BMECs isolation, culture and identification
The human femoral head samples were collected from voluntary patients who underwent total hip arthroplasty at Tongliao City Hospital between 03/22/2018 and 03/22/2019 due to femoral neck fracture, primary hip osteoarthritis or osteoarthritis secondary to congenital hip dysplasia. This research was approved by the Ethics Committee of the Tongliao City Hospital. Written informed consents from all patients were obtained in any experimental work with humans.
Under aseptic condition, HBMECs were isolated from the femoral head samples and cultured with DMEM as described previously (14). Seven days after the culture, the morphology of the isolated HBMECs was observed by phase-contrast microscope. The expression levels of the markers CD31 (PA5-16301), CD133 (PA5-38014) and von Willebrand factor (vWF, PA5-16634) (Thermo Fisher Scientific) were determined by immunofluorescence according to previous report (14, 15).
Cell Treatment
HBMECs were cultured with 5% CO2 at 37℃ with different concentrations (0.25, 0.5, 0.75, or 1.0 mg/ml) of HC (386698, Sigma) for 24 h to establish the HC-induced cell model (16). As shown in Fig. 2A, because 0.759 mg/ml was the IC50 of HC, 0.75 mg/ml of HC was used for next experiments.
To test the effect of PNS (CP201608022, Yunnan phytopharmaceutical. Co., Ltd. Yunnan, China) on cell viability, HBMECs were cultured with PNS for 24 h in different concentrations (100, 200, 300, 400 mg/ml).
To test the protective effect of PNS on HC-induced cell injury, HBMECs were co-cultivated with PNS in different final concentrations (100, 200, 300, 400 mg/ml) and HC in final concentration (0.75 mg/ml) for 24 h.
To test whether APOA1 participated in the protective effect of PNS on HBMECs exposed to HC, BMECs were transfected with APOA1 or siAPOA1 to up-regulate or down-regulate the expression of APOA1.
HBMECs Transfection
The pcDNA3.1 APOA1, pcDNA3.1, APOA1 siRNA (siAPOA1) and siRNA negative control (siNC) were obtained from RiboBio (Guangzhou, China).
HBMECs transfected with pcDNA3.1 was served as negative control (NC) of pcDNA3.1-APOA1. HBMECs transfected with siNC was served as negative control of siAPOA1. Before harvest, the vectors were transfected into HBMECs for 48 h to down-regulate the expression of APOA1 in HBMECs using Lipofectamine® 2000 Transfection Reagent (11668, ThermoFisher, USA).
CCK-8 Assay
HBMECs (5 × 104 cells/well) were planted in 96-well plates for 24 h. After 24 h indicated treatment, the viability of HBMECs was determined by CCK-8 kit (CA1210, Solarbio, China) and the absorbance was determined at 450 nm with a microplate reader (SpectraMax iD5, Molecular Devices, US).
Reverse Transcription And Quantitative Real-time PCR
Total RNA of HBMECs was extracted by Trizol reagent (15596018, Invitrogen). PrimeScript™ RT Master Mix was used for RT-PCR (RR036B, Takara). QRT-PCR was performed by 7300 real-time PCR system (Applied Biosystems, USA) and TB Green® Premix Ex Taq™ II (RR820Q, Takara). Conditions were as follows: 30 min of incubation at 95 °C, followed by amplification of 5 sec at 95 °C, 34 sec at 60 °C for 40 cycles. Data were analyzed by the 2−ΔΔCt method (17). The sequences of primers used in this research were displayed in Table 1.
Table 1
Primer sequences used for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR)
| Genes | Primer sequences(5 ́-3 ́) |
| FOXF1 | forward | CAAAGACAGCGGCAGAGACTAT |
| | reverse | CTGTCTCCTTTTCCAGGTTATCC |
| GADPH | forward | CCAGGTGGTCTCCTCTGA |
| reverse | GCTGTAGCCAAATCGTTGT |
Western Blot
HBMECs lysates were lysed for protein isolation and analyzed as previously described (16). In brief, HBMECs lysates were prepared with RIPA buffer (P0013, Beyotime, China) containing protease inhibitors. After protein containing compounds was centrifuged by high speed centrifuge (12,000 rpm, 5 min) at 4 °C, the supernatant was obtained. The total protein concentration was determined by double bicinchoninic Acid (BCA) assay kit (P0009, Beyotime, China). The protein was separated by 8% SDS-PAGE gel and transferred to a PVDF membrane (FFP24, Beyotime) at 4 °C for 2 h. Then, 5% skimmed milk was prepared using Tris-buffered saline with Tween-20 (TBS-T) to block the aspecific antigen for 1 h. The membrane was washed 3 times with TBS-T and probed with primary antibody at 4℃ overnight. The specific primary antibodies [APOA1, anti-apoptotic related-protein (Bcl-2), pro-apoptotic related-proteins (Bax, Caspase-3) and GAPDH] were listed in Table 2. The membrane was separated from the primary antibody and washed 3 times. The blots in membrane were probed with secondary antibody and washed 3 times. The secondary antibodies were HRP-conjugated secondary antibody (Goat Anti-Mouse, 1:2000, ab205719, Abcam, USA) and HRP-conjugated secondary antibody (Goat Anti-Rabbit, 1:2000, ab205718, Abcam, USA). BeyoECL Star (P0018FS, Beyotime) was used to visualize the target protein on the luminescent image analyzer (ImageQuant LAS4000 mini).
Table 2
List of primary antibodies used for western blots.
| Protein | Antibody | Catalog Number | Company | Antibody Dilution |
| APOPA1 | Rabbit Anti-Apolipoprotein A I antibody [EP1368Y] | ab52945 | Abcam | 1:1000 |
| Bcl-2 | Rabbit Anti-Bcl-2 antibody (ab59348) | ab59348 | Abcam | 1:1000 |
| Bax | Rabbit-Anti-Bax antibody [E63] | ab32503 | Abcam | 1:1000 |
| Cleaved caspase-3 | Rabbit Anti-Cleaved Caspase-3 antibody (ab2302) | ab2302 | Abcam | 1:1000 |
| GAPDH | Mouse Anti-GAPDH antibody [6C5] - Loading Control | ab8245 | Abcam | 1:1000 |
Flow Cytometry Analysis
HBMECs were collected and stabilized with 70% ice-cold ethanol, and dyed by Annexin V-FITC Apoptosis Detection Kit (CA1020, Solarbio) in the dark. After being washed, the apoptosis rate of BMECs was determined by flow cytometry in flow cytometer Accuri™ C6 (BD Biosciences, USA), and the results were analyzed by Cell Quest software 3.3 (Becton-Dickinson).
Scratch Wound Healing Assay
First, BMECs (5 × 105/well) were cultured to 80–90% confluence in 6-well plates. After the medium was discarded, confluent HBMECs were scratched using a 10 µl tip, washed by serum-free DMEM, and incubated for 48 h. The evaluation of migratory activities was performed by counting migrating cells under a 100 × inverted microscope (Ts2r-FL, Nikon, Japan). Five random fields were chosen for each chamber. The following formula [(1 – the distance following healing/the distance prior to healing) × 100%] was used to calculated relative migration rate of HBMECs.
Tube Formation Assay
Matrigel was added to the pre-cooled 24-well plates at 150 µL/well. The plates were placed in an incubator at 37℃ with 5% CO2 for 30 min to turn into glue for next experiments. After indicated treatment for 24 h, HBMECs were digested by trypsin and resuspended by serum-free DMEM. BMECs (5 × 105/well) were planted into 24-well plates coated with matrigel. The HC (0.75 mg/mL) was added and the cells were cultured at 37℃ with 5% CO2 and 95% humidity for 4 h. Next, the cells were photographed under a 100 × inverted phase contrast microscope. Three visual fields were randomly selected, and the tubule length was measured.
Statistical analysis
The data were shown as mean ± standard deviation (S.D.). Statistical significance in this study was analyzed by Student’s t-test or one-way ANOVA followed by Bonferroni’s post hoc test. The analyses were performed by SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). P < 0.05 was considered statistically significant.