A Functional SNP rs895819 on Pre-miR-27a is Associated with Bipolar Disorder by Targeting ICAM-1.

doi:10.21203/rs.3.rs-231475/v1

Download PDF

Article

A Functional SNP rs895819 on Pre-miR-27a is Associated with Bipolar Disorder by Targeting ICAM-1.

https://doi.org/10.21203/rs.3.rs-231475/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 04 Apr, 2022

Read the published version in Communications Biology →

Version 1

posted

You are reading this latest preprint version

Aberrant expression or genomic mutations of microRNA have been reported to be associated with a variety of human diseases. This study is aimed to analyze the association between genetic variations of miRNA and schizophrenia or bipolar disorder. We performed case-control studies for ten SNPs in a total sample of 1584 Chinese subjects. All these ten SNPs are on or near mature microRNAs which are expressed in the brain. To illustrate the function of miR-27a, we constructed a miR-27a knockout (KO) astrocytoma cell line U-251MG. By comparing the differentially expressed genes in wild-type and KO U-251MG, we determined several candidate target genes of miR-27a and then verified ICAM-1 as a target gene of miR-27a. We identified the association between the T/C polymorphism at rs895819 and bipolar disorder. Ectopic expression of miR-27a in NPCs showed that the T to C mutation at rs895819 reduced the suppressive effects of miR-27a on the expression of its target genes. Further studies revealed that the T/C polymorphism on miR-27a led to differential expression of mature and precursor miR-27a without affecting the expression of primary miR-27a. Our study highlighted the importance of miR-27a and its polymorphism at rs895819 in bipolar disorder.

Psychiatry

Medical Genetics

miR-27a

bipolar disorder

schizophrenia

CRISPR/Cas9

RNA-Seq analyses

target gene

ICAM-1

rs895819

neural progenitor cell.

Schizophrenia and bipolar disorder are two major types of psychiatric diseases. Despite the efforts dissecting the genetic causes of psychiatry [1], most analyses are complicated by environmental factors [2]. Besides the independent effects, genetic and environmental factors can interact to contribute to the occurrence and progression of psychiatric diseases [3]. For example, early life adversity can trigger genome-wide pathogenic changes in DNA methylation, which is a major risk factor for depressive disorder and schizophrenia [4]. A series of gene families can mediate the epigenetic response to environmental stresses including noncoding microRNA (miRNA) [5].

MiRNAs are a class of single stranded, evolutionarily conserved non-coding RNAs comprising of approximately 22 nucleotides. MicroRNAs modulate gene expression at post-transcriptional level by either repressing messenger RNA (mRNA) translation or selectively degrading mRNA [6]. Unlike mRNA, the maturation of miRNA requires both nuclear and cytoplasmic processing. MiRNAs biogenesis begins with the transcription of primary miRNA (pri-miRNA) by RNA polymerase II in the nuclei. pri-miRNA contains 5’ cap and poly (A) tail and are typically several kilobase long, encoding one or several precursor miRNA (pre-miRNA) [7]. DiGeorge syndrome critical region gene 8 (DGCR8) recognizes the stem-loop (hairpin) structure of pri-miRNA and renders it to RNase III enzyme Drosha [8]. Drosha cleaves on the stem of pri-miRNA, releasing the pre-miRNA which is composed of approximately 70 nucleotides with a hairpin structure [9]. Pre-miRNA is then transferred into cytoplasm and cleaved by another RNase III enzyme known as Dicer, resulting in the mature, double-stranded RNA duplex with 18–25 nucleotides [7]. Mature miRNA consists of an antisense or guide strand and a sense or passenger strand. The guide strand integrate with Argonaut (Ago) protein to form the RNA-induced Silencing Complex (RISC) [10]. RISC can interacts with the 3’ untranslated region (UTR) of a target mRNA via Watson-Crick pairing, leading to destabilization or translational repression of the target mRNA [11].

A considerable number of miRNAs are expressed in human brain [12] and are known to play important roles in various psychiatric diseases including depressive disorders [13], autism [14], anxiety and stress-related disorders [15], bipolar disorder and schizophrenia [16]. Importantly, miRNAs can act as epigenetic regulators in post-traumatic stress disorders [17, 18]. Drug treatments of psychiatric diseases are often found to be associated with altered expression of miRNA [19, 20]. These data strongly suggest genetic association between miRNA and psychiatric diseases.

In this study, we analyzed the association between genetic variations of miRNA and schizophrenia or bipolar disorder in the Chinese Han population. A single nucleotide polymorphism (SNP) of T/C at rs895819 in miR-27a was found to be associated with bipolar disorder. Using an miR-27a KO cell model, we identified several candidate target genes of miR-27a and verified ICAM1 as a target gene of miR-27a by western blotting and QPCR. Furthermore, we characterized the effects of T/C mutation on the expression of target genes and maturation of miR-27a.

2.1 Association study

In this study, we collected the samples from Chinese Han population in southern China. For each group of schizophrenia, bipolar disorder, and unrelated healthy individuals, 1584 subjects in total were analyzed. We genotyped the SNPs within the 300 bp region of mature miRNA and identified 457 SNPs in or near 307 miRNAs. The ten SNPs on schizophrenia or bipolar disorder susceptible loci with minor allele frequency larger than 0.05 (Table 1) was further investigated. We found that rs895819 on pre-miR-27a was associated with the incidence of bipolar disorder (p = 0.019, Table 2) but not with that of schizophrenia (Supplementary Table 2). In power calculations we found that the sample size had > 90% power for rs895819 to detect gene effect OR = 1.25 with ɑ ≤ 0.05. Therefore, we focused on rs895819 for further analyses.

Table 1

Identified SNPs in miRNA genes
rs number	microRNA	Chr.	Position	Allele frequency (CHB)
rs543412	hsa-mir-100	11	121528137	C:T = 0.636:0.364
rs12903401	hsa-mir-184	15	77289151	G:C = 0.411:0.589
rs2304608	hsa-mir-9-2	5	87998144	G:T = 0.542:0.458
rs629367	hsa-let-7a-2	11	121522224	C:A = 0.167:0.833
rs2910164	hsa-mir-146a	5	159844996	C:G = 0.444:0.556
rs895819	hsa-mir-27a	19	13808292	T:C = 0.689:0.311
rs107822	hsa-mir-219-1	6	33283553	A:G = 0.567:0.433
rs11614913	hsa-mir-196a-2	12	52671866	C:T = 0.489:0.511
rs1011784	hsa-mir-27b	9	96887835	C:G = 0.344:0.656
rs7372209	hsa-mir-26a-1	3	37985712	T:C = 0.322:0.678

Table 2

Allele-wise association analyses of SNP between bipolar disorder patients and healthy individuals
miRNA	SNP	Allele	OR	95% CI	P value^a	HWE P value for samples
hsa-mir-100	rs543412	C/T	1.024	0.862–1.217	0.786	0.66
hsa-mir-184	rs12903401	C/G	1.00	0.846–1.185	0.999	0.532
hsa-mir-9-2	rs2304608	A/C	1.137	0.960–1.347	0.136	0.629
hsa-let-7a-2	rs629367	A/C	1.216	0.993–1.489	0.058	0.374
hsa-mir-146a	rs2910164	C/G	1.044	0.879–1.240	0.625	0.157
hsa-mir-27a^b	rs895819	C/T	1.253	1.037–1.515	0.0197	0.87
hsa-mir-219-1	rs107822	C/T	0.982	0.824–1.171	0.842	0.803
hsa-mir-196a-2	rs11614913	C/T	1.065	0.899–1.261	0.466	0.116
hsa-mir-27b	rs1011784	C/G	0.922	0.776–1.097	0.361	0.267
hsa-mir-26a-1	rs7372209	C/T	1.005	0.837–1.208	0.954	0.15
Note:
a: P values calculated by χ2-test or Fisher’s exact test.
b: P value of < 0.5 is shown in bold and the risk allele is C.

2.2 Construction of miR-27a knockout astrocytoma cell line

It has been reported that the altered cell number and activity of astrocytes are associated with bipolar disorder [21]. Hence, in this study we investigated the potential targets of miR-27a in astrocytes. We chose U-251MG astrocytoma cells as our model cell line and used CRISPR/Cas9 system to generate miR-27a knockout U-251MG cells. A single guide RNA (sgRNA) targeted to the pre-miR-27a sequence was designed and delivered along with Cas9 nuclease to U-251MG cells using lentivirus (LVs). DNA sequencing analyses indicated successful gene editing at targeted genomic locus (Supplementary Fig. 1A). We isolated two single clones containing dual allelic gene modifications at pre-miR-27a site (Supplementary Fig. 1B) and chose clone 1 for further analyses.

2.3 RNA-Seq analyses

We performed whole transcriptome (RNA-Seq) analyses on three biological replicates of each wild-type (WT) and miR-27a knockout (KO) U-251MG cells. Cluster analyses of the sequenced samples suggested significantly altered gene expression profile (Supplementary figure. 2). In total, 681 significant differentially expressed genes (DEGs) were identified consisting of 215 (1.4%) up-regulated and 466 (3.0%) down-regulated genes respectively in miR-27a KO cells (Fig. 1A). Gene ontology (GO) analyses showed that miR-27a KO led to notable enrichment in development-related GO terms in biological process (BP) (Fig. 1B). For many of these GOs, enrichment was found in more than 20% of the genes within the same cluster (cluster frequency) (Fig. 1C), suggesting a critical role of miR-27a for developmental process. Enriched GO terms in cellular component (CC) are mostly plasma membrane or extra cellular matrix-related. In line with the enriched CC GO terms, enriched molecular function (MF) GOs include many ligand-receptor binding-related terms (Fig. 1D)

2.4 Identification of the target genes of miR-27a in U-251MG cells

We used a stringent 0.5 FPKM cutoff that generated a list of genes with significant base level expression and fewer false positives than a lower expression level threshold. To identify the potential target genes of miR-27a, we examined the DEGs in WT and miR-27a KO U-251MG cells in the RNA-Seq analyses and determined the top 10 genes with most up-regulated expression in the KO cells (Table 3). We then validated the mRNA expression of these genes in WT and miR-27a KO cells respectively using real-time quantitative PCR (RT-qPCR). Among the top 10 genes screened by RNASeq, except for PODXL2, the other 9 genes are all up-regulated, which means that the expression level of these genes in the knockout mutant is higher than that of the wild-type. Even 6 genes including TRIL, ICAM1 ,HECW1, ZNF542P and LINC02249 were found to have two-fold more expression in miR-27a KO cells (Fig. 2), suggesting that these 6 genes could be the potential target genes of miR-27a in U-251MG cells.

Table 3

Top 10 up-regulated genes in RNA-Seq analyses
Gene ID	Gene Name	Log₂(FKPM_KO/FKPM_WT)^a
ENSG00000002746	HECW1	Infinite	5.00E-5
ENSG00000255690	TRIL	Infinite	5.00E-5
ENSG00000225930	RP11	Infinite	0.0007
ENSG00000225930	LINC02249	5.91	0.00805
ENSG00000240225	NMNAT3	5.76	5.00E-5
ENSG00000114631	PODXL2	4.25	5.00E-5
ENSG00000090339	ICAM1	4.21	5.00E-5
ENSG00000157833	GAREM2	3.47	5.00E-5
ENSG00000204941	PSG5	3.41	5.00E-5
ENSG00000240225	ZNF542P	3.29	5.00E-5

Note:

^a FKPM > 0.5 at least in one group was used that generated a list of genes with significant base level expression and fewer false positives than a lower expression level threshold.

^b Genes have been filtered to have an adjusted P value of less than 0.01.

2.5 The effects of rs895819 polymorphism on target gene expression

To evaluate the effects of rs895819 mutation on the expression of target genes, we constructed mammalian expression plasmids containing WT (T) or mutant (C) miR-27a sequences (miR-27a-T and miR-27a-C) for ectopic expression. In order to realize the physiological relevance, we chose to perform the experiments in neural progenitor cells (NPCs). We transfected NPCs with miR-27a-T and miR-27a-C plasmids and then quantified the mRNA expression of the 6 candidate target genes as shown in Fig. 3 using RT-qPCR. Among the 6 genes that show two-fold more expression in miR-27a KO cells, all showed significantly higher expression with miR-27a-C (Fig. 3) except TRIL. These data validated several candidate target genes of miR-27a in NPCs and, more importantly, demonstrated that rs895819 polymorphism (T to C) could disrupt the inhibitory effects of miR-27a on the expression of its target genes.

2.6 The effects of rs895819 polymorphism on miR-27a expression

As rs895819 is located at the terminal loop of pre-miR-27a [22], the T to C mutation may affect the maturation process of miR-27a. We therefore determined the expression level of mature miR-27a in NPCs. It was found that mutant miR-27a exhibited significantly lower expression (Fig. 4A), indicating that the maturation process or the stability of miR-27a might be affected by rs895819 variation (T to C). To further elucidate the mechanism underlying decreased miR-27a level, we analyzed the expression of pri- and pre-miR-27a. Interestingly, pri-miR-27a-T and pri-miR-27a-C had similar expression level in NPCs whereas pre-miR-27a-C had significantly reduced expression compared to pre-miR-27a-T (Fig. 4B). These results suggested that T to C mutation at rs895819 affected the maturation of miR-27a from primary form to precursor form. The reduced expression of mature and precursor microRNA with the mutant miR-27a-C also explained the impaired inhibitory effects of miR-27a-C on the target genes.

2.7 ICAM-1 as a target of miR-27a

Among the 6 genes that show two-fold more expression in miR-27a KO cells, ICAM-1 was predicted as a target of miR-27a using Targetscan (Supplementary figure. 3). In miR-27a KO cell, the protein expression of ICAM-1 was significantly increased compared to U-251 wild type. (p < 0.01, Fig. 5A,5B). The relative expression of ICAM-1 was dramatically decreased by miR-27a mimic and increased by miR-27a inhibitor (p < 0.01, Fig. 5C). We found the expression of ICAM-1 was negatively regulated by miR-27a and thus we identified ICAM-1 as a target in U-251MG.

MiR-27a is associated with a broad range of human diseases. Aberrant expression or genetic mutations of miR-27a can lead to colorectal cancer (CRC) [23, 24], breast cancer [25–27], ovarian cancer [28], gastric cancer [29, 30] and many other cancer diseases. More importantly, single nucleotide polymorphisms (SNPs) of miR-27a at rs895819 have been found to be associated with high risk of CRC [31] and non-small cell lung cancer (NSCLC) [32] in the Chinese Han population. Hsa-miR-27a is considered as an oncogene, and its expression level is abnormal in many types of cancers. Interestingly, the C allele of rs895819 in our study was demonstrated as a risk allele for bipolar disease, but in cancer it was a protect allele [33]. This phenomenon might reflect a reasonable balance of evolutionary adaptation which would cause opposite effects in different diseases.

In the current study, we analyzed the association between genetic variations in microRNA and two psychiatric diseases including bipolar disorder and schizophrenia in the Chinese Han population. We found that T to C mutation at rs895819 of miR-27a was associated with bipolar disorder, but not with schizophrenia. In many researches, schizophrenia, and bipolar shared overlap susceptibility, however, they are not totally the same from phenotype to etiology. Franks et al found susceptible loci only for bipolar but not for schizophrenia in chromosome 19q13 [34]. Moreover, Izumi et al observed significant allelic association between several SNPs and bipolar disorder but not for schizophrenia or depression [35], which resembled with our association results. We believed that the differences in genetics between bipolar and schizophrenia could be clinically useful for distinguishing these two psychiatric diseases and might provide help for more specific treatment of different patient based on increasing genetic information.

In order to illustrate the role of rs895819 on Pre-miR-27a in bipolar disorder, we combined RNA seq and downstream functional experiments and then identified ICAM-1 as a target gene of miR-27a in U-251 MG. Intercellular adhesion molecule-1 (ICAM-1) is a transmembrane glycoprotein that is overexpressed in many pathological states [36, 37]. It is of particular interest in psychiatric disorders for two reasons: It has a key function for the blood-brain barrier, which plays an important role in the biology of psychiatric disorders, and it is a marker for inflammation [38]. High soluble ICAM (sICAM) levels were found during both the depressed and the manic states and also during the euthymic phase in bipolar disorder [39].

RNA-Seq and RT-qPCR analyses of a miR-27a KO cell model validated ICAM-1 in human astrocytes and NPCs. Although both astrocytes [21] and NPCs [40] play critical roles in bipolar disorder, aberrant neuron functions have also been hypothesized to be related with bipolar disorder [41]. Therefore, in the future studies it may be important validate the identified target genes of miR-27a in primary or derived neurons. It was found in the ectopic expression experiment that suppression of target genes by miR-27a was dependent on the nucleotide (T or C) at rs895819. The impaired function of miR-27a with C allele could be due to the reduced binding to target mRNA, or reduced stability or expression of miR-27a. To discriminate the effects of T to C mutation, we analyzed the expression of mature miR-27a and found that miR-27a-T had significantly higher expression than miR-27a-C in NPCs. This indicated that T to C mutation at rs895819 affected the stability or expression of miR-27a. We then examined the expression of pri- and pre-miR-27a. Interestingly, T to C mutation decreased the expression of precursor miR-27a without disrupting the expression of pri-miR-27a. Rs895819 is located at the terminal loop of pre-miR-27a and this loop structure is known to be critical for Drosha processing during microRNA maturation [42]. Hence, our observation of reduced expression of pre- but not pri-miR-27a is likely to be attributed to the disrupted maturation process from primary to precursor microRNA. Subsequently, the expression of miR-27a is inhibited and thus its target gene expression of ICAM1 is elevated. This is consistent with high soluble ICAM-1 level found in bipolar disorder. According to the recent studies, reduced expression of hsa-miR-27a-3p in CSF of patients with Alzheimer disease were reported [43]. Kondo et. al found the associations of serum miR-27a with cognitive function in a Japanese population [44]. Moreover, miR-27a is located in chromosome 19q13, one susceptible locus for bipolar disorder [34]. Thus, all these provides evidence to support hypothesis of miR-27a involvement in etiology of bipolar disorder (Fig. 6).

The current study has some limitations. First, we did not correct the number of tests performed thus potentially increasing the risk of false positive. In addition, we had not successfully constructed the KO model of miR-27a in NPC instead of glioblastome cell line U-251MG, though we eventually verified ICAM-1 as the target gene of miR-27a in this cell line. In the future studies, it would be also interesting to examine the effects of rs895819 mutation (T to C) on the interactions between miR-27a and DGCR8 or Drosha.

4.1 Study Population

We recruited 1,584 patients from southern China, including 528 schizophrenia patients with a mean age of onset at 47.3 ± 13.4 (52.3% male), 528 bipolar disorder patients with a mean age of onset at 41.1 ± 12.8 (55.3% male) and 528 unrelated healthy individuals with a mean age of 42.72 ± 13.1 (43.6% male) as the control group. Schizophrenia and bipolar disorder patients were diagnosed on the basis of DSM-III-R criteria [45]. Each patient was assessed by at least two psychiatrists independently according to the case records and interviews. A standard informed consent was signed by each participant and reviewed and approved by the Shanghai Ethical Committee of Human Genetic Resources.

4.2 SNP selection

Since SNPs on or near the pre-miRNAs are more likely to influence the generation and function of mature miRNAs, we chose to analyze the SNPs within the 300 bp sequence of mature miRNA. Candidate miRNA genes were identified from three different ways: (1) the databases of miRBase version 18.0 and Hapmap Phase III were downloaded; according to miRBase version 18.0 data, the genomic location of miRNA genes was determined; by searching SNPs in or near miRNA genomic region according to Hapmap Phase III data then, we found 457 SNPs on or near (within 300bp) 307 miRNA genes; (2) we utilized data of SNPedia miRNA project to find known SNPs near or on miRNAshttp://www.snpedia.com/index.php/SNPedia_microRNA_project; (3) we searched in PUBMED database by using the keywords "microRNA", "brain", “CNS”, "bipolar", "schizophrenia", “psychiatry” to find miRNAs which had been reported to be expressed in the brain and may play functional roles in psychiatric diseases. Finally, we chose 10 SNPs located in psychiatry susceptible loci, whose minor allele frequency was larger than 0.05 in Chinese Han population. (Table 1).

4.3 Genotyping and power calculation

Genomic DNA was extracted from peripheral blood lymphocytes using phenol-chloroform method. Selected SNPs were genotyped by TaqMan® SNP Genotyping Assays (Applied Biosystems, Foster City, CA) on ABI PRIM 7900 Sequence Detection Systems. The results were then analyzed by SDS 2.2 software (Applied Biosystems) for allelic discrimination. Allele deviations were assessed using Hardy Weinberg equilibrium (HWE) and the differences of allele and genotype frequencies between cases and controls were compared using SHEsis [46]. Three models were constructed using R program. Homozygote (1/1) and heterozygote (1/0) risk allele were coded as 2 and 1, respectively and homozygote non-pathogenic allele (0/0) were coded as 0. The dominant model was defined as 1/1 + 1/0 versus 0/0 and the recessive model as 1/1 versus 1/0 + 0/0. Power calculations were post-hoc calculations performed on the G*Power 3.0 program[47]. All reported P-values were two-tailed and statistical significance was defined as p < 0.05.

4.4 Plasmids and cells

LentiCRISPRv2 backbone plasmid was purchased from Addgene (#52961). sgRNA targeted to pre-miR-27a was designed (gtggctaagttccgcccccc) and cloned into LentiCRISPRv2 using Esp 3I (Thermofisher Scientific, Waltham, CA, USA) digestion as described [48] and this plasmid was referred to as lenti-CRISPR-miR-27a thereafter. For overexpression experiments, pri-miR-27a sequences containing T (wild type) and C (mutant) at rs895819 were cloned into pcDNA 3.1(+) under the control of CMV promoter.

U-251MG cell line was purchased from the BeNa Culture Collection and cultured in DMEM (Thermofisher Scientific) supplemented with 10% FBS (Thermofisher Scientific), 100 IU/mL of penicillin and 100 µg/mL of streptomycin at 37°C in a fully humidified atmosphere containing 5% CO2. U-251MG cells were verified prior to use by Saily Bio (Shanghai, China). Neural progenitor cells (NPCs) were purchased from ATCC (ACS-5003) and cultured in STEMdiff neural progenitor medium (STEMCELL Technologies, BC, Canada) at 37°C in a fully humidified atmosphere containing 5% CO2.

4.5 Cell line construction

Lentivirus carrying Cas9 and sgRNA was produced by transfecting 293T cells with lenti-CRISPR-miR-27a plasmid along with two helper plasmids pMd2.G (Addgene #12259) and psPAX2 (Addgene #12260) using lipofectamine 3000 (Invitrogen, CA, USA). At 72 h post transfection, the supernatant containing the lentivirus was harvested, filtered, and stored at -80 ºC for further application. U-251MG cells were infected with a MOI of 0.3 and selected using puromycin as described [49]. At 7 days after puromycin selection, gene modification was verified by DNA sequencing. Single clones carrying edited miR-27a sequence were isolated by limited dilution and genotyped by DNA sequencing. The primers for the PCR amplification of miR-27a are listed in Supplementary Table 1.

4.6 RNA-Seq analyses

WT and miR-27a knockout U-251MG cells were harvested with three biological replicates in each group. Total RNA was extracted using Trizol reagent (Invitrogen, CA, USA). Whole-transcriptome sequencing was performed and analyzed by Vazyme Biotech (Nanjing, Jiangsu, China). RNA-Seq short reads were aligned to the human genome (GRCh38) using HISAT [50] with a maximum of two mismatches. On average, approximately 55.5 million reads across all samples were aligned to the reference, accounting for 96.5% of the total reads. Gene expression was counted as the number of short reads fully or partially aligned to the annotated gene model and was presented as expected number of Fragments Per Kilobase of transcript sequence per Millions base pairs sequenced (FPKM). Expressed genes were defined as genes with more than ten reads in total mapped in all samples and at least two of three replicates having more than two reads each. In total, 15,406 genes met the criteria and were defined as expressed in both WT and miR-27a KO U-251MG libraries. Differentially expressed genes (DEGs) were identified using the CuffDiff module in CuffLink program [51] and are normalized to the library size between samples. P-values were adjusted for multiple testing using false discovery rates [52]. Significant DEGs were identified with an FDR ≤ 0.05 and a log2 (fold change) ≥ 1. Gene Ontology (GO) enrichment analyses was performed using Gorilla [53] by comparing the up/down-regulated DEGs to a list of all expressed genes. Significant GO terms with FDR ≤ 0.05 were reported.

4.7 RT-qPCR analyses of candidate miR-27a targets

The total RNA of WT and miR-27a KO U-251MG was extracted using Trizol reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. One microgram of RNA was transcribed into cDNA using random primers and the SuperScript™ III First-Strand Synthesis System (Invitrogen, Massachusetts, USA). RT-qPCR was performed using the resulting cDNA templates and the GoTaq® qPCR Master Mix (Promega) in an Applied Biosystems 7900 Real-Time PCR Cycler (Applied Biosystems). Primers for RT-qPCR were designed by Beacon Designer 7.01 (www.premierbiosoft.com). The RT-qPCR data were analyzed using SDS software (Applied Biosystems). GAPDH or U6 small nuclear RNA (snRNA) were used as internal control for mRNA and microRNA, respectively.

4.8 Transfection

MiR-27a mimic/inhibitor and their negative control (NC) were all purchased from Shanghai GenePharma Co. Ltd (Shanghai, China). We utilized Lipofectamine RNAiMAX reagent (Invitrogen, USA) to transfect miR-27a mimic/inhibitor or their corresponding control into U-251MG cells according to the protocol provided by the manufacturer. MiR-27a mimic and inhibitor at two doses (30pmol, 90pmol) were used to up-regulate or down-regulate miR-27a expression. Then we investigated the relative mRNA expression of candidate target genes compared with negative control using QPCR technology.

4.4 Western Blotting

The miR-27a knockout mutant constructed on the U-251MG cell line and wild-type were plated in 6-well plates at a density of 3 × 105 cells/mL and U-251MG were treated with mir-27a mimics and inhibitor using RNAiMAX at the indicated concentrations. Cells were collected after 72h, washed with cold 1× PBS, and lysed in 1× SDS buffer containing protease inhibitor cocktails (HY-K0010, MCE). Protein in cell lysate was quantified by detergent compatible Bradford assay kit (no. 23246, Thermo). Primary antibodies used in this study include ICAM1 antibody (ab53013, abcam) and β-actin (#4970, Cell Signaling Technology). The Millipore immobilon Western chemiluminescence substrate was used for signal development. Blots were imaged in an Amersham Imager 600 (GE Healthcare). The gray values of the bands were quantified by ImageJ software. The expression of β-actin was used as an internal control.

4.10 Overexpression of WT and mutant miR-27a in NPCs

The NPCs were counted and seeded on to 6 cm dish to reach a confluency of 80% on the day of transfection. The medium was replaced with Opti-MEM medium (Gibco) at 1 h before transfection. Transfection was performed with 5 µg miR-27a overexpression plasmid for each well using lipofectamine 3000 (Invitrogen). At 4 h after transfection, the medium was replaced with complete medium and incubated in 37°C. After 20 h, the NPCs were detached by ACCUTASE (STEMCELL Technologies) and collected by centrifugation at 1000 rpm for 5 min for further analyses.

4.11 Statistical analyses

All experimental data were presented as means ± standard deviation (S.D.). Two-tailed Student’s t tests (T-test) were used to evaluate differences between groups. ANNOVA tests were used to evaluate the significance of differences among three or more groups All data were representative of an average of three independent experiments and significant differences were indicated as * p < 0.05;** p < 0.01;*** p < 0.001.

To the best of our knowledge, our study first revealed the potential role of miR-27a rs895819 in bipolar disorder. Although SNPs at rs895819 have been reported in the Chinese Han population, most of the existing studies are related to A/G polymorphism. Nevertheless, in this study we identified T/C polymorphism at rs895819 and discovered the association between miR-27a and bipolar disorder by targeting ICAM-1. Taken together, our results highlighted the critical role of rs895819 polymorphism for the expression and function of miR-27a, which also suggested a critical role of miR-27a in bipolar disorder.

Data Availability Statement: Data is contained within the article and Supplementary Materials.The NGS gene analysis data were deposited in the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo), under the accession code SRP146080.

Conflict of interest

The author declare no conflict of interest

Acknowledgements

This study was supported by Natural Science Foundation of China (No. 31600686, to Jia Liu), National Key Technology PD Program (2016YFC1201701, to Lin He) and Natural Science Foundation of Shanghai (20ZR1436800, to Yifeng Yang)

Sullivan, PF, Agrawal, A, Bulik, CM, Andreassen, OA, Borglum, AD, Breen, G, et al. . Psychiatric genomics: an update and an agenda. Am J Psychiatry.2018; 175: 15-27.
Bortolato, B, Kohler, CA, Evangelou, E, Leon-Caballero, J, Solmi, M, Stubbs, B, et al.. Systematic assessment of environmental risk factors for bipolar disorder: an umbrella review of systematic reviews and meta-analyses. Bipolar Disord 2017; 19: 84-96.
Rogers, J, Renoir, T, and Hannan, AJ. Gene-environment interactions informing therapeutic approaches to cognitive and affective disorders. Neuropharmacology.2017;145:37-48
Hoffmann, A, Sportelli, V, Ziller, M, and Spengler, D. Epigenomics of major depressive disorders and schizophrenia: early life decides. Int J Mol Sci 2017;18.
Hollins, SL, and Cairns, MJ . MicroRNA: Small RNA mediators of the brains genomic response to environmental stress. Prog Neurobiol 2016;143: 61-81.
Vannini, I, Fanini, F, and Fabbri, M. Emerging roles of microRNAs in cancer. Curr Opin Genet Dev 2018;48: 128-133.
Lee, Y, Jeon, K, Lee, JT, Kim, S, and Kim, VN. MicroRNA maturation: stepwise processing and subcellular localization. EMBO J 2002;21: 4663-4670.
Gregory, RI, Chendrimada, TP, and Shiekhattar, R . MicroRNA biogenesis: isolation and characterization of the microprocessor complex. Methods Mol Biol.2006; 342: 33-47.
Han, J, Lee, Y, Yeom, KH, Kim, YK, Jin, H, and Kim, VN. The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev .2004;18: 3016-3027.
Gregory, RI, Chendrimada, TP, Cooch, N, and Shiekhattar, R. Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell 2005;123: 631-640.
Siomi, H, and Siomi, MC. On the road to reading the RNA-interference code. Nature 2009;457: 396-404.
Sun, E, and Shi, Y. MicroRNAs: Small molecules with big roles in neurodevelopment and diseases. Exp Neurol 2015;268: 46-53.
Hu, Z, Jiang, Y, Huo, X, Yang, Y, Davies, H, Botchway, BOA, et al. Prospective role of microRNAs in depression. Curr Med Chem 2017;24: 3508-3521.
Fregeac, J, Colleaux, L, and Nguyen, LS . The emerging roles of MicroRNAs in autism spectrum disorders. Neurosci Biobehav Rev. 2016;71: 729-738.
Malan-Muller, S, and Hemmings, SM. The big role of small RNAs in anxiety and stress-related disorders. Vitam Horm.2017; 103: 85-129.
Luoni, A, and Riva, MA. MicroRNAs and psychiatric disorders: From aetiology to treatment. Pharmacol Ther 2016; 167: 13-27.
Giridharan, VV, Thandavarayan, RA, Fries, GR, Walss-Bass, C, Barichello, T, Justice, NJ, et al. Newer insights into the role of miRNA a tiny genetic tool in psychiatric disorders: focus on post-traumatic stress disorder. Transl Psychiatry.2016; 6: e954.
Daskalakis, NP, Provost, AC, Hunter, RG, and Guffanti, G. Noncoding RNAs: stress, glucocorticoids, and posttraumatic stress disorder. Biol Psychiatry 2018;83: 849-865.
Rong, H, Liu, TB, Yang, KJ, Yang, HC, Wu, DH, Liao, CP, et al. MicroRNA-134 plasma levels before and after treatment for bipolar mania. J Psychiatr Res 2011;45: 92-95.
Chen, H, Wang, N, Burmeister, M, and McInnis, MG. MicroRNA expression changes in lymphoblastoid cell lines in response to lithium treatment. Int J Neuropsychopharmacol. 2009;12: 975-981.
Peng, L, Li, B, and Verkhratsky, A. Targeting astrocytes in bipolar disorder. Expert Rev Neurother 2016; 16: 649-657.
Shi, D, Li, P, Ma, L, Zhong, D, Chu, H, Yan, F, et al. A genetic variant in pre-miR-27a is associated with a reduced renal cell cancer risk in a Chinese population. PLoS One. 2012; 7: e46566.
Bao, Y, Chen, Z, Guo, Y, Feng, Y, Li, Z, Han, W, et al. Tumor suppressor microRNA-27a in colorectal carcinogenesis and progression by targeting SGPP1 and Smad2. PLoS One 2014;9: e105991.
Ba, S, Xuan, Y, Long, ZW, Chen, HY, and Zheng, SS. MicroRNA-27a promotes the proliferation and invasiveness of colon cancer cells by targeting SFRP1 through the Wnt/beta-catenin signaling pathway. Cell Physiol Biochem 2017;42: 1920-1933.
Mertens-Talcott, SU, Chintharlapalli, S, Li, X, and Safe, S. The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res 2007;67: 11001-11011.
Mertens-Talcott, SU, Noratto, GD, Li, X, Angel-Morales, G, Bertoldi, MC, and Safe, S. Betulinic acid decreases ER-negative breast cancer cell growth in vitro and in vivo: role of Sp transcription factors and microRNA-27a:ZBTB10. Mol Carcinog 2013;52: 591-602.
Kong, LY, Xue, M, Zhang, QC, and Su, CF. In vivo and in vitro effects of microRNA-27a on proliferation, migration and invasion of breast cancer cells through targeting of SFRP1 gene via Wnt/beta-catenin signaling pathway. Oncotarget 2017;8: 15507-15519.
Lai, Y, Zhang, X, Zhang, Z, Shu, Y, Luo, X, Yang, Y, et al. The microRNA-27a: ZBTB10-specificity protein pathway is involved in follicle stimulating hormone-induced VEGF, Cox2 and survivin expression in ovarian epithelial cancer cells. Int J Oncol ; 2013;42: 776-784.
Zhou, L, Liang, X, Zhang, L, Yang, L, Nagao, N, Wu, H, et al. MiR-27a-3p functions as an oncogene in gastric cancer by targeting BTG2. Oncotarget 2016;7: 51943-51954.
Wu, F, Li, J, Guo, N, Wang, XH, and Liao, YQ. MiRNA-27a promotes the proliferation and invasion of human gastric cancer MGC803 cells by targeting SFRP1 via Wnt/beta-catenin signaling pathway. Am J Cancer Res 2017;7: 405-416.
Jiang, Y, Lin, DH, Xu, JP, Chen, WX, Zheng, SJ, and Song, L. Genotype GG of rs895819 functional polymorphism within miR-27a might increase genetic susceptibility to colorectal cancer in Han Chinese population. J Clin Lab Anal 2016;30: 351-355.
Ma, JY, Yan, HJ, Yang, ZH, and Gu, W. Rs895819 within miR-27a might be involved in development of non small cell lung cancer in the Chinese Han population. Asian Pac J Cancer Prev 2015;16: 1939-1944.
Yang, RX, Schlehe B, Hemminki, K, Sutte,C and Burwinkel, B. A genetic variant in the pre-miR-27a oncogenen is associated with a reduced familial breast cancer risk. Breast Cancer Research and Treatment.2010;121: 693-702
Francks, C, et al. Population-based linkage analysis of schizophrenia and bipolar case-control cohorts identifies a potential susceptibility locus on 19q13. Molecular Psychiatry 2010;15: 319-325.
Izumi, A, et al. Genetic Variations of Human Neuropsin Gene and Psychiatric Disorders: Polymorphism Screening and Possible Association with Bipolar Disorder and Cognitive Functions. Neuropsychopharmacology 2008; 33: 3237-3245.
Springer TA. Adhesion receptors of the immune system. Nature. 1990;346(6283):425-34.
Lawson C, Wolf S. ICAM-1 signaling in endothelial cells. Pharmacol Rep. 2009;61(1):22-32.
Muller N. The Role of Intercellular Adhesion Molecule-1 in the Pathogenesis of Psychiatric Disorders. Front Pharmacol. 2019;10:1251.
Pantovic-Stefanovic M, Petronijevic N, Dunjic-Kostic B, et al. sVCAM-1, sICAM-1, TNF-alpha and IL-6 levels in bipolar disorder type I: Acute, longitudinal and therapeutic implications. World J Biol Psychiatry. 2018;19(sup2):S41-S51.
Papadima, EM, Niola, P, Melis, C, Pisanu, C, Congiu, D, Cruceanu, C, et al. Evidence towards RNA binding motif (RNP1, RRM) protein 3 (RBM3) as a potential biomarker of lithium response in bipolar disorder patients. J Mol Neurosci 2017; 62: 304-308.
Steullet, P, Cabungcal, JH, Bukhari, SA, Ardelt, MI, Pantazopoulos, H, Hamati, F, et al. The thalamic reticular nucleus in schizophrenia and bipolar disorder: role of parvalbumin-expressing neuron networks and oxidative stress. Mol Psychiatry.2017; 23:2057-2065.
Zeng, Y, Yi, R, and Cullen, BR. Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. EMBO J 2005;24: 138-148.
Sala Frigerio C, Lau P, Salta E, Tournoy J, Bossers K, Vandenberghe R, Wallin A, Bjerke M, Zetterberg H, Blennow K, De Strooper B. Reduced expression of hsa-miR-27a-3p in CSF of patients with Alzheimer disease.Neurology. 2013 ;81(24):2103-6.
Kondo M, Yamada H, Suzuki K. Associations of serum microRNA-20a, -27a, and -103a with cognitive function in a Japanese population: The Yakumo study. Arch Gerontol Geriatr. 2019 May-Jun;82:155-160.
Raine, A. The SPQ: a scale for the assessment of schizotypal personality based on DSM-III-R criteria. Schizophr Bull. 1991;17: 1991; 555-564.
Shi, YY, and He, L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005;15: 97-98.
Faul F., Erdfelder E., Lang A.-G., Buchner A. G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behavior Research Methods. 2007;39:175–191. doi: 10.3758/BF03193146
Sanjana, NE, Shalem, O, and Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. 2014; Nat Methods 11: 783-784.
Joung, J, Konermann, S, Gootenberg, JS, Abudayyeh, OO, Platt, RJ, Brigham, MD, et al. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc 2017;12: 828-863.
Kim, D, Langmead, B, and Salzberg, SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods.2015; 12: 357-360.
Trapnell, C, Williams, BA, Pertea, G, Mortazavi, A, Kwan, G, van Baren, MJ, et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 2010;28: 511-515.
Benjamini, Y, and Hochberg, Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Statist Soc B .1995;57: 289-300.
Eden, E, Navon, R, Steinfeld, I, Lipson, D, and Yakhini, Z . GOrilla: a tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics 2009;10: 48.

There is NO Competing Interest.

SIYangetalmiR27a0210new.doc
Supplementary Figures and tables

Download PDF

Journal Publication

published 04 Apr, 2022

Read the published version in Communications Biology →

Version 1

posted

You are reading this latest preprint version

A Functional SNP rs895819 on Pre-miR-27a is Associated with Bipolar Disorder by Targeting ICAM-1.

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Results

3. Discussion

4. Materials And Methods

5. Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1