Patients’ specimen collections
30 pairs of fresh GC cancer tissues and the corresponding adjacent gastric tissues were collected from the Department of Pathology, Affiliated Hospital of Inner Mongolia University. A total of 202 paraffin-embedded GC tissues and their corresponding adjacent gastric tissues were collected from the Department of Pathology, Affiliated Hospital of Inner Mongolia University between January 2013 and June 2015.
Each included patient signed the written informed consent before this study and surgery. And all included cases had corresponding clinical data and follow-up records with the follow-up rate as 100%. And none of the included patients received any prior radiotherapy or chemotherapy before sample collections.
Antibodies and Western Blotting
Total protein lysates from the fresh frozen tissues were extracted and quantified by commercial extraction kits (DE101, Transgen, Beijing, China) and BCA assay kits (PC0020, Solarbio, Beijing, China) according to manufacturer’s instructions.
The proteins lysates from GC tissues and corresponding adjacent tissues were individually resolved on SDS-PAGE gels (P1200, Solarbio, Beijing, China), transferred to polyvinylidene fluoride membranes (PVH00010, Millipore, Beijing, China) and immunoblotted at 4°C with a mouse polyclonal anti-GAPDH antibody(1:1000, CW0100, CWbio, Beijing, China) as loading controls and a rabbit polyclonal anti-SHCBP1 antibody (1:1000, Proteintech, 12672-1-AP, Wuhan, China) overnight. After rinsed with TBST solution for three times, these immunoblotted membranes were incubated with corresponding secondary antibodies (1:1000, CWbio, Beijing, China) at room temperature for 1 hour, visualized with enhanced chemilum inescence solution (ECL, W1001, Promega, Beijing, China) and recorded in ChampChemi (Beijing, China). The SHCBP1 protein expression levels of GC tissues and corresponding adjacent tissues were normalized to GAPDH and calculated by Image J.
Immunohistochemistry (IHC) analyses
According to the departments’ protocols, a total of 202GC tissue samples and corresponding adjacent tissue sample paraffin sections were deparaffinized with Van clear solution and rehydrated in graded ethanol (100-95-85-75%, each for 5 minutes), then washed with phosphate buffered saline solution (PBS, 0.01 M, pH 7.0). The following antigen retrieval was achieved by boiling under pressure for 15 minutes in fresh citrate buffer (0.01M, pH 6.0) with non-specific bindings blocked by incubation with 5% goat blocking serum (SL039, Solarbio, Beijing, China) in PBS for 60 minutes at 37℃. All paraffin sections were incubated with rabbit polyclonal anti-SHCBP1 antibody (1:300, 12672-1-AP, PROTEINTECH, Wuhan, China) and subsequently with goat anti-rabbit HRP secondary antibody (ZSGB-BIO, ZDR-5306, Beijing, China). For the color reaction, sections were incubated with DAB substrate chromogen solution (DA1010, Solarbio, Beijing, China) for 5 minutes at dark. Subsequently sections were counterstained with hematoxylin solution for 30 seconds. Immunostained sections were examined and scored by two independent pathologists under blinded experimental conditions according to intensity and percentage of SHCBP1 positive cells under light microscope (Axio imager A2, Zeiss).
The intensity of SHCBP1 positive cells was scored as follows: 0 (negative), 1 (slight positive), 2 (moderate positive), and 3 (strong intensity). The percentage of SHCBP1 positive cells was scored as follows: 0 (no cytoplasm expression), 1 (< 10% positive tumor cytoplasm), 2 (10–35% positive tumor cytoplasm), 3 (35–75% positive tumor cytoplasm), and 4 (76–100% positive tumor cytoplasm).
RNA extraction and real-time RT-PCR analyses
RT-PCR analyses of the collected fresh GC cancer tissues and corresponding adjacent tissue samples were performed to analysis the relative SHCBP1mRNA expression levels.
Total RNA from fresh GC cancer and adjacent normal tissues was extracted with TRIzol™ solution (79306, Invitrogen, Shanghai, China), and reversely transcripted to cDNA with commercial reverse kit (Prime Script™ RT reagent kit with gDNA Eraser, RR047A; TaKaRa, China) accordance to the manufacturer’s instructions, respectively.
The PCR primers for SHCBP1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as internal controls were as follows:
SHCBP1 forward, 5′-GCTACCGTGATAAACCAGGTTC-3′;SHCBP1 reversed, 5′-AGGCTCTGAATCGCTCATAGA-3′;GAPDH forward, 5′- TGACTTCAACAGCGACACCCA-3′;GAPDH reversed, 5′-CACCCTGTTGCTGTAGCCAAA-3′.
Then real time RT-PCR analyses were conducted by the SYBR Green RealTime PCR assay kit (TaKaRa, China) on a Thermo Pikoreal system. The relative SHCBP1 mRNA expression levels in GC tissues and these corresponding adjacent tissue samples were calculated by the 2-ΔΔCt method.
Comparison of SHCBP1 genes expression level in different cancers
The GEPIA (http://gepia.cancer-pku.cn/index.html) is a newly developed interactive web server to analysis the RNA sequencing expression data of 9,736 tumors and 8,587 normal samples from the TCGA and the GTEx projects with a standard processing pipeline.UALCAN (http://ualcan.path.uab.edu/index.html) is an interactive web resource to analysis different cancer transcriptome data, which was developed with in-house PERL (Practical Extraction and Report Language) program with high quality graphics using JavaScript and cascading style sheets (CSS)[32]. GEDS (http://bioinfo.life.hust.u.cn/web/GEDS/), is an integrative platform to compare the human gene expressions in cancer types, normal tissues and cell lines[33]. GENT2 (http://gent2.appex.kr/gent2/), is a platform for analyzing the gene expression patterns across normal and tumor tissues.
With the resource of GEPIA, GENT, UALCAN and GEDS, the expression patterns of SHCBP1 on different cancers were further analyzed. In addition, the SHCBP1 expression levels on ACC (adrenocortical carcinoma), LGG (brain lower grade glioma), LIHC (liver hepatocellular carcinoma), LUAD (lung adenocarcinoma), MESO (mesothelioma) and PAAD (pancreatic adenocarcinoma) patient survival were further analyzed based on the resource of UALCAN.
Cell culture
Human gastric cancer cell (GC) lines (MKN74 and AGS) were purchased from the Institute of Basic Medical Sciences of the Chinese Academy of Medical Sciences (Beijing, China). All cell lines were cultured with the growth medium as DMEM (41965062, Invitrogen, Shanghai, China) supplemented with 10% fetal bovine serum (FBS, 10270, Invitrogen, Beijing, China) and100 U/mL penicilin/strapmycin antibodies (P/S, 15070063, Invitrogen, Shanghai, China) at 37°C with 5% CO2.
Lentivirus-mediated RNA interference
An shRNA (5′-GCCCAAGAGCACACCTGTTAA-3′) targeting SHCBP1 with a nonsilencing scrambled shRNA (5′-TTCTCCGAACGTGTCACGT-3′) as a negative control were inserted into a super-silencing vector (pGLVH1/GFP + puromycin, GenePharma), respectively, followed by these recombinant lentivirus expressing SHCBP1 shRNA or scrambled shRNA (as Lv-SHCBP1and Lv-NC, respectively) were transfected into cells with stable SHCBP1-knockdown clones selection with puromycin (P8230, Solarbio, Beijing, China).
Cell proliferation assay
GC cells from different groups were pre-plated in 96-well plate (Corning) with 5×103 cells/per well and cultured at 37°C with 5% CO2 with growth medium. After 24, 48 and 72 hours after cell seeding, each well was added with 10 µL CCK-8 solution (CA1210, Solarbio, Beijing, China) and incubated at 37°C with 5% CO2 for 1 hours. At last, the density at 450 nm of 96-well plate was detected with Multiskan GO (Thermo Scientific).
Wound healing assay
The wound healing assay was used to measure the migration ability of GC cells. A wound was made by scratching with a plastic pipette tip followed by washed twice with PBS solution to remove cellular debris and nonadherent cells. Then the GC cells were incubated with growth medium for 24 hours.Cells migrated into the wounded empty space, and photographs were taken at 0 and 24 hours after wounding, respectively.
Transwell invasion assay
Transwell invasion assay were performed to analysis the invasion abilities of BC cells. Briefly, 2×103 GC cells, resuspend in serum-free medium, were seeded into the Transwell upper chambers, while the Transwell bottom chambers were filled with 600µL culture medium. After incubation for 24 h, GC cells on the upper surface of Transwell were completely removed by a cotton swab with the Transwell further fixed in methanol and stained with crystal violet according to the department’s protocols, subsequently, the number of GC cells migrated through the Transwell pores were recorded and quantified by Image J software.
EMT process analyses
Total RNA of GC cells from different groups was extracted with RNeasy plus Mini Kit (74134, QIAGEN, Beijing, China), respectively, followed by the relative gene expression analyses of EMT-TFs by RT-PCR. The primers of EMT-TFs were as follows:
E-cadherin
Forward-CCCTTCACAGCAGAACTAACA, Reversed-TTGGGTTGGGTCGTTGTA;
Vimentin
Forward-AATGACCGCTTCGCCAAC,
Reversed-CCGCATCTCCTCCTCGTAG;
ZEB-1
Forward-CCTGTCCATATTGTGATAGAGGC,
Reversed-ACCCAGACTGCGTCACATGT;
Snail
Forward-AGACGAGGACAGTGGGAAAG,
Reversed- AGATCCTTGGCCTCAGAGAG;
MMP-2
Forward- CTCATCGCAGATGCCTGGAA;
Reversed-CAGCCTAGCCAGTCGGATTTG;
MMP-9
Forward-d-GGATACCCGTCTCCGTGCT;
Reversed-GGATACCCGTCTCCGTGCT;
MMP-13
Forward- CCCTTGATGCCATTACCAGTC;
Reversed-TCCGCATCAACCTGCTGAG;
GAPDH
Forward-TGAACGGGAAGCTCACTG,
Reversed-GCTTCACCACCTTCTTGATG.
Statistical analysis
The expression levels of SHCBP1 mRNA in fresh GC cancer tissues and corresponding adjacent tissues were calculated by the Wilcoxon signed-rank nonparametric test. And Pearson’s χ2 were used to examine the correlations between SHCBP1 protein expression and clinic pathological parameters. Kaplan-Meier and log-rank test were performed to calculate the survival curves. Factors of prognostic significance in the univariate analysis were further analyzed by the model of multivariate Cox regression. For all tests in our study, P values less than 0.05 were considered significant. All statistical works were analyzed by the Statistical package for the social sciences software (SPSS, IBM, version19.0).