA, USA). Unbound secondary antibody was aspirated off, cells were washed with ice-cold PBS and nuclei were stained with Hoechst (Molecular Probes, Life Technologies, Carlsbad, CA, USA). In some cases, cells were stained with Actin Green (Thermo-fisher, Waltham, MA, USA) (1:125 dilution) to stain F-actin. Finally, the samples were analysed by confocal fluorescence microscopy (Nikon A1).
Super-resolution fluorescence microscopy
The sEVs prepared from SW480 or SW620 cells (1.8 x 107 or 3.5 x 107 particles, respectively) were immunolabeled overnight at 4°C using a cocktail of fluorescently labelled antibodies against CD9 (Atto488 mouse anti-human monoclonal; FL-REA-EV-CD9-Atto488, ONI), CD63 (Cy3BTM mouse anti-human monoclonal; FL-REA-EV-CD63-Cy3b, ONI), and TGFβ1 (Alexa Fluor®647 mouse anti-human monoclonal; IC10502R, R&D Systems). They were then loaded and captured on the surface of a PEG-Biotin functionalized microfluidic chip included in the EasyVisi Single-Extracellular Vesicle Characterization kit from ONI (beta version 1.0, Oxford Nanoimaging, UK). Surface preparation, removal of unbound antibodies, and crosslinking of sEVs to the chip surface, including all wash steps, were done using the EasyVisi kit and automated using a Roboflow microfluidic sample preparation platform (ONI). Direct stochastic optical reconstruction microscopy (dSTORM) imaging was then performed after freshly prepared BCubed STORM-imaging buffer (ONI) was added to each lane on the microfluidics chip. Single-molecule fluorescence data consisting of 2000 frames per channel, was sequentially acquired using the Nanoimager S Mark II with laser power set to 45, 50, and 50% for the 640, 560, and 488 lasers, respectively. An Olympus 1.4NA 100x oil immersion super apochromatic objective was used with angle of illumination set to 52.5°. Channel mapping was calibrated at the start of the imaging session using 0.1 µm Tetraspeck beads (#T7279, Thermo Fisher Scientific). Data was processed on NimOS software (version 1.18; ONI). To identify EV subpopulations that express one, two, or three markers, single-molecule data was analyzed using algorithms developed by ONI via their online localization microscopy data analysis platform beta-released named CODI (https://alto.codi.bio/, releases 0.16.0 to 0.14.1; March 9th to April 28th, 2021). The analysis workflow of sEV data included filtering, drift correction, and subsequent clustering using hierarchical density-based clustering algorithms for single-EV analysis.
Trypsin digestion of CRC_sEVs
Approximately 200 μg of isolated CRC_sEVs were re-suspended in a final volume of 0.5 ml of PBS with 0.125% trypsin (Corning, Manassas, VA) and incubated at 37oC for 15 minutes under agitation (31595182, 32731849). At the end of the reaction, the sEVs were diluted in 40 ml PBS and subjected to ultracentrifugation for 105 min at 100,000× g in a Type 70 Ti, fixed angle rotor. Finally, the pellet was resuspended in PBS and analysed by NTA to assess the integrity of sEVs after the treatment with trypisin and by ELISA assay to verify the TGFβ1 removal. Untreated CRC_sEVs were used as control.
TGFβ1 ELISA assay
The presence of TGFβ1 in trypsin-treated and untreated CRC_sEVs was determined by using TGFβ1 specific ELISA kit (Sigma-Aldrich, USA). The assay was performed using the same number of particles determined by the NTA. The ELISA assay was then performed according to the manufacturer’s instructions.
Statistical Analysis
Data are reported as mean ± standard deviation (SD) of biological replicates. Statistical analysis was performed using GraphPad Prism software 9.3 (GraphPad software, Inc, La Jolla, CA). The statistical significance of the differences was analysed using a two-tailed Student’s t-test. A p-value ≤0.05 was considered significant.