Antibodies and reagents
The β-actin (1:1000, 3700S) and p-Src Family (Tyr416) (E6G4R) (1:1000, #59548s) antibodies were purchased from Cell Signaling Technology (Cell Signaling Technology, Beverly, MA, USA). HSPB1(T55934S), p-HSPB1(TA3080S) Flag antibody (1:5000, M20008s) and HA (1:5000, M20003s) were purchased from Abmart (Abmart Pharmaceutical Technology Co, Ltd.). FYN (1:1000, sc-73388, sc-434) were purchased from Santa Cruz, Inc. (Santa Cruz Biotech.,USA).FYN(1:1000,ab184276,ab119855) were purchased from Abcam (Cambridge, UK). p-TOPK (Y272) antibody was prepared by Abiocode, Inc (shanghai, China). Rabbit (1:5000, GB21303) and mouse (1:5000, GB21301) antibodies were obtained from Servicebio, Inc. (Wuhan Servicebio Technology, Wuhan, China). We purchased OTS514 (Cat No. HY-18621) from MCE (MCE, China).
Cell Lines And Culture Condition
The human gastric cancer cell lines AGS, NCI-N87, KATO-III and Hs-746T and HEK293T cell lines were purchased from American Type Culture Collection (ATCC; Manassas, VA, USA). The normal cell line GES-1 were purchased from China Center for Type Culture Collection (CCTCC), SGC7901, MGC803 cell line were purchased from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The cell lines were cultured in DMEM ,1640 and F12K supplemented with 10% FBS at 37°C, 5% CO2.
Clinical Data
The study materials consisted of 54 cases of gastric cancer were obtained from Department of Gastrointestinal Surgery, The First Affiliated Hospital of Zhengzhou University. This study was performed with the permission of the ethical committee of the First Affiliated Hospital of Zhengzhou University(2021-KY-0374-002).
Preparation And Purification Of P-topk(Y272) Antibody
The preparation of p-TOPK(Y272) antibody was done by Shanghai Abiocode Biotechnology Co. Phosphorylated and non-phosphorylated peptides required for antibody purification were synthesized by Gill Biochemical (Shanghai) Co., Ltd. Antibody purification is done with the Thermo Fisher SulfoLink™ Peptide Immobilization Kit (Item No. 44999), according to the kit protocol.
Histopathology And Immunohistochemistry
Specimens were fixed in 10% formalin solution and embedded in paraffin wax. 4 µm serial sections were cut from the tissue blocks, deparaffinized in xylene, and hydrated in a series of alcohol (75%, 85%,95%, 100%), followed by antigen retrieval with EDTA. Tissue sections were then incubated with primary antibodies (FYN, TOPK and p-TOPK(Y272)). Subsequently, tissue sections were incubated with secondary antibody (Peroxidase-conjugated goat anti-rabbit Ig, ZB-2301, Zsbio, China; peroxidase-conjugated goat anti-mouse IgG, ZB-2305, Zsbio, China) for 2 h at room temperature, and then stained with DAB kit (ZL1 − 9018, ZSGB-BIO, China). After staining, sections were digitally scanned using the Aperio AT2 scanner (Leica Biosystems, Germany).
Plasmids And Shrna
TOPK mutants at Y74, Y272, or Y74Y272 (designated Y74F, Y272F, and FF) were performed with the QuikChange Mutagenesis Kit (Stratagene, Inc., La Jolla, CA, USA). The mutant plasmids were sent to Sangon Biotech, Inc. (Shanghai, China) for DNA sequencing. The plasmids pcDNA3-HA-TOPK and pcDNA3 were provided by our laboratory. pcFLAG-FYN-WT was purchased from Addgene (USA). Two shRNA sequences were designed to knockdown FYN. These sequences are: 1. 5′-CCGGGTGCCAACAATCCTAGTGCTTCTCGAGAAGCACTAGGATTGTTGGCACTTTTT-3′;2.5′-CCGGCTGGAGAGACAGGTTACATTCCTCGAGGAATGTAACCTGTCTCTCCAGTTTTTTG-3′. Two shRNA sequences were designed to knockdown TOPK. These sequences are:1.5′-CCGGGAAGTGTGGCTTGCGTAAATACTCGAGTATTTACGCAAGCCACACTTCTTTTTG-3′;2.5′-CCGGGGGAACTAGGCCACCTATTAACTCGAGTTAATAGGTGGCCTAGTTCCCTTTTTG − 3′.
Bacterial Expression And Purification Of The His-topk
PET-His-TOPK-WT and pET-His-TOPK-mutants were expressed in E. coli BL21 bacteria. Bacteria were grown at 37°C to an absorbance of 0.6–0.8 at 600 nm, induced with 1 mM isopropyl β-D-thiogalactopyranoside (IPTG) at 30°C for 4h. All proteins were purified using nickel-nitrilotriacetic acid agarose (Qiagen, Inc., Valencia, CA, USA) overnight at 4°C and eluted with 200 mM imidazole.
In Vitro Kinase Assay
The FYN active kinase and 10×kinase buffer were purchased from Millipore Corp. (Billerica, MA, USA). The inactive substrate (2 µg) and the active kinase (0.2 µg in a 30 µl reaction) were incubated at 37°C for 40 min in 1×kinase buffer containing 100 µmol/L unlabeled ATP or 1 µCi [γ-32P] ATP. The samples were added with 5×SDS buffer and then resolved by SDS-PAGE and visualized by autoradiography or Western blot.
Western Blot And Coimmunoprecipitation
Western blot and Coimmunoprecipitation
Cells (2 × 106) were seeded onto 10-cm-diameter dishes to 70–80% confluence and harvested in 200 µl RIPA buffer. The samples were separated on a 10% SDS-PAGE and subsequently transferred onto a PVDF membrane (Millipore, Billerica, MA, USA). Then antibody-bound proteins were detected by chemiluminescence (BIO-RAD, USA). Coimmunoprecipitation (CoIP) was performed using a CoIP Kit (Cat No.26147, Thermo Fisher Scientific, USA) according to the manufacturers instructions.
Confocal Laser Scanning Fluorescence Microscopy
MGC cells were fixed in methanol (− 20°C) and blocked in 5% normal goat serum at room temperature for 1 h. Then the cells were incubated overnight with the primary antibodies to detect TOPK and FYN at 4°C. On the second day, the cells were incubated for 1 h at room temperature with the Alexa Fluor 546 (red for FYN) or Alexa Fluor 488 (green for TOPK) conjugated secondary antibody while being protected from light. Colocalization of proteins was observed by laser scanning confocal microscopy (NIKON C1si Confocal Spectral Imaging System, NIKON Instruments Co., Japan).
Cell Viability Assay
Cell viability was determined using a cell counting kit-8 (CCK-8, Beyotime). Cells (5 · 103) were seeded in 96-well plates in Medium (100 ul) containing 10% FBS, and cultured overnight. After 24, 48, 72, and 96 h, CCK-8 solution (10ul) was added to each of the 96-well plates, and cultures were incubated for 90 minutes at 37°C. Absorbance at 450 nm was measured using an automatic microplate reader (BioTeke, Beijing, China).
Anchorage-independent Cell Transformation Assay
Cells were seeded at 8 × 103 cells/per well into 6-well plates and cultured in 1ml of 0.33% BME agar containing 10% FBS, with an additional 3ml of 0.5% BME agar containing 10% FBS below. After the cells were cultured in a 37°C, 5% CO2 incubator for 5–10 days, at which time colonies were observed by microscopy.
Wound Scratch Assay
The cells were seeded in six-well plates in Medium and supplemented with 10% FBS. After the cells formed a confluent monolayer, a scratch was created in the center of the monolayer using a sterile p200 pipette tip. Next, the medium was removed and the cells were washed with PBS. The cells were subsequently incubated on a serum-free medium. The ability of cells to close the wound was assessed by comparing the 0 ,24 ,48 hours phase-contrast micrographs of six marked points along the wounded area.
Cell Migration And Invasion Analysis
Migration and invasion abilities of transfected cells were evaluated via Transwell assay (8.0 µm pore size, 3422; Corning Incorporated, Corning, NY, USA). In brief, the lower chamber was coated by 600 µL Medium with 20% FBS, while 200 µL serum-free DMEM was added to the upper chamber. For invasion detection, Matrigel (356234, BD Bioscience, USA) at a concentration of 2 mg/mL was added to the upper chamber. Transfected cells were seeded to the upper chamber at a concentration of 5 × 104 cells/mL, and then the chamber was incubated for 24 h at 37℃ with 5% CO2. Later, the bottom chamber was fixed by 4% polyoxymethylene and stained with 0.01% Crystal Violet (Servicebio Technology Co., Ltd., Wuhan, China). Finally, the number of stained cells were counted under a microscope (DP74; Olympus Corporation, Tokyo, Japan). Six random views were selected for each sample.
In Vivo Study
Female BALB/c nude mice (4–6 weeks of age) were used for all experiments. BALB/c nude mice were purchased from Beijing Vital River Laboratory Animal Technology, Beijing, China. In addition, All nude mice were maintained in SPF conditions at the Department of Zhengzhou University Animal Center strictly according to the institution’s guidelines. All animal work in this study was approved by the Ethics Committee of the Zhengzhou University Health Science Center (2021051102).
For subcutaneous tumor formation experiments, 1× 107/200µL SGC7901 shmock or SGC7901 shFYN cells were digested and resuspended in sterilized PBS and then injected subcutaneously into BALB/c nude mice with 6 mice contained in each group. Tumor size was measured according to the formula: TV (mm3) = length × width2 × 0.5,after which tumors were excised and weighed. Finally, the tumors were harvested, photographed, and weighted. Sections were subjected to HE staining.
For the lung metastatic model, 1 × 106 SGC7901 shmock or SGC7901 shFYN cells (re-suspend with 100µl sterilized PBS) were injected into the nude mice by lateral tail vein (5mice/group). Four weeks after implantation, lung tissues were dissected, fixed, and paraffin-embedded for histopathological analysis.
Proteomic And Phosphoproteomic Analysis
shmock and shTOPK cell samples were sonicated three times on ice using a high intensity ultrasonic processor (Scientz) in lysis buffer (8 M urea, 1% protease inhibitor cocktail). Peptides were separated with a gradient of 2–60% acetonitrile in 10 mM ammonium bicarbonate pH 10 over 80 min into 80 fractions. The resulting MS/MS data were processed using MaxQuant search engine (v.1.6.15.0). Tandem mass spectra were searched against the human SwissProt database (20422 entries) concatenated with reverse decoy database.
Topk Knockout(Ko) Mice
WT and TOPK KO mice were presented by Professor Zhu Feng from the Cancer Research Institute, Affiliated Hospital of Guilin Medical University.
Statistical analysis
All quantitative experiments were performed in triplicate at minimum. Statistical analysis was performed using Graphpad prism8.0. Student’s t-test was used to evaluate the data. Times for OS were defined from treatment initiation to date of death or last follow-up. The correlation between the level of FYN, TOPK or p-TOPK(Y272) and OS were assessed by log-rank test. In all tests, differences were considered significant at P < 0.05.
Data And Materials Availability
The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD036814.The other datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.