The role of human endometrial stem cells application in endometrial-factor induced infertility

doi:10.21203/rs.3.rs-2373335/v1

Download PDF

Research Article

The role of human endometrial stem cells application in endometrial-factor induced infertility

https://doi.org/10.21203/rs.3.rs-2373335/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background.

Endometrial-factor induced infertility remains one of the most significant pathology among all fertility disorders. Stem cell-based therapy is considered to be the next-generation approach. However, at this point there are still issues about successfully retrieving human endometrium derived stem cells (hEnSCs). Moreover, we also need to establish a better understanding of the effect of hEnSCs on the endometrial recovery and the clinical outcome.

Methods.

Endometrium samples were collected from females undergoing assisted reproductive technology (ART) procedure due to couple infertility. These samples were obtained using an endometrium scratching. The hEnSCs were isolated from endometrium samples and characterized with flow cytometry analysis. Groups of endometrium injured female mice were established by the mechanical injury to uterine horns and the intraperitoneal chemotherapy. The hEnSCs suspension was injected to some of the studied female mice at approved time intervals. Morphological changes of mice uterine horns were evaluated after Masson‘s trichrome original staining and hematoxylin and eosin (H&E) staining. The fertility assessment of mice was performed by counting formed embryos. The expression of fibrosis related genes (Col1a1, Col3a1, Acta2 and CD44) was evaluated by the reverse transcription – quantitative polymerase chain reaction (RT-qPCR).

Results.

Endometrium scratching is an effective procedure for stem cells collection from human endometrium. Isolated hEnSCs met the criteria for defining mesenchymal stem cells (MSCs). Moreover, hEnSCs-based therapy had a demonstrably positive effect on the repair of damaged uterine horns layers, including a reduction of fibrosis, intensity of inflammatory cells such as lymphocytes and polymorphonuclear cells (PMNs) and the number of apoptotic bodies. The injured female mice had higher fertility after hEnSCs-based therapy in comparison to the untreated mice models. Gene expression was also reflected in morphology changes and outcomes of conception.

Conclusions.

hEnSCs demonstrated a positive impact on endometrium restoration and outcomes of endometrial-factor induced infertility. Further exploration is required in order to continue exploring the multifactorial associations between stem cell therapy, gene expression, endometrial changes and reproductive health, so we can identify individually effective and safe treatment strategies for endometrial-factor induced infertility, which is caused by mechanical effect or chemotherapy, in daily clinical practise.

infertility

stem cells

endometrial-factor

mechanical injury

chemotherapy

morphology

genes

Infertility has become a significant health problem. Overall, approximately one in six heterosexual couples (or 8-12% women aged 20-44 years) around the world may experience difficulty getting pregnant [1]. Studies on the mechanisms of fertility disorders have identified human endometrial tissue as one of the key elements in reproductive health field.

Regardless of the method of conception, endometrium receptivity – the ability of endometrium to successfully attach and maintain the embryo – is an essential condition for conception and further pregnancy development [2,3]. Unfortunately, this receptivity can be impaired by the endometrial dysfunction such as intrauterine adhesions, Asherman’s syndrome, a persistently thin endometrium or an endometrial atrophy. Meanwhile, these pathologies have been associated with infertility [4,5], increased risk of miscarriage [6,7], ectopic pregnancy [8,9], placenta previa [10], low birthweight [11–14] and other obstetric complications [14]. The main treatment strategy of damaged endometrium consists of medical therapy (estrogen therapy, vitamin E, pentoxifylline, L-arginine, aspirin, tamoxifen, sildenafil), surgical procedures (dilatation and curettage, hysteroscopy), re-adhesion prevention (intrauterine device, uterine balloon stent, Foley’s catheter, anti-adhesion barriers), autologous cellular therapy (intrauterine injection of granulocyte colony stimulating factor, autologous platelet-rich plasma therapy) and ART [15–19]. Although multiple approaches to treatment are available, the overall curative outcome is quite inconsistent. Therefore, stem cell-based therapy is being explored as a potential next-generation approach for endometrial-factor induced infertility.

Immune regulation and paracrine stimulation stem cells have been recognized as a potential treatment strategy for endometrium pathology caused infertility due to self-renewal and multilineage differentiation, disruption of fibrosis and promotion of angiogenesis [20–22]. A great deal of interest is particularly directed towards mesenchymal stem cells (MSCs) as a potential therapy tool due to their properties in contrast to other stem cell types: MSCs are a well-characterized population of adult stem cells, with no ethical or moral issues attached to their usage; they have a wide range of differentiation potential; they can be easily grown and multiplied in culture to create the required amount, without losing differentiation potential; they have a low immunogenicity; they lack tumorigenesis properties; they can act through different mechanisms and, they are even easily available commercially [23–27]. MSCs can be isolated from different adult tissues (bone marrow, adipose tissue, dental pulps, peripheral blood, skin, synovial fluid, muscle, Wharton’s jelly, menstrual blood or endometrial tissue) [28–33] and neonatal tissues (umbilical cord, amniotic fluid, placenta or amniotic membrane) [33–37]. While the best-known and most prevalent sources of MSCs are bone marrow, adipose tissue and umbilical cord, increasing evidence from basic and preclinical studies suggests that human endometrium derived stem cells (hEnSCs) show great promise as an autologous source for regenerative medicine, including reproductive health [38]. While a great deal of knowledge has been accumulated about hEnSCs, their role in the repair process of the endometrium and the impact on fertility disorders treatment, remains elusive.

The aim of the present study is to evaluate the endometrium as a potential source of stem cells, while specifying hEnSCs collecting methods, and investigating their impact on endometrial-factor induced infertility according to the multifactorial background along with an analysis of histological findings, gene expression and fertility assay.

Patient recruitment

The study “Therapeutic potential of human endometrial stem sells“ was approved by the Ethics Committee of Biomedical Research of Vilnius Region, No. 158200-18/7-1049-550 (29/06/2018). All endometrial tissue samples were collected during routine procedure at Vilnius University Hospital Santaros Klinikos Obstetrics and Gynecology Center Santaros Fertility Center. The female subjects of the present study signed consent forms to confirm their agreement to providing their endometrium specimens.

Endometrial tissue samples were taken from a total 20 females undergoing ART procedures due to couple infertility. A reproductive medicine professional collected the specimens using 3 mm wide pipelle, endometrial sampling catheter, while performing a scratching procedure on the inner wall of uterine lining. The procedure was carried out once on Day 20–22 of the menstrual cycle prior to in vitro fertilization (IVF)/intracytoplasmic sperm injection (ICSI) procedure.

Isolation and cultivation of human endometrium derived mesenchymal stem cells

The isolation of hEnSCs was performed according to [39]. Isolated cells were cultured in a growth medium DMEM/F12 (DMEM, Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12) supplemented with 10% Fetal Bovine Serum (FBS), 100 U/mL penicillin and 100 µg/mL streptomycin (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) at 37⁰C in a 5% CO₂ atmosphere with humidity. Cells were plated into T75 cm²culture flasks at a density of 0.5 – 0.6x10⁶ cells. The medium was replaced every 2-3 days and cells were replated according to their confluence. Cell viability was evaluated during passaging using Neubauer’s chamber and Trypan Blue test. Preparation of hEnSCs for the injection into female mice was done by washing cells twice with sterile phosphate-buffered saline (PBS) solution.

Flow cytometry analysis

To determine hEnSCs surface markers, cells were collected (about 0.1x10⁶ cells for one marker), centrifuged at 500 g speed for 5 min and washed twice with 1xPBS and 1% Bovine serum albumin (BSA) solution. Washed cells were then incubated for 30 minutes in the dark on ice with appropriate antibodies against cell surface markers (CD44, CD146, CD166, CD140b, CD34, CD45, HLA-DR). After that, the labelled cells were washed twice with PBS + 1% BSA solution by centrifuging at 550 g for 5 min., 4⁰C. Since flow cytometry analysis was not done immediately, cells were fixated with 2% paraformaldehyde solution and later analyzed with Partec flow cytometer (Sysmex Corporation, Cobe, Hioko, Japan). Results were processed with Flowing Software 2 software.

Animal study

Animal testing "Possibilities of stem cells application for restoration of endometrium" was approved by the State Food and Veterinary Service of the Republic of Lithuania. Veterinary approval for that study was No. G2-115 (20/05/2019). The study reporting adheres to the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines for the reporting of animal experiments.

Procedures with animal were performed by trained specialists using appropriate equipment.

A total of 58 NOD.CB-17-Prkdc scid/Rj female mice, 6 weeks of age, 18 g±0.5 g were purchased from JANVIER LABS (France) and allowed to adapt to the new environment for at least a week. The mice were maintained in specific-pathogen free conditions.

The anesthetised mice were euthanized by cervical dislocation procedure. Mice were removed from their cages, anesthetized by 1% to 3% isoflurane inhalation (100 mg/g, Isoflurin, Vetpharma, Spain) and gently restrained while resting on the operating tables with aseptic pads. Cervical dislocation was performed mechanically and resulted in euthanasia within approximately 10 seconds.

The Control female mice group did not receive any interventions. The group of female mice with mechanically damaged endometrium and the chemotherapy-induced female mice were designed by the following procedures.

A design of mechanically damaged endometrium model in female mice. To construct a mechanically damaged endometrium model, 27 female mice were anesthetized by 1% to 3% isoflurane inhalation (100 mg/g, Isoflurin, Vetpharma, Spain). Once the mice had no limb reaction, they were placed in a supine position with the limbs gently fixed on the operating table with aseptic pads. The operation area was disinfected by 75% alcohol, and a longitudinal incision of 1.5 cm was made in the low midline abdomen. Ophthalmic forceps were used to lift the skin, and ophthalmic scissors were used to cut the skin layer‑by‑layer longitudinally. A 21-gauge needle was inserted into the connection between the left and right uterus horns, and the right horn was scratched back and forth carefully until the uterus became hyperemic (approximately 10 times) while continuing to maintain the wholeness of the horn. The abdominal cavity was subsequently closed. After 7 days, the affected female mice were divided into three groups: a) the mice group which was euthanized right away and its uterine horns were sent for further analysis (the MechI mice group); b) the mice group which was housed together with male mice for 2 weeks; and c) the mice group which was being prepared for the investigation of hEnSCs treatment impact on the injured endometrium (the MechI-hEnSCs mice group). A few additional steps were required to achieve this goal. First, the abdominal cavity of the mice in the MechI-hEnSCs group was reopened according to the previous protocol. When in the back of the bladder, the bilateral uterus was touched, then straight forceps were used to clamp the right horn in the upper third and in the lower third. hEnSCs (0.5x10⁶ cells/20 μl PBS) suspension was injected directly to the right horn. Subsequently, the abdominal cavity was closed. After 7 days, the MechI-hEnSCs group of mice were divided into another two groups: mice that were euthanized right away with their uterine horn sent for further analysis; and mice that were housed together with male mice for 2 weeks. At the end of the study, the mated female mice were euthanized so the embryo pattern formation could be evaluated.

A design of chemotherapy-induced female mice model. To construct a chemotherapy-induced female mice model, 27 mice were injected once intraperitoneally with cisplatin 120 mg/kg and busulfan 30 mg/kg. After 7 days, the affected female mice were divided into three groups: a) the mice group which was euthanized right away with its uterine horn were sent for further analysis (the CheI mice group); b) the mice group housed together with male mice for 2 weeks; and c) the mice group prepared for the investigation of hEnSCs treatment impact on injured endometrium (the ChEeI-hEnSCs mice group). These mice were anesthetized by 1% to 3% isoflurane inhalation (100 mg/g, Isoflurin, Vetpharma, Spain). Once they had no limb reaction, the mice were placed in a supine position with the limbs gently fixed on the operating table with aseptic pads. The operation area was disinfected by 75% alcohol, and a longitudinal incision of 1.5 cm was made in the low midline abdomen. Ophthalmic forceps were used to lift the skin, and ophthalmic scissors were used to cut the skin layer‑by‑layer longitudinally. When in the back of the bladder, the bilateral uterus was touched and then straight forceps were used to clamp the right horn in the upper third and in the lower third. hEnSCs suspension was injected directly to the right uterine horn and then the abdominal cavity was closed. After 7 days, the CheI-hEnSCs mice were divided into two groups: mice which were euthanized right away with their uterine horn sent for further analysis; and mice which was housed together with male mice.

A fertility assessment of the female mice was performed after 14 days. The studied mice were then euthanized and the number of formed embryos was counted.

RNA isolation from mice organs and gene expression analysis using RT-qPCR

Quick-DNA/RNA Miniprep Kit (Zymo Research, CA, USA) was used to facilitate the total RNA extraction from mice uterus horns. Frozen tissue was first submerged in liquid nitrogen and ground to a powder using a mortar and pestle. Then powder was mixed with about 600 µl of DNA/RNA Lysis Buffer, pipetted and transferred to a Zymo-Spin™ Column and centrifuged at 13 000 g for 1 min. at room temperature. The following isolation steps were done in accordance with manufacturer‘s recommendations to ensure high yield and purity of the RNA samples. cDNA was synthesized using Luna® Universal One-Step the reverse transcription – quantitative polymerase chain reaction (RT-qPCR) Kit (New England Biolabs, Ipswich, MA, USA) in accordance with the manufacturer‘s recommendations. cDNA was then amplified by RT-qPCR using Luna® Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA) in accordance with the manufacturer‘s guidelines. RT-qPCR was performed using Rotor-Gene 6000 Real-time Analyzer (Corbett Life Science, QIAGEN, Hilden, Germany) and cycling conditions were set as follows: initial denaturation 95⁰C 1 min (1 cycle), denaturation 95°C 15 s, primer Tm 60⁰C 30 s (40 cycles). The sequences of forward and reverse primers used in this study are detailed in Table 1. Relative gene expression was calculated using ΔΔCt method and mRNA levels were normalized according to 18S expression.

Table 1. List of primers used for RT-qPCR analysis

Gene name	Forward primer (5‘-3‘)	Reverse primer (5‘-3‘)
18S	GGAAGGGCACCACCAGGAGT	TGCAGCCCCGGACATCTAAG
Col1a1	TCACCAAACTCAGAAGATGTAGGA	GACCAGGAGGACCAGGAAG
Col3a1	ACAGCAGTCCAACGTAGATGAAT	TCACAGATTATGTCATCGCA
Acta2	TTGCTGACAGGATGCAGAAGGAGA	ATCTGCTGGAAGGTAGACAGCGAA
CD44	ATCAGCAGATCGATTTGAATGTAA	CATTTCCTTCTATGAACCCATACC

Evaluation of uterine horns morphology

Samples of uterine horns collected from female mice were fixed in 10% neutral buffered formalin with subsequent paraffin embedding. 3 μm-thick sections were stained with hematoxylin and eosin (H&E) and Masson’s original trichrome in accordance with standard protocol. Digital whole slide images were recorded using a ScanScope XT Slide Scanner (Leica Aperio Technologies, Vista, CA, USA) under 20x objective magnification (0.5-μm resolution) and subsequently subjected to digital image analysis by using HALOTM software (version 3.0311.174; Indica Labs, Corrales, New Mexico, United States). The positive pixel counts based HALO Area Quantification v2.1.3 algorithm was calibrated to recognize fibrosis areas and other surrounding tissues. Pixel intensity values were manually determined by the pathologist. Examples of image analysis output are presented in Fig. 2 and Fig. 4. The repeated manual measurement of the thickness of the total uterine horn wall and its separate layers (10 measurements per each tissue sample) were performed by using HALOTM software.

Statistical analysis

Statistical analysis was performed using GraphPad Prism version 8.0.1 for Windows, GraphPad Software, San Diego, California USA, www.graphpad.com. Data in graphs are represented as mean ± standard deviation (S.D.), while triangular data points indicate outliers determined by ROUT (Q = 5%). The statistical significance of difference was calculated using Mann-Whitney U test, Kruskal-Wallis test and Bonferroni test, significance was set at p ≤ 0.05 (*), p ≤ 0.01 (**), p ≤ 0.001 (***).

Characterization of hEnSCs

The morphology of hEnSCs was observed during cultivation and prior to the injection into different female mice models (Fig. 1). The images indicate that cells had spindle-shaped morphology, were adherent and formed a consistent monolayer. The cells were cultured and further characterized at early passages.

Cell surface analysis by flow cytometry was carried out to ensure that our isolated cells corresponded with basic MSCs properties. hEnSCs were identified as positive with CD44, CD146, CD166 and CD140b cell surface markers (Table 2). Both CD44 and CD166 were determined to be highly positive, exceeding 95%. Moreover, hEnSCs did not express hematopoietic cell surface markers CD34, CD45 and HLA-DR, which were all measured at less than 1%.

Table 2. Identified hEnSCs surface markers

Marker	Name	hEnSCs, %
Endometrial Stem Cell Markers
CD44	Homing cell adhesion molecule (HCAM)	96.7%
CD146	Cell surface glycoprotein MUC18	48.9%
CD166	Activated Leukocyte Cell Adhesion Molecule (ALCAM)	98.3%
CD140b	Beta platelet derived growth factor receptor	94%
Hematopoietic Cell Markers
CD34	Hematopoietic progenitor cell antigen CD34	<1%
CD45	Leukocyte common antigen (LCA)	<1%
HLA-DR	Major histocompatibility complex (MHC) class II cell surface molecule	<1%

Fibrotic transformation under the influence of hEnSCs-treatment in mechanically damaged endometrium model of female mice

An evaluation of fibrosis in different layers of uterine horns (the total wall, the myometrium-endometrium, the myometrium and the endometrium) was performed in 3 different female mice groups (the Control, the MechI and the MechI-hEnSCs) using Masson's trichrome original staining (Fig. 2 D, H, L) and was subsequently statistically analyzed (Fig. 3).

Statistical analysis showed significant differences in the fibrotic area between the Control mice group (Fig. 2 D), the MechI mice group (Fig. 2 H) and the MechI-hEnSCs mice group (Fig. 2 L) in separate layers of mechanically injured uterine horns such as the total wall of uterine horn (Kruskal-Wallis; H = 8.38; df = 2; p = 0.02), the myometrium-endometrium (Kruskal-Wallis; H = 7.28; df = 2; p = 0.03) and the myometrium (Kruskal-Wallis; H = 7.53; df = 2; p = 0.02) (Fig. 3). Conversely, the endometrial fibrosis was significant similar (Kruskal-Wallis; H = 5.58; df = 2; p = 0.06), although this related to the tendencies of the widest fibrotic area in the MechI mice group (Fig. 2 H) and the narrowest fibrotic area in the MechI-hEnSCs mice group (Fig. 2 L) (Fig. 3). Overall, the lowest spread of fibrosis was observed of all layers of uterine horns in MechI-hEnSCs mice group (Fig. 2 L) – the total wall 6.3% (± 1,3%), the myometrium-endometrium 4.1% (± 2.9%), the myometrium 6.0% (± 0.8%) and the endometrium 1.1% (± 1.7%) compared to other study’s groups (Fig. 3).

The Bonferroni post-hoc test revealed that the percentage of fibrosis spread in the total wall and its separate layers – the myometrium and the myometrium-endometrium – was significantly higher in Mech I mice group (Fig. 2 H) compared to MechI-hEnSCs mice group (Fig. 2 L) (Bonferroni test in all cases; p < 0.05), although the differences in mean values between the Control mice group (Fig. 2 D), the MechI mice group (Fig. 2 H) and the MechI-hEnSCs mice group (Fig. 2 L) were not statistically significant (in all cases Bonferroni test; p > 0.05) (Fig. 3).

Fibrotic transformation under the influence of hEnSCs-treatment in chemotherapy-affected female mice model

Evaluation of fibrosis in different layers of uterine horns (the total wall of uterine horn, the myometrium-endometrium, the myometrium and the endometrium) was performed in 3 different female mice groups (the Control, the CheI and the CheI-hEnSCs) using Masson's trichrome original staining (Fig. 4 D, H, L) and then they were statistically analyzed (Fig. 3).

Analysing the intensity of fibrotic area, we detected no significant differences in separate uterine horn layers within the different female mice groups: the total wall of uterine horn (Kruskal-Wallis; H = 1.62; df = 2; p = 0.45), the myometrium-endometrium (Kruskal-Wallis; H = 1.06; df = 2; p = 0,59), the myometrium (Kruskal-Wallis; H = 1.66; df = 2; p = 0.44) and the endometrium (Kruskal-Wallis; H = 0.35; df = 2; p = 0.84) (Fig. 3). However, the highest level of fibrosis was observed in the CheI mice group (Fig. H) in all layers of uterine horns: the total wall of uterine horn 16.9% (± 8.4%), the myometrium-endometrium 14.8% (± 11.3%), the myometrium 21.4% (± 9.8%) and endometrium 8.4 % (± 8.3%) (Fig. 3).

Evaluation of the thickness of uterine horn layers and other morphological changes in female mice groups

An evaluation of the thickness of different uterine horns layers (the total wall of uterine horn and the endometrium) was performed in the Control mice group (Fig. 2 B, Fig. 4 B), mechanically injured endometrium model (Fig. 2 F, J) and chemotherapy-induced model (Fig. 4 F, J) using Masson's trichrome original staining and, after that, statistically analyzed (Fig. 5).

During the study, it was revealed that the widest total wall thickness of uterine horns was observed in the CheI-hEnSCs mice group (1645.3 ± 203.0 µm) (Fig. 4 J), a slightly lower thickness was detected in the CheI group (1539.7 ± 190.5 µm) (Fig. 4 F) and the Control mice group (1500.7 ± 189.7 µm) (Fig. 4 B) (Fig. 5). Overall, the total wall thickness was significantly smaller in the MechI mice group (1315.1 ± 222.0 µm) (Fig. 2 F) and the MechI-hEnSCs mice group (1220.8 ± 241.5 µm) (Fig. 2 J) (Fig. 5).

An evaluation of the endometrial area in all female mice groups revealed that the widest endometrial area, as well as the total wall thickness of uterine horns, was observed in the CheI-hEnSCs mice group (485.1 ± 50.0 µm) (Fig. 4 J) (Fig. 5). In contrastthe result of the Control mice group (367.2 ± 50.6 µm) (Fig. 2 B), the MechI mice group (388.0 ± 72.6 µm) (Fig. 2 F) and the MechI-hEnSCs mice group (320.5 ± 69.3 µm) (Fig. 2 J) showed a thickening of the narrower endometrial area (Fig. 5). It was also seen that the endometrial diameter in all female mice groups was significantly reduced compared to the total wall thickness (in all cases Mann-Whitney U; p ≤ 0.05).

The nonparametric one-way analysis of variance revealed that the endometrial thickness of the Control mice group (Fig. 4 B) and the CheI mice group (Fig. 4 J) was statistically significant (Kruskal-Wallis; H = 6.56; df = 2; p = 0.04) and, moreover, the endometrial thickness in the Control group (Fig. 4 B) was significantly narrow in comparison with the CheI mice group (Fig. 4 F) and the CheI-hEnSCs mice group (both Bonferroni test; p < 0.05) (Fig. 5). Contrary to the endometrial area, the total wall thickness of uterine horns was not statistically different between the Control mice group (Fig. 4 B), the CheI mice group (Fig. 4 F) and the CheI-hEnSCs mice group (Kruskal-Wallis; H = 1.62; df = 2; p = 0.45) (Fig. 4 J) (Fig. 5). There was also a similarity between the Control mice group (Fig. 2 B), the MechI mice group (Fig. 2 F) and the MechI-hEnSCs mice group (Fig. 2 J) in relation to the thickness of endometrium (Kruskal-Wallis; H = 1.67; df = 2; p = 0.44) and the total wall thickness of uterine horns (Kruskal-Wallis; H = 3.72; df = 2; p = 0.16) (Fig. 5).

Some tendencies could be seen according to the morphology assessment by H&E, also. It was observed that in the MechI mice group, the smooth cavity of uterine horn was damaged with the detaching of the endometrium and glandular dilatation (Fig. 6 D-F). Meanwhile, these findings were less pronounced in the MechI-hEnSCs mice group (Fig. 6 G-I) and not expressed in the Control mice group (Fig. 6 A-C). Assessment of the intensity of inflammatory cells infiltration, absent or scant number of lymphocytes and polymorphonuclear cells (PMNs) was observed in the Control mice group (Fig.6 A-C) and the MechI-hEnSCs mice group (Fig. 6 G-I) in contrast with the MechI mice group (Fig. 6 D-F), where moderate amount of PMNs were seen. Evaluating results of apoptosis rate, the moderate number of apoptotic bodies in the MechI mice group (Fig. 6 D-F) were observed. None of these pathological changes were detected in the Control mice group (Fig. 6 A-C) and they showed improvement in the MechI-hEnSCs mice group (Fig. 6 G-I).

However, the distribution results of inflammatory cells and apoptotic bodies when comparing chemotherapy-induced mice groups (Fig. 6 J-L and M-O) and the Control mice group (Fig. 6 A-C) were quite scattered. Overall, the similar tendencies were also seen in the evaluation of mitotic bodies formation in different study’s groups, overall (Fig. 6).

Fertility assessment in different female mice groups

A fertility assessment was performed to evaluate the direct effect of stem cell-based treatment on reproductive function in 5 different female mice groups (the Control, the MechI, the MechI-hEnSCs, the CheI and the CheI-hEnSCs). In the mechanically injured endometrium model, we counted the number of embryos only in the one uterine horn which was affected. Meanwhile, in the chemotherapy-induced female mice, the number of embryos was counted in two uterine horns due to the systematic effect of the medication.

First of all, results from mechanically injured endometrium model showed a lower number of mice embryos in the MechI mice group (2.6 ± 1.1 units) and the MechI-hEnSCs mice group (3,8 ± 1,3 units) in comparison to the Control mice group (5.2 ± 0.8 units) (Fig. 7). Moreover, the number of embryos was significantly different between the Control mice group, the MechI mice group and the MechI-hEnSCs mice group (Kruskal-Wallis; H = 7.72; df = 2; p = 0.02) (Fig. 7). The Bonferroni post-hoc test analysis revealed that the number of mice embryos in the Control mice group was significantly higher than those in the MechI mice group (Bonferroni test; p < 0.05) (Fig. 7). However, there were no significant differences observed between the Control mice group with the MechI-hEnSCs mice group or between the MechI mice group and the MechI-hEnSCs mice group (Bonferroni test in both cases; p > 0.05).

During the study of chemotherapy-induced female mice, the Control mice group was observed to have the highest number of mice embryos (10.8 ± 0.8 units), more than twice the number of embryos was determined in the CheI-hEnSCs mice group (4.6 ± 0.6 units) while the lowest number of embryos was observed in the CheI mice group (2.8 ± 0.8 units) (Fig. 8). Statistical analysis revealed that the number of embryos in the Control mice group, the CheI mice group and the CheI-hEnSCs mice group was significantly different from each other (Kruskal-Wallis; H = 12.28; df = 2; p = 0.002) (fig. 8). It was also found that the Control mice group had a significantly higher number of embryos than the CheI-hEnSCs group (both Bonferroni test; p < 0.05), although the fecundity of the CheI-hEnSCs group mice was significantly higher than the CheI mice group (Bonferroni test; p < 0.05).

Gene expression analysis in uterine horn tissue from different female mice groups

Expression analysis of genes involved in fibrosis process was performed with 5 different female mice groups (the Control, the MechI, the MechI-hEnSCs, the CheI and the CheI-hEnSCs) using RNA extracted from their uterine horn tissue samples (Fig. 9).

The discussed genes Col1a1 (Collagen, type I, alpha 1), Col3a1 (Collagen, type III, alpha 1), Acta2 (Actin alpha 2, smooth muscle) have been shown to have an association with excess fibrosis and wound healing [40–42], and CD44 gene is associated with the binding of extracellular matrix molecules, such as collagen, fibronectin and osteopontin [43]. Gene expression analysis revealed that Col1a1 gene was upregulated in all of the female mice groups receiving interventions, compared to Control mice group, although, only two of which were considered to be statistically significant (Fig. 9). Col1a1 gene was upregulated significantly in the MechI mice group and the CheI mice group (Fig. 9). The expression of Col3a1 gene throughout different group was determined to be at a very similar level to the Control mice group, although a slight upregulation can be seen in the CheI-hEnSCs mice group when compared to the CheI group. In all groups, CD44 was downregulated in comparison to the Control mice group while values of relative gene expression remained at a similar level between the different mice groups. Acta2 gene was upregulated in the MechI-hEnSCs mice group in comparison to the MechI mice group, although the results were not significant.

Fertility is an issue that affects many parameters of peoples’ lives, as individuals and as a couple. Nevertheless, while the main factors for the successful implantation are recognized as implantation competency of the embryo , a receptive state for the endometrium along with synchronized development for both of them, reproductive health disorders remain a significant problem [44], especially, endometrial-factor induced infertility. The lack of clear understanding of this pathology, along with conflicting theoretical and practical results from different studies have aggravated the impact of this situation to the point where couples facing this issue turn to alternatives such as surrogacy, uterine transplantation, adoption or they even choose to remain childless. Meanwhile, new strategies of diagnosis and treatment are being investigated.

Stem cell-based therapies have proved to be a promising treatment option for treating autoimmune, inflammatory, neurological, orthopaedic conditions and traumatic injuries, and could also be used for infertility. The implied mechanism of stem cells in the repair of reproductive dysfunction involves the following procedure: first the stem cells migrate to the injured reproductive tissues caused by chemokines, and then they differentiate and integrate somatic cells with non-tumorigenic properties [22]. The human endometrium provides unique material in comparison to other adult tissues due to the cyclical nature of endometrial expansion, maturation and shedding, after which it again remarkably regenerates. Therefore the endometrium itself is considered to be an excellent source of stem cells and, moreover, hEnSCs are considered to have great promise for the therapy of reproductive system disorders [33].

The aim of this study was to deepen the investigation of the endometrial-factor induced infertility and hEnSCs-based treatment role on it using multifactorial analysis consisted from the histological assessment, gene expression analysis and fertility assay.

First of all, in the present study we confirmed that the endometrium scratching procedure performed for female undergoing ART procedures due to couple infertility is an effective tool for the collection of stem cells. Isolated MSCs from endometrium samples, which were collected through endometrium scratching procedures, had a fibroblastic-like appearance with adherent property to the culture plate, expressed mesenchymal stem cells markers CD44 and CD166 and, did not express hematopoietic cell surface markers CD34, CD45 and HLA-DR. These findings fulfil the minimal criteria to define human MSCs proposed by Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy (ISCT) [45–47]. The findings negate the uncertainty about endometrium scratching usage for stem cells collection and lead us to clearly confirm that not only stratum basalis, but, also, stratum functionalis could be used for the isolation of stem cells with high proliferation, self-renewal and differentiation potential characteristics of hEnSCs [48–51]. The evidence that hEnSCs can be easily and repeatedly isolated without leading to major technical problems or causing inconvenience to patients – such as the need for hospitalization or anaesthesia – is worthwhile for stem cells-based therapy implementation in clinical practise [52,53].

Further, embryo implantation is a precise process, in which various factors come into play one after the other, so we decided to extended used models to evaluate the effectiveness of hEnSCS therapy for induced infertility [48,53–56]. In this way, we combined three evaluation methods – histological assessment, gene expression analysis and fertility assay – in pursuit of a broader view which could provide new insights for understanding related mechanisms and investigate treatment strategies.

According to multivarious study results, mechanically injury of the endometrium or intraperitoneal chemotherapy was observed to be capable of causing clear negative impact on uterine tissues and, most importantly, conceiving. The significantly wider fibrotic area was measured in the total wall of uterine horns and their separate layers – the myometrium and the myometrium-endometrium in untreated mice group with the mechanically injured endometrium compared to the mice group with mechanically injured endometrium, which received hEnSCs, although the differences in mean values between both of these groups and the Control mice group were not statistically significant. The same tendencies were seen in the chemotherapy-induced mice group where the highest level of fibrosis in all uterine horns’ layers was observed in the mice group which did not receive hEnSCs in comparison with treated mice group and the Control mice group. These findings could be explained by the activity of hEnSCs. They are characterized by the broad differentiation potential, highly efficient self-renewal and remarkable immunomodulatory capacity to migrate to the injured reproductive tissues caused by chemokines, before they differentiate and integrate somatic cells with non-tumorigenic properties [22,57,58]. It creates conditions for slowing down the progression of fibrosis and (or) replacing damaged tissues [58–60]. The ability of MSCs to relieve the fibrotic diseases by modulating inflammation, regenerating damaged tissues and modulating the death of stressed cells was also confirmed in the following results [61].

According to the assessment of other morphology elements, it was observed that hEnSCs-based therapy can reduce the infiltration of inflammation factors such as PMNs and lymphocytes, and apoptotic bodies in uterine horns. The density of inflammatory cells was higher in the untreated mice group with mechanically injured endometrium compared to the treated mice groups and the Control mice group. Also, the rate of apoptotic bodies was higher pronounced in mechanically injured mice group with hEnSCs compared with treated mice group and the Control group. These repeated tendencies were also seen in fertility assessment of female mice.

During the study, the higher fertility rate was observed in harmfully affected mice groups which received stem cells therapy, even with a significant difference between the chemotherapy-induced female mice model, which did not receive stem cells and the chemotherapy-induced female mice model, which were treated.

The observed tendencies of morphological changes and fertility assessment in different groups of female mice are fairly strong confirmation of the relationships between both of them and could be explained by several known physiological mechanisms.

First of all, the fibrotic endometrium is characterized by poor epithelial growth, poor vascular development, impaired endometrium function and the displacement of extracellular matrix by the fibrous connective tissues, which can lead to uterine cavity degeneration, progression to intrauterine adhesions or Asherman‘s syndrome and, ultimately to embryo implantation dysfunction and consequent infertility or spontaneous abortion [62–64]. Secondly, apoptosis is a form of programmed cell death in which cells condense and fragment their nuclear material, cytoplasmic material, and then release their contents in membrane-bound apoptotic bodies [65]. In this way, apoptotic bodies may contain a wide variety of cellular components such as micronuclei, chromatin remnants, cytosol portions, degraded proteins, DNA fragments, or even intact organelles and other metabolites which could negatively affect even gene expression [66–68]. An imbalance of apoptotic bodies clearance could cause harmful exposure to the inflammatory and immunogenic contents of dying cells, ultimately causing implantation failure and consecutive pregnancy complications [69–71]. Moreover, few studies concluded that some substance derived from PMNs may exert toxic effects on fertilized oocytes or on spermatozoa and could thus be responsible for the endometrial-factor induced infertility [72]. Also, a variation of endometrial natural killer, T and B lymphocyte populations including upregulation of them, have all been proposed as contributory factors to adverse reproductive failure outcome such as repeated implantation failure and recurrent pregnancy loss [73–75]. However, there is still a lack of study into each subtype, including their concentrations in the endometrium and mechanisms of activity. Further research is essential not only in the inflammatory process, but also in other fields.

The measurement of the endometrial thickness and the total diameter of the uterine horns showed controversial results, especially when studying the chemotherapy-induced mice groups. The endometrial thickness in the Control mice group was significantly narrow compared with the chemotherapy-induced mice groups that nevertheless received hEnSCs-based therapy. The total wall thickness of uterine horns was not statistically different between these three groups of female mice, although the shortest diameter was measured in the Control mice group. Moreover, the frequency of the distribution of inflammatory cells and apoptotic bodies between chemotherapy-induced mice groups and the Control mice group was quite scattered. These results are quite unexpected because it is well known that chemotherapy is one of the main cause of premature ovarian failure [76–78] which is characterized by hypoestrogenism and, eventually, the endometrium atrophy. This limitation might be related to several factors, including the need for more time to develop premature ovarian failure. Some pre-processing issues were also agreed: during gross examination, the cross sections of uterine horns were selected as thick as possible for further paraffin-embedding procedure in order to receive well-represented cross-sections of tissues and facilitate the whole procedure. Future perspective for overcoming this limitation is applying a more standardised gross section procedure which targets for more systemic tissue sampling regardless of the thickness of uterine horns.

Meanwhile, the last step of our study was to evaluate relationships between the expression of certain genes profile and different groups of female mice. It was observed that Col1a1 gene was upregulated in all mice groups with mechanically injured endometrium and chemotherapy-induced mice groups with the statistically significant increase in the harmfully affected mice groups without hEnSCs therapy. Col1a1 encodes the major component of type I collagen, the fibrillar collagen found in most connective tissues. According to the fact that gene expression is regulated by both extrinsic and intrinsic factors to the cell and interplay between them [79,80], it could be hypothesized that stem cells-based therapy can reduce or even prevent formation of excessive fibrosis through transcriptional changes. Also, interesting insights could be made after the evaluation of Acta2 gene profile expression in different female mice groups. Acta2 encodes smooth muscle actin - Actin alpha 2. It was seen upregulation of Acta2 gene expression in the mechanically injured mice group which received hEnSCs compared with the same affected mice group which was not treated. Actin proteins are essential for the cell structure, and they are also involved in the process of cell motility, integrity, and intercellular signalling [81]. Moreover, Acta2 is one of 6 different actin isoforms and is involved in the contractile apparatus of smooth muscle; mutation in this gene can cause a variety of vascular diseases, such as multisystemic smooth muscle dysfunction syndrome [81]. In this way, downregulation of Acta2 gene expression can be associated with the abnormal uterine contractility which may contribute to endometrium-factor induced infertility. Considering the extensive growth of the genetic and epigenetic studies, it is believed that more clarification of actual relations between stem cells activity, gene profile expression and reproductive health disorders will come.

Failure to achieve a pregnancy and successful live birth due to the endometrial-factor induced infertility is one of the major challenges in the field of reproductive medicine.

Given the study results, hEnSCs are an attractive target for endometrium-factor induced infertility. Isolated hEnSCs have demonstrated a positive impact on the repair of mechanically injured endometrium and chemotherapy-induced endometrium with – most importantly – successful pregnancy outcomes. Moreover, it becomes apparent that stem cells can be successfully isolated from endometrium samples collected through routine gynaecological procedure such as endometrium scratching or endometrium biopsy. This finding increases the flexibility and effectiveness of stem cells collection procedure with help to decrease inconvenience to patients. Also, our study presented that a combination of multifactorial analysis could be valuable for the deeper understanding of the endometrial-factor induced infertility and, probably other endometrium pathologies.

Overall, generated results encourage the continuation of further research in order to discover new insights in this field with the hope of identifying safe and individually effective treatment strategies in mechanical injured or chemotherapy induced endometrial-factor infertility in daily clinical practise.

ALCAM: Activated Leukocyte Cell Adhesion Molecule

ARRIVE: Animal Research: Reporting of In Vivo Experiments

ART: Assisted reproductive technology

BSA: Bovine serum albumin

FBS: Fetal bovine serum

H&E: hematoxylin and eosin

hEnSCs: Human endometrial-derived mesenchymal stromal cells

HCAM: Homing cell adhesion molecule

ICSI: Intracytoplasmic sperm injection

ISCT: The International Society for Cellular Therapy

IVF: In vitro fertilization

LCA: Leukocyte common antigen

MHC: Major histocompatibility complex

MSCs: Mesenchymal stem cells

PBS: Phosphate-buffered saline

PMNs: Polymorphonuclear cells

RT-qPCR: Reverse transcription-quantitative polymerase chain reaction

S.D.: Standard deviation

Ethics approval and consent to participate. The study “Therapeutic potential of human endometrial stem sells“ was approved by the Ethics Committee of Biomedical Research of Vilnius Region, No. 158200-18/7-1049-550 (29/06/2018). All participants received written and oral information and signed informed consent before the study.

Consent for publication. Not applicable.

Availability of data and materials. The data and materials used and analyzed underlying this article are available from the corresponding author on reasonable request.

Competing interests. The authors declare no competing or conflict interests.

Funding. This study received no external funding.

Authors' contributions

RB: designed the study, selected patients for the study, performed clinical interventional procedures and experiments with animals, summarized results of the histological changes, gene expression and fertility assessment, performed statistical analysis, wrote the original draft.

BV: designed the study, selected patients for the study, performed clinical interventional procedures and performed experiments with animals, reviewed and edited of the manuscript.

VB: designed the study, performed experiments with animals, reviewed and edited of the manuscript.

EV: isolated and cultivated hEnSCs from collected endometrium samples, analyzed gene expression by the RT-qPCR and interpretated obtained results, performed statistical analysis and visualization of the manuscript.

JB: applied Masson‘s trichrome original staining and H&E staining, calibrated digital image analysis algorithms and performed measurements on digitalized images of uterine horns, analyzed and interpretated results of histological changes, performed visualization of the manuscript.

RBV: applied Masson‘s trichrome original staining and H&E staining, evaluated histological changes of uterine horn layers, analyzed and interpretated results of histological changes, performed visualization of the manuscript.

EK: validated data, performed review and editing of the manuscript.

DR: conceptualized the study, curated the data, validated the data, performed review and editing of the manuscript.

RN: conceptualized the study, supervised study performing and writing processes, performed review and editing of the manuscript.

All authors read and approved the final manuscript.

Acknowledgements. Not applicable.

ESHRE Capri Workshop Group. Social determinants of human reproduction. Hum Reprod. 2001;16:1518–26.
Lessey BA, Young SL. What exactly is endometrial receptivity? Fertil Steril. 2019;111:611–7.
Heger A, Sator M, Pietrowski D. Endometrial Receptivity and its Predictive Value for IVF/ICSI-Outcome. Geburtsh Frauenheilk. 2012;72:710–5.
Liu KE, Hartman M, Hartman A, Luo Z-C, Mahutte N. The impact of a thin endometrial lining on fresh and frozen-thaw IVF outcomes: an analysis of over 40 000 embryo transfers. Hum Reprod. 2018;33:1883–8.
Mahutte N, Hartman M, Meng L, Lanes A, Luo Z-C, Liu KE. Optimal endometrial thickness in fresh and frozen-thaw in vitro fertilization cycles: an analysis of live birth rates from 96,000 autologous embryo transfers. Fertil Steril. 2022;117:792–800.
Yuan X, Saravelos SH, Wang Q, Xu Y, Li T-C, Zhou C. Endometrial thickness as a predictor of pregnancy outcomes in 10787 fresh IVF-ICSI cycles. Reprod Biomed Online. 2016;33:197–205.
Bu Z, Hu L, Su Y, Guo Y, Zhai J, Sun Y-P. Factors related to early spontaneous miscarriage during IVF/ICSI treatment: an analysis of 21,485 clinical pregnancies. Reprod Biomed Online. 2020;40:201–6.
Rombauts L, McMaster R, Motteram C, Fernando S. Risk of ectopic pregnancy is linked to endometrial thickness in a retrospective cohort study of 8120 assisted reproduction technology cycles. Hum Reprod. 2015;30:2846–52.
Liu H, Zhang J, Wang B, Kuang Y. Effect of endometrial thickness on ectopic pregnancy in frozen embryo transfer cycles: an analysis including 17,244 pregnancy cycles. Fertil Steril. 2020;113:131–9.
Jing S, Li X, Zhang S, Gong F, Lu G, Lin G. The risk of placenta previa and cesarean section associated with a thin endometrial thickness: a retrospective study of 5251 singleton births during frozen embryo transfer in China. Arch Gynecol Obstet. 2019;300:1227–37.
R M, S B, A S, M DG, C DG. Endometrial thickness influences neonatal birth weight in pregnancies with obstetric complications achieved after fresh IVF-ICSI cycles. Archives of gynecology and obstetrics [Internet]. Arch Gynecol Obstet; 2017 [cited 2022 Nov 15];296. Available from: https://pubmed.ncbi.nlm.nih.gov/28589476/
Guo Z, Xu X, Zhang L, Zhang L, Yan L, Ma J. Endometrial thickness is associated with incidence of small-for-gestational-age infants in fresh in vitro fertilization-intracytoplasmic sperm injection and embryo transfer cycles. Fertil Steril. 2020;113:745–52.
Ribeiro VC, Santos-Ribeiro S, De Munck N, Drakopoulos P, Polyzos NP, Schutyser V, et al. Should we continue to measure endometrial thickness in modern-day medicine? The effect on live birth rates and birth weight. Reprod Biomed Online. 2018;36:416–26.
Oron G, Hiersch L, Rona S, Prag-Rosenberg R, Sapir O, Tuttnauer-Hamburger M, et al. Endometrial thickness of less than 7.5 mm is associated with obstetric complications in fresh IVF cycles: a retrospective cohort study. Reprod Biomed Online. 2018;37:341–8.
AAGL Practice Report: Practice Guidelines on Intrauterine Adhesions Developed in Collaboration With the European Society of Gynaecological Endoscopy (ESGE). Journal of Minimally Invasive Gynecology. Elsevier; 2017;24:695–705.
Santamaria X, Liu JH, Lusine A, Isaacson K, Movilla P, Fernandez H, et al. Should we consider alternative therapies to operative hysteroscopy for the treatment of Asherman syndrome? Fertility and Sterility. Elsevier; 2020;113:511–21.
Strug M, Aghajanova L. Making More Womb: Clinical Perspectives Supporting the Development and Utilization of Mesenchymal Stem Cell Therapy for Endometrial Regeneration and Infertility. J Pers Med. 2021;11:1364.
Ranisavljevic N, Raad J, Anahory T, Grynberg M, Sonigo C. Embryo transfer strategy and therapeutic options in infertile patients with thin endometrium: a systematic review. J Assist Reprod Genet. 2019;36:2217–31.
Mouanness M, Ali-Bynom S, Jackman J, Seckin S, Merhi Z. Use of Intra-uterine Injection of Platelet-rich Plasma (PRP) for Endometrial Receptivity and Thickness: a Literature Review of the Mechanisms of Action. Reprod Sci. 2021;28:1659–70.
Fossett E, Khan WS, Longo UG, Smitham PJ. Effect of age and gender on cell proliferation and cell surface characterization of synovial fat pad derived mesenchymal stem cells. J Orthop Res. 2012;30:1013–8.
Song Y-T, Liu P-C, Tan J, Zou C-Y, Li Q-J, Li-Ling J, et al. Stem cell-based therapy for ameliorating intrauterine adhesion and endometrium injury. Stem Cell Res Ther. 2021;12:556.
Wu J-X, Xia T, She L-P, Lin S, Luo X-M. Stem Cell Therapies for Human Infertility: Advantages and Challenges. Cell Transplant. 2022;31:9636897221083252.
Wang J, Liu C, Fujino M, Tong G, Zhang Q, Li X-K, et al. Stem Cells as a Resource for Treatment of Infertility-related Diseases. Curr Mol Med. 2019;19:519–46.
Musiał-Wysocka A, Kot M, Majka M. The Pros and Cons of Mesenchymal Stem Cell-Based Therapies. Cell Transplant. 2019;28:801–12.
Lukomska B, Stanaszek L, Zuba-Surma E, Legosz P, Sarzynska S, Drela K. Challenges and Controversies in Human Mesenchymal Stem Cell Therapy. Stem Cells Int. 2019;2019:9628536.
Lee SH. The advantages and limitations of mesenchymal stem cells in clinical application for treating human diseases. Osteoporos Sarcopenia. 2018;4:150.
Tipnis S, Viswanathan C, Majumdar AS. Immunosuppressive properties of human umbilical cord-derived mesenchymal stem cells: role of B7-H1 and IDO. Immunol Cell Biol. 2010;88:795–806.
Hs T. Endometrial cells derived from donor stem cells in bone marrow transplant recipients. JAMA [Internet]. JAMA; 2004 [cited 2022 Nov 15];292. Available from: https://pubmed.ncbi.nlm.nih.gov/15238594/
Mints M, Jansson M, Sadeghi B, Westgren M, Uzunel M, Hassan M, et al. Endometrial endothelial cells are derived from donor stem cells in a bone marrow transplant recipient. Hum Reprod. 2008;23:139–43.
Fuoco NL, de Oliveira RG, Marcelino MY, Stessuk T, Sakalem ME, Medina DAL, et al. Efficient isolation and proliferation of human adipose-derived mesenchymal stromal cells in xeno-free conditions. Mol Biol Rep. 2020;47:2475–86.
Chen L, Qu J, Cheng T, Chen X, Xiang C. Menstrual blood-derived stem cells: toward therapeutic mechanisms, novel strategies, and future perspectives in the treatment of diseases. Stem Cell Res Ther. 2019;10:406.
Phermthai T, Tungprasertpol K, Julavijitphong S, Pokathikorn P, Thongbopit S, Wichitwiengrat S. Successful derivation of xeno-free mesenchymal stem cell lines from endometrium of infertile women. Reprod Biol. 2016;16:261–8.
Figueira PGM, Abrão MS, Krikun G, Taylor HS, Taylor H. Stem cells in endometrium and their role in the pathogenesis of endometriosis. Ann N Y Acad Sci. 2011;1221:10–7.
Zhang L, Li Y, Guan C-Y, Tian S, Lv X-D, Li J-H, et al. Therapeutic effect of human umbilical cord-derived mesenchymal stem cells on injured rat endometrium during its chronic phase. Stem Cell Research & Therapy. 2018;9:36.
Phermthai T, Odglun Y, Julavijitphong S, Titapant V, Chuenwattana P, Vantanasiri C, et al. A novel method to derive amniotic fluid stem cells for therapeutic purposes. BMC Cell Biol. 2010;11:79.
Lin Y, Dong S, Ye X, Liu J, Li J, Zhang Y, et al. Synergistic regenerative therapy of thin endometrium by human placenta-derived mesenchymal stem cells encapsulated within hyaluronic acid hydrogels. Stem Cell Res Ther. 2022;13:66.
Ouyang X, You S, Zhang Y, Zhang C, Zhang G, Shao X, et al. Transplantation of Human Amnion Epithelial Cells Improves Endometrial Regeneration in Rat Model of Intrauterine Adhesions. Stem Cells Dev. 2020;29:1346–62.
Abuwala N, Tal R. Endometrial stem cells: origin, biological function, and therapeutic applications for reproductive disorders. Curr Opin Obstet Gynecol. 2021;33:232–40.
Tavakol S, Azedi F, Hoveizi E, Ai J, Joghataei MT. Human Endometrial Stem Cell Isolation from Endometrium and Menstrual Blood. Bio Protoc. 2018;8:e2693.
Szóstek-Mioduchowska AZ, Lukasik K, Skarzynski DJ, Okuda K. Effect of transforming growth factor -β1 on α-smooth muscle actin and collagen expression in equine endometrial fibroblasts. Theriogenology. 2019;124:9–17.
Liu X, Wu H, Byrne M, Krane S, Jaenisch R. Type III collagen is crucial for collagen I fibrillogenesis and for normal cardiovascular development. Proc Natl Acad Sci U S A. 1997;94:1852–6.
Cutroneo KR, White SL, Phan SH, Ehrlich HP. Therapies for bleomycin induced lung fibrosis through regulation of TGF-beta1 induced collagen gene expression. J Cell Physiol. 2007;211:585–9.
Foster LC, Arkonac BM, Sibinga NE, Shi C, Perrella MA, Haber E. Regulation of CD44 gene expression by the proinflammatory cytokine interleukin-1beta in vascular smooth muscle cells. J Biol Chem. 1998;273:20341–6.
Teh W-T, McBain J, Rogers P. What is the contribution of embryo-endometrial asynchrony to implantation failure? J Assist Reprod Genet. 2016;33:1419–30.
Baghaei K, Hashemi SM, Tokhanbigli S, Asadi Rad A, Assadzadeh-Aghdaei H, Sharifian A, et al. Isolation, differentiation, and characterization of mesenchymal stem cells from human bone marrow. Gastroenterol Hepatol Bed Bench. 2017;10:208–13.
Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8:315–7.
Machado C de V, Telles PD da S, Nascimento ILO. Immunological characteristics of mesenchymal stem cells. Rev Bras Hematol Hemoter. 2013;35:62–7.
Hu J, Song K, Zhang J, Zhang Y, Tan B-Z. Effects of menstrual blood-derived stem cells on endometrial injury repair. Mol Med Rep. 2019;19:813–20.
Gargett CE, Masuda H. Adult stem cells in the endometrium. Mol Hum Reprod. 2010;16:818–34.
Schwab KE, Gargett CE. Co-expression of two perivascular cell markers isolates mesenchymal stem-like cells from human endometrium. Hum Reprod. 2007;22:2903–11.
Cousins FL, Filby CE, Gargett CE. Endometrial Stem/Progenitor Cells–Their Role in Endometrial Repair and Regeneration. Frontiers in Reproductive Health [Internet]. 2022 [cited 2022 Nov 14];3. Available from: https://www.frontiersin.org/articles/10.3389/frph.2021.811537
Mobarakeh ZT, Ai J, Yazdani F, Sorkhabadi SMR, Ghanbari Z, Javidan AN, et al. Human endometrial stem cells as a new source for programming to neural cells. Cell Biol Int Rep (2010). 2012;19:e00015.
Human amniotic epithelial cells improve fertility in an intrauterine adhesion mouse model | Stem Cell Research & Therapy | Full Text [Internet]. [cited 2022 Nov 15]. Available from: https://stemcellres.biomedcentral.com/articles/10.1186/s13287-019-1368-9
Alawadhi F, Du H, Cakmak H, Taylor HS. Bone Marrow-Derived Stem Cell (BMDSC) transplantation improves fertility in a murine model of Asherman’s syndrome. PLoS One. 2014;9:e96662.
Archibong AE, Sharan C, Al-Hendy A. Intervention of chemotherapy-induced ovarian failure/infertility using diploid cell therapy. Fertility and Sterility. Elsevier; 2011;96:S125.
Jiang Y, Zhao J, Qi H, Li X, Zhang S, Song DW, et al. Accelerated ovarian aging in mice by treatment of busulfan and cyclophosphamide. J Zhejiang Univ Sci B. 2013;14:318–24.
Valatkaitė E, Baušytė R, Vitkevičienė A, Ramašauskaitė D, Navakauskienė R. Decidualization Potency and Epigenetic Changes in Human Endometrial Origin Stem Cells During Propagation. Front Cell Dev Biol. 2021;9:765265.
Wiśniewska J, Sadowska A, Wójtowicz A, Słyszewska M, Szóstek-Mioduchowska A. Perspective on Stem Cell Therapy in Organ Fibrosis: Animal Models and Human Studies. Life. Multidisciplinary Digital Publishing Institute; 2021;11:1068.
Nie C, Yang D, Xu J, Si Z, Jin X, Zhang J. Locally Administered Adipose-Derived Stem Cells Accelerate Wound Healing through Differentiation and Vasculogenesis. Cell Transplant. SAGE Publications Inc; 2011;20:205–16.
Park S-R, Kim J-W, Jun H-S, Roh JY, Lee H-Y, Hong I-S. Stem Cell Secretome and Its Effect on Cellular Mechanisms Relevant to Wound Healing. Molecular Therapy. Elsevier; 2018;26:606–17.
Mesenchymal stem cells in fibrotic diseases—the two sides of the same coin | Acta Pharmacologica Sinica [Internet]. [cited 2022 Nov 14]. Available from: https://www.nature.com/articles/s41401-022-00952-0
Cai H, Li H, He Y. Interceed and Estrogen Reduce Uterine Adhesions and Fibrosis and Improve Endometrial Receptivity in a Rabbit Model of Intrauterine Adhesions. Reprod Sci. 2016;23:1208–16.
Bai X, Liu J, Cao S, Wang L. Mechanisms of endometrial fibrosis and the potential application of stem cell therapy. Discov Med. 2019;27:267–79.
Deans R, Abbott J. Review of intrauterine adhesions. J Minim Invasive Gynecol. 2010;17:555–69.
Kerr JF, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer. 1972;26:239–57.
Zeng C, Shao Z, Li J, Pan H, Xing F. Commentary: Metabolites released from apoptotic cells act as tissue messengers. Frontiers in Immunology [Internet]. 2020 [cited 2022 Nov 14];11. Available from: https://www.frontiersin.org/articles/10.3389/fimmu.2020.01878
Medina CB, Mehrotra P, Arandjelovic S, Perry JSA, Guo Y, Morioka S, et al. Metabolites released from apoptotic cells act as tissue messengers. Nature. 2020;580:130–5.
Battistelli M, Falcieri E. Apoptotic Bodies: Particular Extracellular Vesicles Involved in Intercellular Communication. Biology (Basel). 2020;9:E21.
Maderna P, Godson C. Phagocytosis of apoptotic cells and the resolution of inflammation. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2003;1639:141–51.
Fadok VA, Bratton DL, Frasch SC, Warner ML, Henson PM. The role of phosphatidylserine in recognition of apoptotic cells by phagocytes. Cell Death Differ. 1998;5:551–62.
Savill J, Dransfield I, Gregory C, Haslett C. A blast from the past: clearance of apoptotic cells regulates immune responses. Nat Rev Immunol. 2002;2:965–75.
Parr EL, Schaedler RW, Hirsch JG. The relationship of polymorphonuclear leukocytes to infertility in uteri containing foreign bodies. J Exp Med. 1967;126:523–38.
Csabai T, Pallinger E, Kovacs AF, Miko E, Bognar Z, Szekeres-Bartho J. Altered Immune Response and Implantation Failure in Progesterone-Induced Blocking Factor-Deficient Mice. Frontiers in Immunology [Internet]. 2020 [cited 2022 Nov 14];11. Available from: https://www.frontiersin.org/articles/10.3389/fimmu.2020.00349
Marron K, Harrity C. Endometrial lymphocyte concentrations in adverse reproductive outcome populations. J Assist Reprod Genet. 2019;36:837–46.
Robertson SA, Care AS, Moldenhauer LM. Regulatory T cells in embryo implantation and the immune response to pregnancy. J Clin Invest. 2018;128:4224–35.
Torrealday S, Kodaman P, Pal L. Premature Ovarian Insufficiency - an update on recent advances in understanding and management [Internet]. F1000Research; 2017 [cited 2022 Nov 14]. Available from: https://f1000research.com/articles/6-2069
Mauri D, Gazouli I, Zarkavelis G, Papadaki A, Mavroeidis L, Gkoura S, et al. Chemotherapy Associated Ovarian Failure. Frontiers in Endocrinology [Internet]. 2020 [cited 2022 Nov 14];11. Available from: https://www.frontiersin.org/articles/10.3389/fendo.2020.572388
Ovarian damage from chemotherapy and current approaches to its protection | Human Reproduction Update | Oxford Academic [Internet]. [cited 2022 Nov 14]. Available from: https://academic.oup.com/humupd/article/25/6/673/5585503?login=false
Kabir MH, O’Connor MD. Stems cells, big data and compendium-based analyses for identifying cell types, signalling pathways and gene regulatory networks. Biophys Rev. 2019;11:41–50.
Gene Expression Regulates Cell Differentiation | Learn Science at Scitable [Internet]. [cited 2022 Nov 16]. Available from: https://www.nature.com/scitable/topicpage/gene-expression-regulates-cell-differentiation-931/
ACTA2 actin alpha 2, smooth muscle [Homo sapiens (human)] - Gene - NCBI [Internet]. [cited 2022 Nov 14]. Available from: https://www.ncbi.nlm

ARRIVEChecklistE10.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

The role of human endometrial stem cells application in endometrial-factor induced infertility

Status:

Version 1

Abstract

Figures

1. Background

2. Materials and Methods

3. Results

4. Discussion

5. Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1