Overexpression of SHCBP1 predicts poor prognosis of gastric cancer

Abstract

Background

SHC SH2-domain binding protein 1 (SHCBP1) functions as an oncogene in different cancers. The effect pattern of SHCBP1 in gastric cancer (GC) tissues and the relationships between SHCBP1 expression and GC progression were explored in our study.

Methods

The expression of SHCBP1 in GC tissues and corresponding adjacent tissues was analyzed by immune histochemistry, Western blot and RT-PCR. With bioinformatics methods, the associations between the expression level of SHCBP1 and different cancer progression were also analyzed. In addition, the knockdown of SHCBP1 gene using shRNA transfection was applied to investigate the effect of SHCBP1 expressionon the proliferation, migration, invasion and epithelial to mesenchymal transition (EMT) capabilities of GC cells.

Results

The expression level of SHCBP1 mRNA was significantly increased in GC tissues compared with that of the adjacent tissues (P < 0.05). The expressions of SHCBP1 in GC tissues were associated with T stage and TNM stage. High SHCBP1 expression and TNM stage were independent factors to predict poor prognosis for GC patients.With the bioinformatics database, SHCBP1 could be treated as an oncogene of GC. And the in vitro study further confirmed that the knockdown of SHCBP1 expression in GC cells effectively suppressed the proliferation, migration, invasion and EMT capabilities of GC cells.

Conclusions

Our results indicate that SHCBP1 promote the metastasis of GC and could be served as potential prognostic marker and potential molecular target for GC therapy.

Introduction

Gastric cancer (GC), as a typical epithelium-originated malignant tumor with high mortality rates, is predominantly delayed due to the absence of early clinical symptoms and ineffective treatments for the advanced stage ^{[1, 2]}. With approximately 990 000 new cases diagnosed and more than 730,000 deaths annually, GC imposes a considerable public health burden throughout the world ^[3–5].

Due to these crucial advances of etiology and pathology of GC and promising improvements of therapeutic strategies in past decades^[6–9], the incidences and mortality of GC have significantly declined, however, the clinical outcomes of GC are still among the poorest of all solid tumors, predominantly due to the malignant presence of advanced stage disease with lymph node (LN) metastasis^[10], which is mainly involved with the epithelial to mesenchymal transitions (EMT) process^[11–15]. A comprehensive understanding of the molecular etiopathogenesis of GC involving EMT process will benefit the clinical treatments and the survival outcomes of GC patients.

As a dynamic and reversible process with epithelial cells transcriptional transformations with enhanced migration or invasion and down-regulated cell adhesion abilities during mammalian embryogenesis^{[16, 17]}, wound healing and carcinoma progression^[18] via pleiotropic signaling factors ^[19–23], EMT regulate the expressions of specific transcription factors as EMT-TFs (including E-cadherin,Snail, Zeb-1 and Twist) that promote the repression of epithelial features and induction of mesenchymal characteristics^[24], which enhanced the drug resistance abilities of cancer cells.

However, the absence of specific and reliable biomarkers of those above targeted therapy lead to unsatisfactory prediction of drug treatments. Consequently, it is an urgent need to investigate the specific mechanisms of GCr development and to identify novel treatment biomarkers.

Src homolog and collagen homolog (Shc), as one of specific cell surface receptors adaptor proteins, regulates the activities of growth factor receptorsin vivo, including insulin receptor (IR), insulin growth factor receptor (IGFR), epidermal growth factor receptor (EGFR)^[25] and fibroblast growth factor receptor (FGFR)^[26,27]. Recent studies demonstrated that SHC SH2-domain binding protein 1 (SHCBP1) as one of the partner of Shc family plays important roles in cell proliferation, migration, adhesion, and cell cycle progression, especially in the carcinogenesis in vivo^[28–31].

However, whether SHCBP1 is involved with GC invasion and metastasis in vivo, and the related mechanisms in vivo are still not clear. Thus, the expressions of SHCBP1 mRNA and protein in GC tissues were examined in our study, and the correlations between its expression levels with GC patients’ survival were assessed in our study. Furthermore, the correlations of SHCBP1 protein expression and GC progression were analyzed with bioinformatics analysis and in vitro cell culture models.

Results

Expression patterns of SHCBP1 mRNA in GC cancer tissues and adjacent tissues

The relative SHCBP1 mRNA expression levels in these included fresh cancer tissues and corresponding adjacent tissues were analyzed by qRT-PCR. And our results showed that the relative expression levels of SHCBP1 mRNA were significantly higher in the GC cancer tissues compared with these in the corresponding adjacent tissues (1.06 ± 0.18vs 0.52 ± 0.13, 2.04-fold, P < 0.001) (Fig. 1).

Discussion

As a heterogeneous disease that varies in histology, molecular alterations of tumor suppressor gene and oncogenes, clinical courses and responses to treatment of chemotherapy or radiotherapy, majority of GC are diagnosed in the advanced metastatic stage, resulting in dramatic decrease of patient survival. Understanding the molecular mechanism of GC is of critical importance for diagnosis and treatment.

Previous studies have uncovered that SHCBP1, mapped on a region of chromosome 16q11.2, acts as an oncogene by promoting cancer cell proliferation and tumorigenicity in vivo ^{[28, 29, 34]}. Here, we disclosed the significant association between elevated SHCBP1 expression patterns and GC progression. Similar to breast cancer, hepatocellular carcinoma, pancreatic cancer, penile cancer,esophageal squamous cell carcinoma and prostate cancer^[35–38], patients with higher SHCBP1 expression pattern had shorter overall survival time than those with lower or no SHCBP1 expressions, indicating that SHCBP1 represents an independent prognostic factor for GC patients.

SHCBP1 is known as a member of Shc family, which has been found to be important in the regulation of apoptosis and drug resistancein mammalian cells^[36,39,40]. Dysreglation of Shcs, leading to uncontrolled proliferation, is a characteristic of human cancers. SHCBP1 therefore may play a role in signaling pathways governing cellular proliferation, cell growth and differentiation.

In this study, the expression levels of SHCBP1 in GC tissues and the adjacent tissues were detected with the observations that both SHCBP1 mRNA and protein levels were significantly up-regulated in GC tissues in comparison with those of the adjacent tissues. In addition, high SHCBP1 protein was positively related with the poor overall survival for GC patients, which indicated that SHCBP1may be applied as an independent clinical marker in predicting unfavorable prognosis of GC patients.

In order to confirm the effect of SHCBP1 on the proliferation, migration and invasion potentials of GC cells, shRNA technology was applied to knock down the expression of SHCBP1 in MKN74 and AGS cells. Then CCK8 assay, wound healing assay and transwell assay were applied to evaluate the effect of knockdown of SHCBP1 on the migration and invasion potentials of MKN74 and AGS cells. We found that the migration and invasion potentials of MKN74 and AGS cells were effectively decreased after the reduction of SHCBP1 expression.

Moreover, we also found that the EMT process. EMT, as a dynamic and reversible process with epithelial cells losing polarities and down-regulatd cadherin-mediated cell adhesion, has been associated with human embryonic development^[16,17], wound healing and carcinoma progression^[18] via pleiotropic signaling factors including the transforming growth factor β (TGF β) family^[19], Wnt/β-catenin^[20], fibroblast growth factor (FGF) ^[21,22] and Sonic hedgehog (Shh)^[23]. The disregulations of ECM in the tumor microenvironments could also activate the process of EMT^[41], tumor invasion, and metastasis through EMT related transcription factors and pathways ^[41,42], which regulates the metastasis in malignant cancers by conferring invasive phenotypes and facilitating metastasis^[41]. And the increased EMT levels could promote the generation of cancer stem cells and contribute to therapy resistance in vivo ^[41]. However, the potential relationship between SHCBP1 and EMT process in GC progression needs further detailed investigations.

In conclusion, our data provide a comprehensive analysis of SHCBP1, which may be involved in the progress of GC. The study provides a set of useful targets for future investigation into the molecular mechanisms and biomarkers. Furthermore, our study showed that the dysregulation of SHCBP1 is correlated with GC clinical features and poor survival rates. SHCBP1 might serve as a novel therapeutic target for the treatment of GC cancer. Further study is needed to elucidate the in vivo effect and the downstream signaling pathway through which SHCBP1 functions in GC cancer.

Materials And Methods

Patients’ specimen collections

30 pairs of fresh GC cancer tissues and the corresponding adjacent gastric tissues were collected from the Department of Pathology, Affiliated Hospital of Inner Mongolia University. A total of 202 paraffin-embedded GC tissues and their corresponding adjacent gastric tissues were collected from the Department of Pathology, Affiliated Hospital of Inner Mongolia University between January 2013 and June 2015.

Each included patient signed the written informed consent before this study and surgery. And all included cases had corresponding clinical data and follow-up records with the follow-up rate as 100%. And none of the included patients received any prior radiotherapy or chemotherapy before sample collections.

Antibodies and Western Blotting

Total protein lysates from the fresh frozen tissues were extracted and quantified by commercial extraction kits (DE101, Transgen, Beijing, China) and BCA assay kits (PC0020, Solarbio, Beijing, China) according to manufacturer’s instructions.

The proteins lysates from GC tissues and corresponding adjacent tissues were individually resolved on SDS-PAGE gels (P1200, Solarbio, Beijing, China), transferred to polyvinylidene fluoride membranes (PVH00010, Millipore, Beijing, China) and immunoblotted at 4°C with a mouse polyclonal anti-GAPDH antibody(1:1000, CW0100, CWbio, Beijing, China) as loading controls and a rabbit polyclonal anti-SHCBP1 antibody (1:1000, Proteintech, 12672-1-AP, Wuhan, China) overnight. After rinsed with TBST solution for three times, these immunoblotted membranes were incubated with corresponding secondary antibodies (1:1000, CWbio, Beijing, China) at room temperature for 1 hour, visualized with enhanced chemilum inescence solution (ECL, W1001, Promega, Beijing, China) and recorded in ChampChemi (Beijing, China). The SHCBP1 protein expression levels of GC tissues and corresponding adjacent tissues were normalized to GAPDH and calculated by Image J.

Immunohistochemistry (IHC) analyses

According to the departments’ protocols, a total of 202GC tissue samples and corresponding adjacent tissue sample paraffin sections were deparaffinized with Van clear solution and rehydrated in graded ethanol (100-95-85-75%, each for 5 minutes), then washed with phosphate buffered saline solution (PBS, 0.01 M, pH 7.0). The following antigen retrieval was achieved by boiling under pressure for 15 minutes in fresh citrate buffer (0.01M, pH 6.0) with non-specific bindings blocked by incubation with 5% goat blocking serum (SL039, Solarbio, Beijing, China) in PBS for 60 minutes at 37℃. All paraffin sections were incubated with rabbit polyclonal anti-SHCBP1 antibody (1:300, 12672-1-AP, PROTEINTECH, Wuhan, China) and subsequently with goat anti-rabbit HRP secondary antibody (ZSGB-BIO, ZDR-5306, Beijing, China). For the color reaction, sections were incubated with DAB substrate chromogen solution (DA1010, Solarbio, Beijing, China) for 5 minutes at dark. Subsequently sections were counterstained with hematoxylin solution for 30 seconds. Immunostained sections were examined and scored by two independent pathologists under blinded experimental conditions according to intensity and percentage of SHCBP1 positive cells under light microscope (Axio imager A2, Zeiss).

The intensity of SHCBP1 positive cells was scored as follows: 0 (negative), 1 (slight positive), 2 (moderate positive), and 3 (strong intensity). The percentage of SHCBP1 positive cells was scored as follows: 0 (no cytoplasm expression), 1 (< 10% positive tumor cytoplasm), 2 (10–35% positive tumor cytoplasm), 3 (35–75% positive tumor cytoplasm), and 4 (76–100% positive tumor cytoplasm).

RNA extraction and real-time RT-PCR analyses

RT-PCR analyses of the collected fresh GC cancer tissues and corresponding adjacent tissue samples were performed to analysis the relative SHCBP1mRNA expression levels.

Total RNA from fresh GC cancer and adjacent normal tissues was extracted with TRIzol^™ solution (79306, Invitrogen, Shanghai, China), and reversely transcripted to cDNA with commercial reverse kit (Prime Script^™ RT reagent kit with gDNA Eraser, RR047A; TaKaRa, China) accordance to the manufacturer’s instructions, respectively.

The PCR primers for SHCBP1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as internal controls were as follows:

SHCBP1 forward, 5′-GCTACCGTGATAAACCAGGTTC-3′;SHCBP1 reversed, 5′-AGGCTCTGAATCGCTCATAGA-3′;GAPDH forward, 5′- TGACTTCAACAGCGACACCCA-3′;GAPDH reversed, 5′-CACCCTGTTGCTGTAGCCAAA-3′.

Then real time RT-PCR analyses were conducted by the SYBR Green RealTime PCR assay kit (TaKaRa, China) on a Thermo Pikoreal system. The relative SHCBP1 mRNA expression levels in GC tissues and these corresponding adjacent tissue samples were calculated by the 2^-ΔΔCt method.

Comparison of SHCBP1 genes expression level in different cancers

The GEPIA (http://gepia.cancer-pku.cn/index.html) is a newly developed interactive web server to analysis the RNA sequencing expression data of 9,736 tumors and 8,587 normal samples from the TCGA and the GTEx projects with a standard processing pipeline.UALCAN (http://ualcan.path.uab.edu/index.html) is an interactive web resource to analysis different cancer transcriptome data, which was developed with in-house PERL (Practical Extraction and Report Language) program with high quality graphics using JavaScript and cascading style sheets (CSS)^[32]. GEDS (http://bioinfo.life.hust.u.cn/web/GEDS/), is an integrative platform to compare the human gene expressions in cancer types, normal tissues and cell lines^[33]. GENT2 (http://gent2.appex.kr/gent2/), is a platform for analyzing the gene expression patterns across normal and tumor tissues.

With the resource of GEPIA, GENT, UALCAN and GEDS, the expression patterns of SHCBP1 on different cancers were further analyzed. In addition, the SHCBP1 expression levels on ACC (adrenocortical carcinoma), LGG (brain lower grade glioma), LIHC (liver hepatocellular carcinoma), LUAD (lung adenocarcinoma), MESO (mesothelioma) and PAAD (pancreatic adenocarcinoma) patient survival were further analyzed based on the resource of UALCAN.

Cell culture

Human gastric cancer cell (GC) lines (MKN74 and AGS) were purchased from the Institute of Basic Medical Sciences of the Chinese Academy of Medical Sciences (Beijing, China). All cell lines were cultured with the growth medium as DMEM (41965062, Invitrogen, Shanghai, China) supplemented with 10% fetal bovine serum (FBS, 10270, Invitrogen, Beijing, China) and100 U/mL penicilin/strapmycin antibodies (P/S, 15070063, Invitrogen, Shanghai, China) at 37°C with 5% CO₂.

Lentivirus-mediated RNA interference

An shRNA (5′-GCCCAAGAGCACACCTGTTAA-3′) targeting SHCBP1 with a nonsilencing scrambled shRNA (5′-TTCTCCGAACGTGTCACGT-3′) as a negative control were inserted into a super-silencing vector (pGLVH1/GFP + puromycin, GenePharma), respectively, followed by these recombinant lentivirus expressing SHCBP1 shRNA or scrambled shRNA (as Lv-SHCBP1and Lv-NC, respectively) were transfected into cells with stable SHCBP1-knockdown clones selection with puromycin (P8230, Solarbio, Beijing, China).

Cell proliferation assay

GC cells from different groups were pre-plated in 96-well plate (Corning) with 5×103 cells/per well and cultured at 37°C with 5% CO2 with growth medium. After 24, 48 and 72 hours after cell seeding, each well was added with 10 µL CCK-8 solution (CA1210, Solarbio, Beijing, China) and incubated at 37°C with 5% CO2 for 1 hours. At last, the density at 450 nm of 96-well plate was detected with Multiskan GO (Thermo Scientific).

Wound healing assay

The wound healing assay was used to measure the migration ability of GC cells. A wound was made by scratching with a plastic pipette tip followed by washed twice with PBS solution to remove cellular debris and nonadherent cells. Then the GC cells were incubated with growth medium for 24 hours.Cells migrated into the wounded empty space, and photographs were taken at 0 and 24 hours after wounding, respectively.

Transwell invasion assay

Transwell invasion assay were performed to analysis the invasion abilities of BC cells. Briefly, 2×10³ GC cells, resuspend in serum-free medium, were seeded into the Transwell upper chambers, while the Transwell bottom chambers were filled with 600µL culture medium. After incubation for 24 h, GC cells on the upper surface of Transwell were completely removed by a cotton swab with the Transwell further fixed in methanol and stained with crystal violet according to the department’s protocols, subsequently, the number of GC cells migrated through the Transwell pores were recorded and quantified by Image J software.

EMT process analyses

Total RNA of GC cells from different groups was extracted with RNeasy plus Mini Kit (74134, QIAGEN, Beijing, China), respectively, followed by the relative gene expression analyses of EMT-TFs by RT-PCR. The primers of EMT-TFs were as follows:

E-cadherin

Forward-CCCTTCACAGCAGAACTAACA, Reversed-TTGGGTTGGGTCGTTGTA;

Vimentin

Forward-AATGACCGCTTCGCCAAC,

Reversed-CCGCATCTCCTCCTCGTAG;

ZEB-1

Forward-CCTGTCCATATTGTGATAGAGGC,

Reversed-ACCCAGACTGCGTCACATGT;

Snail

Forward-AGACGAGGACAGTGGGAAAG,

Reversed- AGATCCTTGGCCTCAGAGAG;

MMP-2

Forward- CTCATCGCAGATGCCTGGAA;

Reversed-CAGCCTAGCCAGTCGGATTTG;

MMP-9

Forward-d-GGATACCCGTCTCCGTGCT;

Reversed-GGATACCCGTCTCCGTGCT;

MMP-13

Forward- CCCTTGATGCCATTACCAGTC;

Reversed-TCCGCATCAACCTGCTGAG;

GAPDH

Forward-TGAACGGGAAGCTCACTG,

Reversed-GCTTCACCACCTTCTTGATG.

Statistical analysis

The expression levels of SHCBP1 mRNA in fresh GC cancer tissues and corresponding adjacent tissues were calculated by the Wilcoxon signed-rank nonparametric test. And Pearson’s χ² were used to examine the correlations between SHCBP1 protein expression and clinic pathological parameters. Kaplan-Meier and log-rank test were performed to calculate the survival curves. Factors of prognostic significance in the univariate analysis were further analyzed by the model of multivariate Cox regression. For all tests in our study, P values less than 0.05 were considered significant. All statistical works were analyzed by the Statistical package for the social sciences software (SPSS, IBM, version19.0).

Declarations

Ethics approval and consent to participate

The investigations have been approved by the ethics committee of the Affiliated Hospital of Inner Mongolia University.

Consent for publication

Not applicable.

Availability of data and materials

We declared that materials described in the manuscript, including all relevant raw data, will be freely available to any scientist wishing to use them for non-commercial purposes, without breaching participant confidentiality.

Competing interests

The authors report no conflicts of interest in this work.

Funding

This work was supported by the Inner Mongolia Science and Technology Research Project (2021MS08093 and No. 2019LH08032), the Key technologies research and development program of Inner Mongolia (2021GG0170), the general Program of Inner Mongolia Medical University (YKD2021006), the 14th Five-Year Plan of Education Science in Inner Mongolia Autonomous Region (NGJGH2021307), the 14th Five-Year Plan of Science and Technology Innovation in Inner Mongolia Autonomous Region(No.2022YFSH0078), Zhiyuan Talent Program of Inner Mongolia Medical University (No.ZY0202020), Key project of Inner Mongolia Medical University (No.YKD2021ZD007). 

 Authors' contributions

Data curation, Hua Du, Haifeng Zhang,Wei Sun, Ling Hai,Xiaoyan Xu, Lixin Wen and Jingyuan Wang; Formal analysis,Hua Du, Yingxu Shi and Honggang Liu; Funding acquisition,Hua Du and Yingxu Shi; Investigation, Hua Du, Haifeng Zhang,Wei Sun, Ling Hai, Xiaoyan Xu, Lixin Wen and Yingxu Shi; Methodology,Hua Du,Yingxu Shi and Honggang Liu; Project administration, Yingxu Shi and Honggang Liu; Resources, Yingxu Shi and Honggang Liu; Supervision, Honggang Liu; Writing original draft, Yingxu Shi; Writing-review & editing,Yingxu Shi. All authors have read and approved the final manuscript.

References

1. Lianos GD, Rausei S, Ruspi L, et al. Laparoscopic gastrectomy for gastric cancer: current evidences. Int J Surg. 2014;12(12):1369-1373.
2. Pasechnikov V, Chukov S, Fedorov E, et al. Gastric cancer: prevention, screening and early diagnosis. World J Gastroenterol. 2014;20(38):13842-13862.
3. Smolińska M, Grzanka D, Antosik P, et al. HER2, NF-κB, and SATB1 Expression Patterns in Gastric Cancer and Their Correlation with Clinical and Pathological Parameters. Dis Markers. 2019;2019:6315936.
4. Sitarz R, Skierucha M, Mielko J, et al. Gastric cancer: epidemiology, prevention, classification, and treatment. Cancer Manag Res. 2018;10:239-248.
5. Ajani JA, Lee J, Sano T, et al. Gastric adenocarcinoma. Nat Rev Dis Primers. 2017;3:17036.
6. Goral V. Etiopathogenesis of Gastric Cancer. Asian Pac J Cancer Prev. 2016;17(6):2745-2750.
7. Digklia A, Wagner AD. Advanced gastric cancer: Current treatment landscape and future perspectives. World J Gastroenterol. 2016;22(8):2403-2414.
8. Moehler M, Delic M, Goepfert K, et al. Immunotherapy in gastrointestinal cancer: Recent results, current studies and future perspectives. Eur J Cancer. 2016;59:160-170.
9. Toomey PG, Vohra NA, Ghansah T, et al. Immunotherapy for gastrointestinal malignancies. Cancer Control. 2013;20(1):32-42.
10. de Boer M, van Dijck JA, Bult P, et al. Breast cancer prognosis and occult lymph node metastases, isolated tumor cells, and micrometastases. J Natl Cancer Inst. 2010;102(6):410-425.
11. Lee HH, Lee SH, Song KY, et al. Evaluation of Slug expression is useful for predicting lymph node metastasis and survival in patients with gastric cancer. BMC Cancer. 2017;17(1):670.
12. Jin JJ, Dai FX, Long ZW, et al. CXCR6 predicts poor prognosis in gastric cancer and promotes tumor metastasis through epithelial-mesenchymal transition. Oncol Rep. 2017;37(6):3279-3286.
13. Okubo K, Uenosono Y, Arigami T, et al. Clinical significance of altering epithelial-mesenchymal transition in metastatic lymph nodes of gastric cancer. Gastric Cancer. 2017;20(5):802-810.
14. Zhang X, Zhang P, Shao M, et al. SALL4 activates TGF-β/SMAD signaling pathway to induce EMT and promote gastric cancer metastasis. Cancer Manag Res. 2018;10:4459-4470.
15. Dong J, Wang R, Ren G, et al. HMGA2-FOXL2 Axis Regulates Metastases and Epithelial-to-Mesenchymal Transition of Chemoresistant Gastric Cancer. Clin Cancer Res. 2017;23(13):3461-3473.
16. Richter A, Valdimarsdottir L, Hrafnkelsdottir HE, et al. BMP4 promotes EMT and mesodermal commitment in human embryonic stem cells via SLUG and MSX2. Stem Cells. 2014;32(3):636-648.
17. Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial-mesenchymal transitions in development and disease. Cell. 2009;139(5):871-890.
18. Iwatsuki M, Mimori K, Yokobori T, et al. Epithelial-mesenchymal transition in cancer development and its clinical significance. Cancer Sci. 2010;101(2):293-299.
19. Katsuno Y, Lamouille S, Derynck R. TGF-β signaling and epithelial-mesenchymal transition in cancer progression. Curr Opin Oncol. 2013;25(1):76-84.
20. Ghahhari NM, Babashah S. Interplay between microRNAs and WNT/β-catenin signalling pathway regulates epithelial-mesenchymal transition in cancer. Eur J Cancer. 2015;51(12):1638-1649.
21. Tanaka T, Saika S, Ohnishi Y, et al. Fibroblast growth factor 2: roles of regulation of lens cell proliferation and epithelial-mesenchymal transition in response to injury. Mol Vis. 2004;10:462-467.
22. Shirakihara T, Horiguchi K, Miyazawa K, et al. TGF-β regulates isoform switching of FGF receptors and epithelial-mesenchymal transition. EMBO J. 2011;30(4):783-795.
23. Zhang J, Tian XJ, Xing J. Signal Transduction Pathways of EMT Induced by TGF-β, SHH, and WNT and Their Crosstalks. J Clin Med. 2016;5(4):41.
24. Yao L, Conforti F, Hill C, et al. Paracrine signalling during ZEB1-mediated epithelial-mesenchymal transition augments local myofibroblast differentiation in lung fibrosis. Cell Death Differ. 2019;26(5):943-957.
25. Chen Y, Long H, Wu Z, Jiang X, Ma L. EGF transregulates opioid receptors through EGFR-mediated GRK2 phosphorylation and activation. Mol Biol Cell. 2008;19(7):2973-2983.
26. Alam SM, Rajendran M, Ouyang S, Veeramani S, Zhang L, Lin MF. A novel role of Shc adaptor proteins in steroid hormone-regulated cancers. Endocr Relat Cancer. 2009;16(1):1-16.
27. Ornitz DM, Itoh N. The Fibroblast Growth Factor signaling pathway. Wiley Interdiscip Rev Dev Biol. 2015;4(3):215-266.
28. Feng W, Li HC, Xu K, et al. SHCBP1 is over-expressed in breast cancer and is important in the proliferation and apoptosis of the human malignant breast cancer cell line. Gene. 2016;587(1):91-97.
29. Peng C, Zhao H, Song Y, et al. SHCBP1 promotes synovial sarcoma cell metastasis via targeting TGF-β1/Smad signaling pathway and is associated with poor prognosis. J Exp Clin Cancer Res. 2017;36(1):141.
30. Peng C, Zhao H, Chen W, et al. Identification of SHCBP1 as a novel downstream target gene of SS18-SSX1 and its functional analysis in progression of synovial sarcoma. Oncotarget. 2016;7(41):66822-66834.
31. Tao HC, Wang HX, Dai M, et al. Targeting SHCBP1 inhibits cell proliferation in human hepatocellular carcinoma cells. Asian Pac J Cancer Prev. 2013;14(10):5645-5650.
32. Chandrashekar DS, Bashel B, Balasubramanya SAH, et al. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia. 2017;19(8):649-658.
33. Xia M, Liu CJ, Zhang Q, Guo AY. GEDS: A Gene Expression Display Server for mRNAs, miRNAs and Proteins. Cells. 2019;8(7):675.
34. Liu L, Yang Y, Liu S, et al. EGF-induced nuclear localization of SHCBP1 activates β-catenin signaling and promotes cancer progression. Oncogene. 2019;38(5):747-764.
35. Mo M, Tong S, Yin H, Jin Z, Zu X, Hu X. SHCBP1 regulates STAT3/c-Myc signaling activation to promote tumor progression in penile cancer. Am J Cancer Res. 2020;10(10):3138-3156.
36. Xu N., Wu Y. P., Yin H. B., et al. SHCBP1 promotes tumor cell proliferation, migration, and invasion, and is associated with poor prostate cancer prognosis[J].Journal of cancer research and clinical oncology,2020,146 (8):1953-69.
37. Ren C, Zhou Z, Wang X, et al. SHCBP1 Promotes the Progression of Esophageal Squamous Cell Carcinoma Via the TGFβ Pathway. Appl Immunohistochem Mol Morphol. 2021;29(2):136-143.
38. Yang C, Hu JF, Zhan Q, et al. SHCBP1 interacting with EOGT enhances O-GlcNAcylation of NOTCH1 and promotes the development of pancreatic cancer. Genomics. 2021;113(2):827-842.
39. Zou A, Wu A, Luo M, et al. SHCBP1 promotes cisplatin induced apoptosis resistance, migration and invasion through activating Wnt pathway. Life Sci. 2019;235:116798.
40. Zhang T, He X, Yu G, He Z. Downregulation of SHCBP1 Inhibits Proliferation, Migration, and Invasion in Human Nasopharyngeal Carcinoma Cells. Evid Based Complement Alternat Med. 2021;2021:8262502.
41. Kumar S, Das A, Sen S. Extracellular matrix density promotes EMT by weakening cell-cell adhesions. Mol Biosyst. 2014;10(4):838-850.
42. Wei SC, Fattet L, Tsai JH, et al. Matrix stiffness drives epithelial-mesenchymal transition and tumour metastasis through a TWIST1-G3BP2 mechanotransduction pathway. Nat Cell Biol. 2015;17(5):678-688.