Lncrna HOXD-AS1 Functions As A Cerna To Promote Hepatocellular Carcinoma Metastasis In Zebrafish Xenograft Models

doi:10.21203/rs.3.rs-232919/v2

Download PDF

Research Article

Lncrna HOXD-AS1 Functions As A Cerna To Promote Hepatocellular Carcinoma Metastasis In Zebrafish Xenograft Models

https://doi.org/10.21203/rs.3.rs-232919/v2

This work is licensed under a CC BY 4.0 License

Version 2

posted

You are reading this latest preprint version

Recent studies have suggested that long noncoding RNA (lncRNA) HOXD cluster antisense RNA 1 (HOXD-AS1) plays an important role in hepatocellular carcinoma (HCC) metastasis as a competing endogenous RNA (ceRNA). However, there is no in vivo evidence supporting this. Employing zebrafish HCC xenograft as an in vivo metastasis model, we aim to verify the role of ceRNA network of HOXD-AS1 in HCC metastasis. The quantitative reverse transcription PCR (qRT-PCR) assay was used to assess the expression level of HOXD-AS1 in HCC cell lines. Knockdown of HOXD-AS1 or miR-130a-3p was performed by transfecting small interfering RNA (siRNA) or microRNA (miRNA) inhibitor, respectively. The proliferation and migration of HCC cells in vitro were analyzed by CCK-8 and transwell assays. The growth and metastasis of HCC cells in vivo were assessed by zebrafish xenograft models. We verified that HOXD-AS1 was overexpressed in all tested HCC cell lines compared to the normal hepatic cells. Silence of HOXD-AS1 suppressed cell proliferation and migration in Hep3B and Huh7 HCC cell lines, respectively. In zebrafish xenograft models, knockdown of HOXD-AS1 also reduced the growth and metastasis of the two HCC cells. Downregulation of miR-130a-3p rescued the metastasis which inhibited by silence of HOXD-AS1 in vitro and in vivo. Moreover, HOXD-AS1 knockdown enhanced the inhibition effect of oxaliplatin for HCC progression in vitro and in vivo. Our study demonstrates the pro-metastastic role of the HOXD-AS1/miR-130a-3p ceRNA network in HCC cells, and provides evidence that HOXD-AS1 may serve as a biomarker and potential therapeutic target for HCC metastasis.

HOXD-AS1

Zebrafish xenograft

ceRNA

miR-130-3p

Metastasis

HCC

As the third most common cause of cancer-related death worldwide, HCC has an incidence of approximately 800,000 new cases annually [1]. Although different innovative therapeutic strategies are employed for HCC treatment, the survival rate of HCC patients is still poor [2, 3]. It is mainly due to the high rates of recurrence and metastasis after surgical resection. The metastatic HCC cells to other parts of the body are the prominent cause of cancer-related death 4]. To better understand the underlying mechanisms of HCC metastasis and develop a corresponding clinical treatment, a good in vivo tumor metastasis models is critical.

Zebrafish xenograft model has been developed rapidly for human cancers in recent years [5–7]. Up to date, various zebrafish cell line-derived tumor xenograft (zCDX) models have been established, including the models of colorectal cancer, melanoma, hepatocellular carcinoma, breast cancer, lung adenocarcinoma, etc. [5–10]. Moreover, a few zebrafish models of patient-derived xenograft (zPDX) have also been successfully developed [11–13]. Compared with the mouse xenograft model, the transparent zebrafish larva xenograft can be used to observe the transplanted cancer cells at the cellular level in intact animals, which provides an in vivo strategy to study the tumor growth and metastasis simultaneously [5, 14, 15]. Thus, with the help of zebrafish xenograft model, metastasis of tumor cells could be assessed in more precise way in a short time frame, even for personalized clinical testing of metastasis inhibition.

In the past few decades, increasing evidences indicate that lncRNAs, a class of non-coding transcripts (> 200 nucleotides) [16], play an important role in diverse physiological and pathological processes [17]. In HCCs, many lncRNAs have been reported to be crucial in tumor growth, metastasis and drug resistance [18]. Several recent studies have demonstrated that lncRNAs in HCC, including HULC/miR-372/PRKACB, LINC00974/miR-642/KRT19, AGAP2-AS1/miR-16-5p/ANXA11, etc. can act as ceRNAs in regulating tumor metastasis [19–22]. LncRNA HOXD-AS1 (also named HAGLR) was first reported as a marker of neuroblastoma progression [23]. Transcribed from the HOXD cluster on human chromosome 2q31.2 in an antisense manner, HOXD-AS1 contains eight exons [24]. It has been proved to closely associate with the progression of several tumors [25]. Among these tumors, HOXD-AS1 mainly functions as a ceRNA which binding with miRNAs in different cancers, such as HCC, lung cancer, ovarian cancer, glioma, breast cancer, colorectal cancer, cholangiocarcinoma and cervical cancer [26–34]. However, most of these studies lacked in vivo tumor metastasis models of HOXD-AS1, and so far no study offered in vivo evidence of its ceRNA network. Given that zebrafish xenograft can offer the fast and intuitive metastasis model in cancer research for lncRNA study [35], we attempt to establish a zebrafish xenograft-based in vivo strategy to verify the ceRNA network of HOXD-AS1 in HCC metastasis.

In this study, we first verified the high expression of HOXD-AS1 in different HCC cell lines. We then assessed the proliferation and metastasis of Hep3B and Huh7 cells following silencing the HOXD-AS1 in both cell culture systems and zebrafish xenograft models. Moreover, we inspected the binding of miR-130a-3p with HOXD-AS1 and its role in regulation of HCC metastasis. Our results demonstrate that HOXD-AS1 plays a critical role in promoting HCC metastasis in both in vitro and in vivo, and that miR-130a-3p inhibition can rescue the HCC metastasis decreased by HOXD-AS1 knockdown.

Zebrafish husbandry

Adult zebrafish were maintained in a fish auto culture system (Haishen, China) at 28°C, and the light cycle was 14-hours (hrs) on and 10-hrs off. Zebrafish embryos were cultured in 10% Hank’s solution which contained 140 mM NaCl, 5.4 mM KCl, 0.25 mM Na₂HPO₄, 0.44 mM KH₂PO₄, 1.3 mM CaCl₂, 1.0 mM MgSO₄ and 4.2 mM NaHCO₃ (pH 7.2). AB wild-type and Tg (fli1a:EGFP) transgenic zebrafish were used in this study. The zebrafish handling procedures were approved by Nanjing University School of Medicine.

Cell Culture

The human HCC cell lines HepG2, Hep3B, Huh7, and the normal hepatic cell line LO2 were used in this study. All cell lines were obtained from CUNMAI Biotechnologies (Shanghai, China) in 2019 and all cell lines were authenticated by STR test. And all cell lines were tested for mycoplasma contamination by PCR. LO2 cells were cultured in 1640. HepG2, Hep3B, and Huh7 cells were cultured in DMEM. Both media were supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin and then cultured in a humidified air atmosphere containing 5% carbon dioxide at 37 ℃.

Rna Extraction And Qrt-pcr

Total RNA was extracted from cell lines using TRIzol reagent. Total RNA was reverse transcribed to cDNA using 1st Strand cDNA Synthesis SuperMix for qPCR kit (Takara). We performed real-time PCR analyses using SYBR Green Master Mix kit (Takara) following the instructions to detect the expression levels of HOXD-AS1 in different liver cell lines. Data were analyzed based on the ∆∆CT method and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control. The sequences for gene-specific primers were HOXD-AS1-F: 5´-ATTCGTCTGACTTGGCTCTT-3´and HOXD-AS1-R: 5´-CCTGTTTTGACCTTTTCCTG-3´. The GAPDH sequences were GAPDH-F: 5´-GGGAGCCAAAAGGGTCAT-3´and GAPDH-R: 5´-GAGTC CTTCCACGATACCAA-3´.

Cell Transfection Of Sirna And Mirna Inhibitor

HepG2, Hep3B and Huh7 cell lines were cultured in six-well plates, then specific siRNAs or miRNA inhibitor were transfected after 24 hrs using Lipofectamine 3000 reagents (Thermo Fisher Scientific, USA). We purchased two HOXD-AS1 siRNAs, miR-130a-3p inhibitor and negative control (NC) siRNA from General Biosystems (China). The HOXD-AS1 siRNA sequences [36] are as follow: si1-HOXD-AS1: 5’-GAAAGAAGGACCAAAGTAA-3’, si2-HOXD-AS1: 5’-GCACAAAGGAACAAGGAAA-3’, and the NC siRNA sequence are 5’-TTCTCCGAACGTGTCACGT-3’. The sequence of miR-130a-3p inhibitor is AUGCCCUUUUAACAUUGCACUG [27]. Cells were harvested at 24 hrs after transfection, and silencing efficiencies were analyzed by qRT-PCR.

Cell Proliferation Assays

Cell proliferation assays were performed using Cell Counting Kit-8 (CCK-8, DOJINDO, Japan). HOXD-AS1 and NC siRNA were transfected into Hep3B and Huh7 cell lines, then cultured in 6-well plates for 24 hrs. A total of 2×10³ cells were placed in each well of 96-well plates. Cell proliferation was monitored by measuring the optical density (OD) at 450 nm every 24 hrs according to the manufacturer's instructions, from 0 to 96 hrs, then we analyzed the data of each group.

Cell Migration Assays

Hep3B and Huh7 were transfected with HOXD-AS1 and NC siRNA. After 24 hrs, transfected cells were plated in 24-well plates with 8-mm-pore size chamber inserts. 2.0×10⁴ or 6.0×10⁴ cells were plated into the upper chambers, which was diluted with the serum-free culture medium. Then the transwell was put into the lower chamber, which including 800µL medium with 10% FBS. After 24 hrs, the cells migrated to the bottom surface of the membrane, then the cells were fixed with methanol, and stained with 0.1% crystal violet for 30 minutes. The images were taken under the microscope for analysis.

Zebrafish Xenograft Models

Before injection, cancer cells were labeled with fluorescent dye CM-DiI (Invitrogen, USA). The detailed protocol was as follows: cells were collected, then washed three times with HBSS. The cells were then labeled with CM-DiI at 37 ℃ for 5 min, following by 15 min at 4 ℃. Next, the unincorporated dye was removed by rinsing three times with HBSS and the labeled cells were prepared for injection. The labeled cancer cells were injected into the perivitelline space (PVS) of 48-hpf (hours post-fertilization) zebrafish larvae. Each zebrafish larvae were mounted in 1.2% low-melting gel, and about 300–400 cells were implanted into PVS by the micro-injector. After injection, the zebrafish larva xenografts were cultured at 34℃ until the end of experiments. On 1 day post-injection (dpi), the successfully injected xenografts with similar tumor size were selected for the following experiments.

In vivo imaging and quantitative analysis

At 4 dpi, the zebrafish larvae were mounted in 1.2% low-melting gel, and the images were taken by stereotype microscope (MVX10, Olympus, Japan) or confocal microscope using a 20X water-immersion objective lens (Fluoview 3000, Olympus, Japan). The spatial resolution of the images was 1600×1200 (MVX10) or 1024×1024 pixels (Fluoview 3000). The images taken by stereotype microscope were quantitatively analyzed by ImageJ software.

Drug Administration

In zebrafish xenograft, the 24-hpi zebrafish xenografts with the similar tumor size were randomly divided in two groups: hanks solution and hanks solution containing 0.5 µM oxaliplatin. These larvae were raised for 3 days and then mounted for the imaging experiments.

Statistical analysis

Statistical analysis was performed using unpaired Student’s t-tests. A level of p < 0.05 was considered to be statistically significant. Results were displayed as the mean ± SEM.

HOXD-AS1 was highly expressed in HCC cell lines

We first examined the expression level of HOXD-AS1 in three HCC cell lines (HepG2, Hep3B and Huh7) as well as the normal human liver cell line LO2 using qRT-PCR. Compared to LO2 cells, we found that HOXD-AS1 was highly expressed in all tested HCC cell lines (Fig. 1A). To evaluate the function of HOXD-AS1 in HCC progression, we knocked down the level of HOXD-AS1 in these three HCC cell lines by transfecting the siRNAs [36]. At 24 hrs post-transfection, we collected the transfected cells and analyzed the knockdown efficiency of HOXD-AS1 using qRT-PCR. Compared with control oligonucleotide (NC), the efficiency of first siRNA (si1-HOXD-AS1) was 40.9%, 96.6%, 75.7% in HepG2, Hep3B and Huh7 cells, respectively, while the efficiency of second siRNA (si2-HOXD-AS1) was 3.9%, 41.0% and 45.2%, respectively (Fig. 1B-D). Based on knockdown efficiency data, we selected Hep3B and Huh7 cell lines for further studies.

Knockdown of HOXD-AS1 suppressed growth and metastasis of Hep3B cells in vitro and in vivo

We next examined the cell proliferation in Hep3B cell by CCK-8 assay and found that the viability of Hep3B was significantly decreased after transfected with si1-HOXD-AS1, but not si2-HOXD-AS1 (Fig. 2A). In line with the observation in HOXD-AS1 knockdown efficiency, si1-HOXD-AS1 is better antisense oligonucleotide than si2-HOXD-AS1. We therefore only examined the cell migration by using si1-HOXD-AS1 to silence HOXD-AS1, and we found that the migration of Hep3B cell was repressed after knockdown of HOXD-AS1 compared with the control (Fig. 2B). To determine the roles of HOXD-AS1 in HCC progression in vivo, we transplanted the Hep3B cells transfected with si1-HOXD-AS1 into zebrafish embryos. The transplanted cells were firstly transfected with si1-HOXD-AS1 for 24 hrs and then labeled with CM-DiI. About 400 cells were inoculated into the PVS of 2-dpf Tg (fli1a:EGFP) zebrafish larvae, in which the vascular endothelial cells were labeled by EGFP. At 4 dpi, the yolk and trunk of the zebrafish larva samples were imaged by stereomicroscopy and confocal microscopy. We first quantified the area with CM-DiI positive signals in yolk which represented the cell proliferation, and found that knockdown of HOXD-AS1 decreased the growth of Hep3B cells compared with the control (Fig. 2C-E). Next, we quantified the area with CM-DiI positive signals in trunk which represented the metastasis, and we also found that silence of HOXD-AS1 decreased the metastasis of Hep3B cells (Fig. 2F-H). These results show that HOXD-AS1 plays an important role in the progression of Hep3B cells.

Knockdown of HOXD-AS1 suppressed growth and metastasis of Huh7 cells both in vitro and in vivo

The same experiments using Huh7 cells was performed. As shown in Fig. 3, different from Hep3B cells, knockdown of HOXD-AS1 only slightly decreased the proliferation of Huh7 cells at 72-hr post-transfection (Fig. 3A), but the migration of Hep3B cell was significantly reduced (Fig. 3B). In zebrafish xenograft models, the silence of HOXD-AS1 dramatically decreased the growth and metastasis of Huh7 cells (Fig. 3C-H). These results not only confirm the oncogenic role of HOXD-AS1 in HCC, but also indicate its critical function in promoting HCC metastasis.

Knockdown of miR-130a-3p increased the metastasis of HCC cells in vitro and in vivo

Previous studies have shown that HOXD-AS1 functions as a ceRNA to facilitate HCC metastasis [26, 27]. Because miR-130a-3p can inhibit metastasis in multiple cancer cells [27, 30, 37–40] and serves as a competitive binding miRNA to HOXD-AS1, we next examined the interaction of miR-130a-3p with HOXD-AS1 and tis role in modulating HCC metastasis. We firstly verified the metastasis function of miR-130a-3p in cultured Huh7 cells. After knockdown of miR-130a-3p, we found that the migration of Huh7 cells was significantly increased compared with the control cells (Fig. 4A). Furthermore, we transplanted the cells transfected with the miR-130a-3p inhibitor into zebrafish larvae, and found that the CM-DiI positive cells were also dramatically increased in trunk (Fig. 4B). These results demonstrate that miR-130a-3p plays an important role in suppressing HCC metastasis.

Knockdown of miR-130a-3p rescued the HCC metastasis decreased by HOXD-AS1 silence in vitro and in vivo

To investigate whether the effect of miR-130a-3p on HCC metastasis inhibition is through competing with HOXD-AS1, we co-transfected HCC cells with HOXD-AS1 siRNA and miR-130a-3p inhibitor. As shown in the results of transwell assay (Fig. 5A), miR-130a-3p inhibitor rescued the migration of Huh7 cells which was decreased by HOXD-AS1 knockdown. To validate this in vivo, we implanted Huh7 cells transfected with si1-HOXD-AS1 and miR-13a-3p inhibitor into zebrafish larvae, and found that silence of HOXD-AS1 decreased HCC metastasis, whereas knockdown of miR-130a-3p rescued the metastasis (Fig. 5B). These results indicate that HOXD-AS1 promotes HCC metastasis through competitively binding with miR-130a-3p.

HOXD-AS1 knockdown and oxaliplatin treatment have a synergetic effect on inhibition of HCC proliferation and migration in vitro and in vivo

We also tested the potential clinical application of HOXD-AS1 in treatment of tumor metastasis. As shown in Fig. 6, in addition to knockdown of HOXD-AS1, we also bathed the cultured HCC cells with oxaliplatin. The results showed that knockdown of HOXD-AS1 enhanced the inhibitory effect of oxaliplatin on cancer cell proliferation and migration (Fig. 6A and B). Similarly, we also added the oxaliplatin in zebrafish culture medium and found that knockdown of HOXD-AS1 enhanced the inhibitory effect of oxaliplatin on cancer cell proliferation in zebrafish HCC xenograft models (Fig. 6C). However, we did not observe the enhanced inhibition of metastasis when combining HOXD-AS1 knockdown and oxaliplatin treatment (Fig. 6D). These results suggest that HOXD-AS1 may serve as a therapeutic target in a combination with oxaliplatin for HCC treatment.

HOXD-AS1 has been revealed to regulate the proliferation, migration, invasion, apoptosis and cycle progression through different pathways in HCC [26, 27, 41, 42]. Accumulating evidence suggest that HOXD-AS1 can function as a ceRNA that binds with miR-19a, miR-130a-3p and miR-326 [26, 27, 41]. In the present study, we verified that HOXD-AS1 functioned as an oncogenic lncRNA in growth and metastasis in HCC cell lines in vitro and in vivo. We also showed that miR-130a-3p, which binds with HOXD-AS1, displays an inhibition role in HCC metastasis. The rescue experiments further indicate that HOXD-AS1 may regulate the HCC metastasis via competing with miR-130a-3p.

Recent studies have demonstrated that some of the lncRNAs can serve as ceRNAs to impact tumor proliferation and metastasis via competitively binding with miRNAs [43, 44]. In the present study, we showed that knockdown of miR-130a-3p markedly promoted HCC metastasis. In addition, decreased metastasis of HCC cells by HOXD-AS1 knockdown could be rescued by miR-130a-3p inhibitor in zebrafish xenograft. This finding shows that zebrafish xenograft is a feasible in vivo model for verifying the ceRNA pathway in human cancers. Mouse metastasis models are widely used for the study of human cancers. The pro-metastatic role of HOXD-AS1 in HCC has been reported by various investigators using mouse metastasis models [26, 41]. On day 28 after tail vein injecting or day 42 after intra-spleen injecting in the nude mouse, HCCLM3 cells with HOXD-AS1 overexpression displayed an increased metastasis in liver and lung [26]. In line with this finding, our present study shows that knockdown of HOXD-AS1 decreases the metastasis of HCC cells in zebrafish xenograft models.

Our results demonstrate that zebrafish xenografts can serve as an ideal in vivo model for studying human cancer metastasis. In addition, compared to mouse model, zebrafish xenograft models show certain advantages in tumor biology research. First, it requires significantly short time frame. For instance, we accessed the metastasis role of HOXD-AS1 by zebrafish xenograft in only 4 days after transplantation, whereas mouse metastasis xenograft models require at least 4 weeks. Second, although we mainly focused on metastasis of HCC cells in the present study, we could analyze the HCC proliferation using the same xenograft samples. Finally, by combing different transgenic zebrafish lines, we also can study the microenvironment of HCC cells, such as angiogenesis by Tg(fli1a:EGFP) transgenic line. As more oncologists use zebrafish as a model organism, more specific and precise xenograft models will be developed.

In conclusion, we demonstrate that HOXD-AS1 plays an important role in HCC metastasis in zebrafish xenograft models via acting as a ceRNA. Silencing miR-130a-3p can rescue the HCC metastasis which is decreased by knockdown of HOXD-AS1. Additionally, pharmacological experiments indicate that HOXD-AS1 knockdown and oxaliplatin treatment have synergic effects on inhibiting HCC progression. Our results suggest that HOXD-AS1 may serve as a biomarker and potential therapeutic target for HCC metastasis.

CCK-8 Cell Counting Kit-8

ceRNA Competing Endogenous RNA

dpf Days Postfertilization

dpi Days Postinjection

GAPDH Glyceraldehyde 3-Phosphate Dehydrogenase

HCC Hepatocellular Carcinoma

hpf Hours Postfertilization

HOXD-AS1 HOXD Cluster Antisense RNA 1

lncRNA Long Non-coding RNA

miRNA MicroRNA

NC Negative Control

PVS Perivitelline Space

qRT-PCR Quantitative Reverse Transcription-PCR

siRNA Small Interfering RNA

STR Short Tandem Repeat

zCDX Zebrafish Cell Line Derived Xenograft

zPDX Zebrafish Patient Derived Xenograft

Acknowledgements This work was supported by the Nanjing Science and Technology Development Plan Project (No. 201715061). We thank Nanjing XinJia Medical Technology Co., Ltd. for helping with zebrafish xenograft models. We would like to give our sincere gratitude to the reviewers for their constructive comments.

Author contributions YZ: Conceptualization, Methodology, Investigation, Visualization, Validation, Writing-Original draft preparation and Supervision. L-XW: Methodology and Investigation. FQ: Investigation and Visualization. S-CJ: Writing-Reviewing and Editing and Supervision.

Data Availability All data collected and analyzed during the current study are available from the corresponding author on reasonable request.

Conflict of Interests The authors declare that they have no competing interests.

Consent for publication All the authors approved the publication.

Ethical approval This study was approved by the Ethics Committee of the Nanjing University School of Medicine, and all experiments were performed under accordance with the guidelines of Nanjing University School of Medicine.

Forner A, Reig M, Bruix J (2018) Hepatocellular carcinoma. The Lancet 391:1301–1314. https://doi.org/10.1016/S0140-6736(18)30010-2
Portolani N, Coniglio A, Ghidoni S, Ghidoni S, Giovanelli M, Benetti A, Tiberio GAM, Giulini SM (2006) Early and Late Recurrence After Liver Resection for Hepatocellular Carcinoma: Prognostic and Therapeutic Implications. Ann Surg 243:229–235. https://doi.org/10.1097/01.sla.0000197706.21803.a1
Heimbach JK, Kulik LM, Finn RS, Sirlin CB, Abecassis MM, Roberts LR, Zhu AX, Murad MH, Marrero JA (2018) AASLD guidelines for the treatment of hepatocellular carcinoma. Hepatology 67:358–380. https://doi.org/10.1002/hep.29086
Gosalia AJ, Martin P, Jones PD (2017) Advances and Future Directions in the Treatment of Hepatocellular Carcinoma. Gastroenterol Hepatol (N Y) 13:398–410.
Fior R, Póvoa V, Mendes RV, Carvalho T, Gomes A, Figueiredo N, Ferreira MG (2017) Single-cell functional and chemosensitive profiling of combinatorial colorectal therapy in zebrafish xenografts. Proc Natl Acad Sci USA 114:E8234-E8243. https://doi.org/10.1073/pnas.1618389114
Hason M, Bartůněk P (2019) Zebrafish Models of Cancer—New Insights on Modeling Human Cancer in a Non-Mammalian Vertebrate. Genes (Basel) 10:935. https://doi.org/10.3390/genes10110935
Yan C, Brunson DC, Tang Q, Do D, Iftimia NA, Moore JC, Hayes MN, Welker AM, Garcia EG, Dubash TD, Hong X, Drapkin BJ, Myers DT, Phat S, Volorio A, Marvin DL, Ligorio M, Dershowitz L, McCarthy KM, Karabacak MN, Fletcher JA, Sgroi DC, Iafrate JA, Maheswaran S, Dyson NJ, Haber DA, Rawls JF, Langenau DM (2019) Visualizing Engrafted Human Cancer and Therapy Responses in Immunodeficient Zebrafish. Cell 177:1903–1914.e14. https://doi.org/10.1016/j.cell.2019.04.004
Eguiara A, Holgado O, Beloqui I, Abalde L, Sanchez Y, Callol C, Martin AG (2011) Xenografts in zebrafish embryos as a rapid functional assay for breast cancer stem-like cell identification. Cell Cycle 10:3751–3757. https://doi.org/10.4161/cc.10.21.17921
Lu JW (2015) Zebrafish as a disease model for studying human hepatocellular carcinoma. World J Gastroenterol 21:12042. https://doi.org/10.3748/wjg.v21.i42.12042
Chen X, Fu YF, Xu HF, Teng P, Xie Q, Zhang YR, Yan CC, Xu YQ, Li CQ, Zhou JY, Ni YM, Li WD (2018) SOX5 predicts poor prognosis in lung adenocarcinoma and promotes tumor metastasis through epithelial-mesenchymal transition. Oncotarget 9:10891–10904. https://doi.org/10.18632/oncotarget.22443
Mercatali L, Manna FL, Groenewoud A, Casadei R, Recine F, Miserocchi G, Pieri F, Liverani C, Bongiovanni A, Spadazzi C, Vita AD, Pluijm GVD, Giorgini A, Biagini R, Amadori D, Ibrahim T, Snaar-Jagalska E (2016) Development of a Patient-Derived Xenograft (PDX) of Breast Cancer Bone Metastasis in a Zebrafish Model. Int J Mol Sci 17:1375. https://doi.org/10.3390/ijms17081375
Wu JQ, Zhai J, Li CY, Tan AM, Wei P, Shen LZ, He MF (2017) Patient-derived xenograft in zebrafish embryos: a new platform for translational research in gastric cancer. J Exp Cli Cancer Res 36:160. https://doi.org/10.1186/s13046-017-0631-0
Wang L, Chen H, Fei F, He XF, Sun SY, Lv KP, Yu B, Long J, Wang X (2019) Patient-derived Heterogeneous Xenograft Model of Pancreatic Cancer Using Zebrafish Larvae as Hosts for Comparative Drug Assessment. J Vis Exp 146:59507. https://doi.org/10.3791/59507
Liu TL, Upadhyayula S, Milkie DE, Singh V, Wang K, Swinburne IA, Mosaliganti KR, Collins ZM, Hiscock TW, Shea J, Kohrman AQ, Medwig TN, Dambournet D, Forster R, Cunniff B, Ruan Y, Yashiro H, Scholpp S, Meyerowitz EM, Hockemeyer D, Drubin DG, Martin BL, Matus DQ, Koyama M, Megason SG, Kirchhausen T, Betzig E (2018) Observing the cell in its native state: Imaging subcellular dynamics in multicellular organisms. Science 360:eaaq1392. https://doi.org/10.1126/science.aaq1392
Osmani N, Goetz JG (2019) Multiscale Imaging of Metastasis in Zebrafish. Trends Cancer 5:766–778. https://doi.org/10.1016/j.trecan.2019.10.003
Rosenbloom KR, Dreszer TR, Long JC, Malladi VS, Sloan CA, Raney BJ, Cline MS, Karolchik D, Barber GP, Clawson H, Diekhans M, Fujita PA, Goldman M, Gravell RC, Harte RA, Hinrichs AS, Kirkup VM, Kuhn RM, Learned K, Maddren M, Meyer LR, Pohl A, Rhead B, Wong MC, Zweig AS, Haussler D, Kent WJ (2012) ENCODE whole-genome data in the UCSC Genome Browser: update 2012. Nucleic Acids Res 40:D912-D917. https://doi.org/10.1093/nar/gkr1012
Quinn JJ, Chang HY (2016) Unique features of long non-coding RNA biogenesis and function. Nat Rev Genet 17:47–62. https://doi.org/10.1038/nrg.2015.10
Klingenberg M, Matsuda A, Diederichs S, Patel T (2017) Non-coding RNA in hepatocellular carcinoma: Mechanisms, biomarkers and therapeutic targets. J Hepatol 67:603–618. https://doi.org/10.1016/j.jhep.2017.04.009
Wang JY, Liu XF, Wu HC, Ni PH, Gu ZD, Qiao YX, Chen N, Sun FY, Fan QS (2010) CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. Nucleic Acids Res 38:5366–5383. https://doi.org/10.1093/nar/gkq285
Yuan JH, Yang F, Wang F, Ma JZ, Guo YJ, Tao QF, Liu F, Pan W, Wang TT, Zhou CC, Wang SB, Wang YZ, Yang Y, Yang N, Zhou WP, Yang GS, Sun SH (2014) A Long Noncoding RNA Activated by TGF-β Promotes the Invasion-Metastasis Cascade in Hepatocellular Carcinoma. Cancer Cell 25:666–681. https://doi.org/10.1016/j.ccr.2014.03.010
Liu ZK, Wang YF, Wang L, Yao BW, Sun LK, Liu RK, Chen TX, Niu YS, Tu KS, Liu QG (2019) Long non-coding RNA AGAP2-AS1, functioning as a competitive endogenous RNA, upregulates ANXA11 expression by sponging miR-16-5p and promotes proliferation and metastasis in hepatocellular carcinoma. J Exp Clin Cancer Res 38:194. https://doi.org/10.1186/s13046-019-1188-x
Xu G, Xu WY, Xiao Y, Jin B, Du SD, Mao YL, Zhang ZT (2020) The emerging roles of non-coding competing endogenous RNA in hepatocellular carcinoma. Cancer Cell Int 20:496. https://doi.org/10.1186/s12935-020-01581-5
Yarmishyn AA, Batagov AO, Tan JZ, Sundaram GM, Sampath P, Kuznetsov VA, Kurochkin IV (2014) HOXD-AS1 is a novel lncRNA encoded in HOXD cluster and a marker of neuroblastoma progression revealed via integrative analysis of noncoding transcriptome. BMC Genomics 15:S7. https://doi.org/10.1186/1471-2164-15-S9-S7
Zheng L, Chen JT, Zhou ZY, He ZK (2017) Knockdown of long non-coding RNA HOXD-AS1 inhibits gastric cancer cell growth via inactivating the JAK2/STAT3 pathway. Tumor Biol 39:101042831770533. https://doi.org/10.1177/1010428317705335
Xie SC, Yang YJ, Zhang JQ, Zhou S, Xie SW, Hua YY (2019) HOXD-AS1: a novel oncogenic long intergenic non-coding RNA in humans. Eur Rev Med Pharmacol Sci 23:2898–2907. https://doi.org/10.26355/eurrev_201904_17568
Lu S, Zhou JS, Sun YM, Li N, Miao MY, Jiao BH, Chen H (2017) The noncoding RNA HOXD-AS1 is a critical regulator of the metastasis and apoptosis phenotype in human hepatocellular carcinoma. Mol Cancer 16:125. https://doi.org/10.1186/s12943-017-0676-x
Wang H, Huo XS, Yang XR, He J, Cheng LJ, Wang N, Deng X, Jin HJ, Wang N, Wang C, Zhao FY, Fang JY, Yao M, Fan J, Qin WX (2017) STAT3-mediated upregulation of lncRNA HOXD-AS1 as a ceRNA facilitates liver cancer metastasis by regulating SOX4. Mol Cancer 16:136. https://doi.org/10.1186/s12943-017-0680-1
Wang QH, Jiang SJ, Song AY, Hou SY, Wu QF, Qi LJ, Gao X (2017) HOXD-AS1 functions as an oncogenic ceRNA to promote NSCLC cell progression by sequestering miR-147a. OncoTargets Ther 10:4753–4763. https://doi.org/10.2147/OTT.S143787
Zhang Y, Dun YB, Zhou SM, Huang XH (2017) LncRNA HOXD-AS1 promotes epithelial ovarian cancer cells proliferation and invasion by targeting miR-133a-3p and activating Wnt/β-catenin signaling pathway. Biomed Pharmacother 96:1216–1221. https://doi.org/10.1016/j.biopha.2017.11.096
Chen YN, Zhao FB, Cui DM, Jiang R, Chen J, Huang QF, Shi JL (2018) HOXD-AS1/miR-130a sponge regulates glioma development by targeting E2F8. Int J Cancer 142:2313–2322. https://doi.org/10.1002/ijc.31262
Li YY, Han X, Li QB, Wang CY, Lou Z, Wang XM (2019) Long noncoding RNA HOXD-AS1 induces epithelial-mesenchymal transition in breast cancer by acting as a competing endogenous RNA of miR-421. J Cell Biochem 120:10633–10642. https://doi.org/10.1002/jcb.28353
Chen SZ, Li KJ (2020) HOXD-AS1 facilitates cell migration and invasion as an oncogenic lncRNA by competitively binding to miR-877-3p and upregulating FGF2 in human cervical cancer. BMC Cancer 20:924. https://doi.org/10.1186/s12885-020-07441-9
Li JL, Jiang XM, Li ZL, Huang LN, Ji DL, Yu L, Zhou YX, Cui YF (2020) SP1-induced HOXD-AS1 promotes malignant progression of cholangiocarcinoma by regulating miR-520c-3p/MYCN. Aging (Albany NY) 12:16304–16325. https://doi.org/10.18632/aging.103660
Yan F, Ma YL, Liu L, Li L, Deng J, Sun JH (2020) Long Noncoding RNA HOXD-AS1 Promotes the Proliferation, Migration, and Invasion of Colorectal Cancer via the miR-526b-3p/CCND1 Axis. J Surg Res 255:525–535. https://doi.org/10.1016/j.jss.2020.05.078
Shen WY, Pu J, Sun J, Tan B, Wang W, Wang LL, Cheng JM, Zuo YS (2020) Zebrafish xenograft model of human lung cancer for studying the function of LINC00152 in cell proliferation and invasion. Cancer Cell Int 20:376. https://doi.org/10.1186/s12935-020-01460-z
Zhang HL, Bai M, Zeng A, Si LB, Yu NZ, Wang XJ (2017) LncRNA HOXD-AS1 promotes melanoma cell proliferation and invasion by suppressing RUNX3 expression. Am J Cancer Res 7:2526–2535.
Liu Y, Li YM, Wang R, Qin SK, Liu J, Su F, Yang Y, Zhao FY, Wang ZS, Wu Q (2016) MiR-130a-3p regulates cell migration and invasion via inhibition of Smad4 in gemcitabine resistant hepatoma cells. J Exp Clin Cancer Res 35:19. https://doi.org/10.1186/s13046-016-0296-0
Kong XJ, Zhang JF, Li J, Shao JF, Fang L (2018) MiR-130a-3p inhibits migration and invasion by regulating RAB5B in human breast cancer stem cell-like cells. Biochem Biophys Res Commun 501:486–493. https://doi.org/10.1016/j.bbrc.2018.05.018
Wang SS, Han HB, Hu Y, Yang W, Lv YW, Wang LM, Zhang LH, Ji JF (2018) MicroRNA-130a-3p suppresses cell migration and invasion by inhibition of TBL1XR1-mediated EMT in human gastric carcinoma. Mol Carcinog 57:383–392. https://doi.org/10.1002/mc.22762
Wang ZJ, Li ZH, Fu Y, Han L, Tian Y (2019) MiRNA-130a-3p inhibits cell proliferation, migration, and TMZ resistance in glioblastoma by targeting Sp1. Am J Transl Res 11:7272–7285.
Ji WB, Wang QF, Yang J (2020) LncRNA HOXD-AS1 promotes the metastasis of human hepatocellular carcinoma via modulating miR-326/SLC27A4. Cancer Cell Int 20:161. https://doi.org/10.1186/s12935-020-01217-8
Sun J, Guo Y, Bie BB, Zhu MC, Tian HW, Tian J, Li J, Yang Y, Ji FP, Kong GY, Li ZF (2020) Silencing of long noncoding RNA HOXD-AS1 inhibits proliferation, cell cycle progression, migration and invasion of hepatocellular carcinoma cells through MEK/ERK pathway. J Cellular Biochem 121:443–457. https://doi.org/10.1002/jcb.29206
Qi XL, Zhang DH, Wu N, Xiao JH, Wang X, Ma W (2015) ceRNA in cancer: possible functions and clinical implications. J Med Genet 52:710–718. https://doi.org/10.1136/jmedgenet-2015-103334
Chan JJ, Tay Y (2018) Noncoding RNA:RNA Regulatory Networks in Cancer. Int J Mol Sci 19:1310. https://doi.org/10.3390/ijms19051310

No competing interests reported.

Download PDF

Version 2

posted

You are reading this latest preprint version

Lncrna HOXD-AS1 Functions As A Cerna To Promote Hepatocellular Carcinoma Metastasis In Zebrafish Xenograft Models

Status:

Version 2

Abstract

Figures

Introduction

Materials And Methods

Zebrafish husbandry

Cell Culture

Rna Extraction And Qrt-pcr

Cell Transfection Of Sirna And Mirna Inhibitor

Cell Proliferation Assays

Cell Migration Assays

Zebrafish Xenograft Models

Drug Administration

Statistical analysis

Results

HOXD-AS1 was highly expressed in HCC cell lines

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 2