Human papilloma virus profiles in breast cancer in correlation with Vitamin D

doi:10.21203/rs.3.rs-2374933/v1

Download PDF

Research Article

Human papilloma virus profiles in breast cancer in correlation with Vitamin D

https://doi.org/10.21203/rs.3.rs-2374933/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The presence of the vitamin D receptor on the surface of breast tissue active results in terminal differentiation and inhibition of cell growth. The implication of vitamin D deficiency on cancer susceptibility found an association between low serum 25(OH) D3 levels and increased prevalence of breast cancer genesis. The risk factors incriminated in the genesis of breast cancer are well known, there is the involvement of certain oncogenic viruses, particularly HPV. In this, study 22 patients with breast cancer with a dosage of vitamin D less than normal with HPV infection. No significance between Clinicopathological parameters and vitamin D assay.

Vitamin D

Human papilloma virus (HPV)

Breast cancer

VDR

Vitamin D is one of the major components of phosphocalcic metabolism. The relatively low plasma levels of calcium and phosphorus will be accurately adjusted from inputs, outputs and bone stock to maintain phosphocalcic homeostasis and skeletal mineralization. Vitamin D contributes to this balance (Hossain et al., 2019). Vitamin D has a double exogenous origin: food, including supplements, provides D2 and D3, endogenous: skin synthesis of the form D3 only. Only 10–20% of circulating vitamin D comes from the diet (apart from any supplementation) (Briot et al., 2009). It contains vitamin D2 and vitamin D3 which will be absorbed at the intestinal level.

The vitamin D content in food or drugs can be expressed in International Units (IU) or micrograms (µg): 1 IU = 0.025 µg or 1 µg = 40 IU. (Benedik et al., 2021).

1,25(OH) 2 D must bind to the vitamin D receptor (VDR) to perform its functions. VDR is a nuclear receptor that belongs to the family of nuclear steroid receptors. It binds to 1.25(OH) 2 D, with a very high affinity, which is consistent with the low levels of hormone found in the circulation. The affinity of 25(OH)D and other metabolites for VDR is two orders of magnitude lower, and 25(OH)D binds to VDR only if it is present at levels high enough to compensate for its low affinity. (Bagheri-Hosseinabadi et al., 2020).

VDR is a nuclear receptor, whose general structure is characteristic of other steroid receptors in the superfamily, such as the glucocorticoid receptor and the estrogen receptor.

Many epidemiological studies have found a significant association between low serum levels of 25(OH)D and the development of some cancers. The hypothesis of a potential relationship between vitamin D and cancer was first suggested by geographical observations

According to the cancer diagnosis support the hypothesis of an inverse correlation between serum vitamin D levels and breast neoplasia. (Rosso et al., 2022).

The level of vitamin D plays a role in maintaining the functioning of the immune system which can promote another risk of cancer by a viral infection, especially DNA viruses, especially HPV. (Fathi et al., 2019).

Blood samples

This study included a total of 63 people in two groups: 53 breast cancer patients and 10 control women. The patients are women with breast cancer diagnosed at the National Institute of Oncology (INO) in Rabat, during the period from November 2021 to February 2022. Blood samples were taken before the start of any treatment (surgery, chemotherapy or radiation). Required Ethical approval was obtained from the committee of biomedical research ethics in Morocco (No. 3/2018/30 April/2018-Morocco).

Determination Of Vitamin D

The blood samples are collected on dry tubes with separating gel, sent from Rabat to the biology center of Casablanca certified iso 9001V 2015. The determination of total vitamin D is carried out on the VIDAS-3 automat on the luminescence chemistry technique.

Dna Extraction

DNA extraction from breast cancer fresh biopsies performed by using the Kit PureLink Genomic DNA (Invitrogen). Aliquots of 25 mg of samples were digested with 20 µl of proteinase K and 180 µl of Digestion buffer at 55ºC, for 1 to 4 hours. DNA precipitation was performed by adding 200 µl of ethanol (90%). DNA was eluted in 25 to 50 µl of Elution buffer and stored at -20ºC until further use. DNA was quantified using the Nanodrop spectrophotometer. Samples with a DNA concentration of 20–50 ng/µl or above were selected to perform the polymerase chain reaction.

Internal Control

The samples were checked by internal control for β-globin gene by PCR. Using the primers PCO4(5’CAACTTCATCCACGTTCACC3’)and GH20 (5’GAAGAGCCAAGGACAGGTAC 3’) which flanks a sequence of about 300 bp. Only the samples that were positive for human ß-globin gene are the subjected to research the DNA.

Detection Of Hpv

Detection of HPV sequences was performed using a nested PCR approach (Tawe et al., 2018). DNA was first amplified with MY09 (CGTCCMARRGGAWACTGATC) MY11 (GCMCAGGGWCATAAYAATGG) primers that were used as a template for the second PCR amplification using GP5+ (TTTGTTACTGTGGTAGATACTAC) and GP6+ (CTTATACTAAATGTCAAATAAAAA) primers. For PCR, the mixture contained 200 ng of DNA for the first PCR and 2 µl of PCR product for the second PCR, 12.5 µl of the Master Mix (Vazyme Green Taq Mix), 6.5 µl of distilled water. The mixture was initially denatured at 94°C during 3 minutes followed by 35 cycles with denaturation at 94°C for 1 minute, primers’ hybridization at the corresponding annealing temperature 55°C for 1 minute and extension at 72° for 1 minute. At the end of the last cycle, the mixture further incubated at 72°C for 10 min. PCR products were visualized by electrophoresis on 2% agarose gels after staining with ethidium bromide (10 mg/ml), and visualized in UV light. The Standard PCR precautions and procedures were used to avoid contamination.

Statistical analysis:

Statistical analysis is performed on IBM SPSS Statistics version 20. The association between vitamin D levels with the molecular prevalence of HPV in breast cancer and the different parameters was tested by the chi-square and Fischer exact test. A p-value below 0.05 is considered statistically significant.

Overall, 53 patients whose HPV DNA testing, and 10 healthy patients are defined as control group. 22 patients were considered as study groups according to their HPV status. The mean ages of the participants in study and control groups were 55 years old. The HPV type distribution of the study group is demonstrated in Table 1.

Among the studied population, 22 (41%) was infected by HPV. The hypovitaminosis D represents 22(41.5%), while the proportion of women with insufficient status present 26(49.1%) and just 5(9.4%) of them had a normal vitamin D level.

Table 1

Clinicopathological parameters
Parameters	Number (percentage)
Age
˂ 50	26 (49%)
˃ 50	27(51%)
weight
˂ 66	27(51%)
˃ 66	26(49%)
Size
˂ 160	28(53%)
˃ 160	25(47%)
Vitamin D Dosage
˃ 30	5(9.4%)
between 12 et 29	26(49.1%)
˂ 12	22(41.5%)
IMC
˂ 25	29(55%)
˃ 25	24(45%)
HPV infection
Positive	22 (41%)
Negative	31 (59%)

The association between vitamin D status and the infection by HPV was presented in Table 2. Among the HPV-infected women with breast cancer 12 (36.4%) had low vitamin D levels although just 4 (12.1%) had a normal status. The results show a lack of significance between vitamin D and this infection with a P-value of 0.513.

The majority of women under age of 50 years old have a deficiency of vitamin D 12 (33.3%), 26 (49.1%) have an insufficiency, meanwhile 4 (11.1%) present a normal rate of this prohormone. For women over 50 years of age, 10 (58.8%) were vitamin D deficient and only one patient (5.9%) had a normal level. No association was found between the age and the level of vitamin D.

Our results show no significance between vitamin D and Weight, size and body mass index among these women with a p-value of respectively 0.097, 0.122 and 0.126.

Table 2

Association between vitamin D analysis and HPV infection and other parameters.
		Vitamin D analysis			p-value
		˂ 12 ng/mL	12˂ VIT D˂ 30 ng/mL	˃ 30ng/mL
		22 (41.5%)	26 (49.1%)	5 (9.4%)
Age	˂ 50 years	12 (33.3%)	20 (55.6%)	4 (11.1%)	0.211
Age	˃ 50 years	10 (58.8%)	6 (35.3%)	1 (5.9%)	0.211
HPV infection	Positive	12 (36.4%)	17 (51.5%)	4 (12.1%)	0.513
HPV infection	Negative	10 (50%)	9 (45%)	1 (5%)	0.513
Weight	˂ 66 Kg	14 (56%)	10 (40%)	1 (4%)	0.097
Weight	˃ 66 Kg	8 (28.6%)	16 (57.1%)	4 (14.3%)	0.097
Size	˂ 166 cm	11 (50%)	11 (50%)	0	0.122
Size	˃ 166 cm	11 (35.5%)	15 (48.4%)	5 (16.1%)	0.122
BMI	˂ 25	13 (56.5%)	9 (39.1%)	1 (4.3%)	0.126
BMI	˃ 25	9 (30%)	17 (56.7%)	4 (13.3%)	0.126
BMI: Body Mass Index; P-value by chi-square test.

Vitamin D and HPV

Regarding the association between vitamin D and HPV, a study of 82 patients with a positive Papanicolaou test found low serum 25(OH)D3 levels in this group, not found in the group of women with a negative Papanicolaou test (Ozgu E., et al., 2016). A work on 67 patients followed up for systemic lupus erythematosus showed that high prevalence of HPV infection in the cervix was associated with a plasma 25(OH)D level below 20 g/l, whereas those with serum 25(OH)D levels greater than or equal to 20 g/l had a lower prevalence of infection (30.7% vs 25.8%) (Garcia-Carrasco M., et al., 2015).

A study of 4343 women aged 18–59 years found that high risk HPV prevalence was correlated with a serum 25(OH)D level of 20 g/l (Gupta A., et al., 2021). Furthermore, Shim J., et al, reported in 2016 that there is an association between high prevalence of vaccine-preventable HPV and low serum 25(OH)D (Shim J., et al., 2016).

However, a recent study in 2020 did not find an association between high-risk HPV and plasma 25(OH)D concentration (Troja C., et al., 2020).

Vitamin D, known for its role in bone, also plays an anti-infective role. Indeed, it has been shown that there is a strong association between the development of active tuberculosis and low plasma 25(OH)D levels (Sato S., et al., 2012). A study by Yamshchikov AV, et al. in 2009 looked at the anti-infective effect of vitamin D in upper respiratory diseases, tuberculosis and immunodeficiency virus (Yamshchikov AV, et al., 2009). A study in the ANRS COPANA cohort demonstrated the link between low CD4 counts, increased inflammatory markers and low serum 25(OH)D levels in newly diagnosed HIV + patients (Legeai C., et al., 2013).

Regarding the relationship between vitamin D and influenza virus, a study in Norway showed that low serum vitamin D levels are closely associated with high mortality from seasonal influenza and pneumonia (Moan J., et al., 2009). A Japanese study of Japanese schoolchildren (6–15 years) between December and March demonstrated the benefit of vitamin D supplementation at 1200 IU/day on the incidence of influenza A, particularly in asthmatic children (Urashima M; et al; 2010).

Regarding the relationship between vitamin D and COVID-19 disease, one work reported the link between COVID-19 deficiency (Grant W., et al., 2020).

In fact, the anti-infective effect of vitamin D is due to its immunomodulatory role: it prevents the proliferation of T cells (Rigby W.F., et al., 1984), on the one hand, and macrophages have the capacity to produce vitamin D, on the other (Adams J.S., et al., 1983). It inhibits inflammation-inducing mediators and stimulates monocytes and macrophages.

When confronted with an infectious agent, the latter induce an over-expression of the "Toll-like receptor", the VDR (vitamin D receptor) and 1-α hydroxylase. Activated VDR leads to a decrease in pro-inflammatory cytokines (interleukin-1, interferon-γ, tumor necrosis factor-α) and an increase in anti-inflammatory cytokines (interleukin-10).

Locally produced calcitriol will stimulate macrophages leading to autophagy and synthesis of anti-microbial peptides (cathelicidin), natural anti-infectives (Talvas J., et al., 2017., Adams J.S., et al., 2009).

Vitamin D and breast cancer

In addition, due to the presence of the vitamin D receptor on the surface of breast tissue, Holick reported in 2006 that this receptor is activated by vitamin D (Holick M.F, 2006). This activation results in terminal differentiation and inhibition of cell growth (Holick M.F, 2006). Studies have suggested that vitamin D receptors are present in more than 80% of breast tumours, giving them a protective role against tumour proliferation (Colston K.W et al, 1989; Roy D et al, 2003; Pendas-Franco N et al, 2007).

A study investigating the implication of vitamin D deficiency on cancer susceptibility found an association between low serum 25(OH)D3 levels and increased prevalence of breast cancer genesis, risk of recurrence and mortality (Bilinski, K., Boyages, J., 2013). A meta-analysis of premenopausal women demonstrated the protective role of high serum vitamin D levels and the development of breast neoplasia (Estébanez, N. et al, 2018). Another study found that in patients with a serum vitamin D level below 50 nmol/l, the risk of developing breast cancer is higher in African American patients than in Hispanic patients (Wu, Y., et al., 2017). Work from randomised trials has emphasised that high vitamin D levels are associated with a reduced risk of breast cancer, with the most protective values being 150 nmol/l (Mc Donnell, S.L et al., 2018).

HPV and breast cancer

The risk factors incriminated in the genesis of breast cancer are well known: female gender, late puberty and menopause, use of oral contraceptives, smoking, etc. In addition, there is the involvement of certain oncogenic viruses, particularly HPV. Indeed, more than 40 studies conducted in 20 countries have discovered HPV gene sequences in breast neoplastic tissue (Choi J., et al., 2016; Bae J.M., Kim EH; 2016). In the USA, the prevalence of HPV in breast neoplasia was reported to be 86% in the study by Zur Hansen H. and Villiers EM (Zur Hansen H., Villiers EM., 2015). It would appear that HPV 16 and 18 are the most frequently found in breast cancer, but Chinese and Japanese studies have shown the frequent presence of HPV 33 and 58 (Choi J. et al., 2016; Bae J.M., Kim EH; 2016). The study by Lawson J.S; et al. showed the presence of high-risk HPV on benign breast tissue that developed into HPV-positive breast cancer cells 1 to 11 years later after the initial discovery of HPV (Lawson JS., et al., 2015). Furthermore, the same study reported the occurrence of HPV-induced cervical lesions before the occurrence of breast cancer in the same patient (Lawson JS., et al., 2015).

The study by Dimri G., et al. demonstrated that mammary epithelial cells are immortalised and transformed by HPV (Dimri G., et al., 2005). The work of Yasmeen A., et al. showed that non-invasive and non-metastatic breast cancer cells are transformed by HPV 16 E6 and E7 oncoproteins into invasive and metastatic cells (Yasmeen A., et al., 2007). Ngan C., et al. reports the hypotheses that HPV may indirectly influence breast cancer genesis as well as act through the "hit and run" technique in that it triggers breast cancer genesis and subsequently disappears from tumour cells not found at the time of clinical breast cancer diagnosis (Ngan C., et al., 2015). In addition, the APOBEC enzyme involved in cell cycle control appears to be influenced by HPV leading to genomic instability and ultimately to the occurrence of breast cancer (Ohba K., et al., 2014; Vieira VC, et al., 2014).

Our study shows that the majority of women with breast cancer 90.6% present a deficiency or an insufficiency of vitamin D, while just 9.4% had a normal level. 22 of them were infected with HPV. We find no evidence for an association between vitamin D levels and infection by HPV among women with breast cancer.

Acknowledgment:

Authors would like to thank University Hassan II of Casablanca, Faculty of Sciences and Techniques – Mohammedia, the members of the team of Virology, Oncology and Biotechnologies, Laboratory of Virology, Oncology, Biosciences, Environment and New Energies for all their efforts to support us during all work stages on this research.

Funding notes: None

Conflict of interest: The authors declare that they have no conflict of interest.

Associations entre la 25-hydroxyvitamine D et les marqueurs immunologiques, métaboliques et inflammatoires chez les personnes infectées par le VIH naïves de traitement : étude de cohorte ANRS CO9 « COPANA »
Bae JM, Kim EH. Human papillomavirus infection and risk of breast cancer: a meta-analysis of case-control studies. Infect Agent Cancer (2016) 11:14. 10.1186/s13027-016-0058-9
Bagheri-Hosseinabadi, Z., Imani, D., Yousefi, H., & Abbasifard, M. (2020). Vitamin D receptor (VDR) gene polymorphism and risk of rheumatoid arthritis (RA): systematic review and meta-analysis. Clinical Rheumatology, 39(12), 3555-3569.
Benedik, E. (2021). Sources of vitamin D for humans. International Journal for Vitamin and Nutrition Research.
Bilinski, K.; Boyages, J. Association between 25-hydroxyvitamin D concentration and breast cancer risk in an Australian population: An observational case-control study. Breast Cancer Res. Treat. 2013, 137, 599–607.
Briot, K., Audran, M., Cortet, B., Fardellone, P., Marcelli, C., Orcel, P., ... & Roux, C. (2009). Vitamine D : effet osseux et extra-osseux; recommandations de bon usage. La Presse Médicale, 38(1), 43-54.
Camille Legeai, Corinne Vigouroux,Jean-Claude Souberbielle,Olivier Bouchaud,Faroudy Boufassa,Jean-Philippe Bâtard,Robert Carlier,Jacqueline Capeau,Cécile Goujard,Laurence Meyer,Jean Paul Viard.Associations entre la 25-hydroxyvitamine D et les marqueurs immunologiques, métaboliques et inflammatoires chez les personnes infectées par le VIH naïves de traitement : étude de cohorte ANRS CO9 « COPANA ».PLOS ONE. Publié : 18 septembre 2013
Choi J, Kim C, Lee HS, Choi YJ, Kim HY, Lee J, et al. Detection of human papillomavirus in Korean breast cancer patients by real-time polymerase chain reaction and meta-analysis of human papillomavirus and breast cancer. J Pathol Transl Med (2016) 50:442–50. 10.4132/jptm.2016.07.08
Colston K.W., Burger U., Coombers R.C. Possible role for vitamin D in controlling breast cancer cell proliferation. Lancet, 1 (8631), 1989, p. 188-191
Dermato-Endocrinol, 1 (2009), pp. 307-309
Dimri G, Band H, Band V. Mammary epithelial cell transformation: insights from cell culture and mouse models. Breast Cancer Res (2005) 7:171–9. 10.1186/bcr973
Estébanez, N.; Gómez-Acebo, I.; Palazuelos, C.; Llorca, J.; Dierssen-Sotos, T. Vitamin D exposure and Risk of Breast Cancer: A meta-analysis. Sci. Rep. 2018, 8, 9039.
Fathi, N., Ahmadian, E., Shahi, S., Roshangar, L., Khan, H., Kouhsoltani, M., ... & Sharifi, S. (2019). Role of vitamin D and vitamin D receptor (VDR) in oral cancer. Biomedicine & Pharmacotherapy, 109, 391-401.
García-Carrasco M, Mendoza-Pinto C, Munguía-Realpozo P, et al. Lack of association between serum 25-hydroxyvitamin D levels and cervical human papillomavirus infection in systemic lupus erythematosus. Lupus 2015; 24:606–12
Gupta A, Villa A, Feldman S, Citow B, Sroussi H. Site and sex-specific differences in the effect of vitamin D on human papillomavirus infections: analyses of NHANES 2009–2014. Sex Transm Infect 2021; 97:75–76. doi: 10.1136/sextrans-2020-054466.
Holick M.F. Vitamine D: its role in cancer prevention and treatment. Prog Biophys Mol Biol, 92 (1) 2006, p. 49.59
Hossain, S., Beydoun, M. A., Beydoun, H. A., Chen, X., Zonderman, A. B., & Wood, R. J. (2019). Vitamin D and breast cancer: A systematic review and meta-analysis of observational studies. Clinical nutrition ESPEN, 30, 170-184 https://doi.org/10.1371/journal.pone.0074868
J. Moan, A. Dahlback, L.W. Ma, A. Juzeniene.Influenza, solar radiation and vitamin D.
J. Talvas, G. Martinroche, K. Lanchais, S. Rougé, N. Goncalves-Mendes, M.P. Vasson
J.S. Adams, O.P. Sharma, M.A. Gacad, F.R. Singer.Metabolism of 25-hydroxyvitamin D3 by cultured pulmonary alveolar macrophages in sarcoidosis. J Clin Invest, 72 (1983), pp. 1856-1860
J.S. Adams, S. Ren, P.T. Liu, R.F. Chun, V. Lagishetty, A.F. Gombart.Vitamin D-directed rheostatic regulation of monocyte antibacterial responses. J Immunol, 182 (2009), pp. 4289-4295
La vitamine D induit ex vivo une production dose–dépendante de cathélicidine par les cellules mononucléées du sang périphérique. Nutrition clinique et métabolisme, 31 (3) (2017), pp. 250-251, 10.1016/j.nupar.2017.06.077
Lawson JS, Glenn WK, Salyakina D, Delprado W, Clay R, Antonsson A, et al. Human papilloma viruses and breast cancer. Front Oncol (2015) 5:277. 10.3389/fonc.2015.00277
M. Urashima, T. Segawa, M. Okazaki, M. Kurihara, Y. Wada, H. Ida
McDonnell, S.L.; Baggerly, C.A.; French, C.B.; Baggerly, L.L.; Garland, C.F.; Gorham, E.D.; Hollis, B.W.; Trump, D.L.; Lappe, J.M. Breast cancer risk markedly lower with serum 25-hydroxyvitamin D concentrations ≥60 vs. <20 ng/ml (150 vs. 50 nmol/L): Pooled analysis of two randomized trials and a prospective cohort. PLoS ONE 2018, 13, e0199265.
Ngan C, Lawson JS, Clay R, Delprado W, Whitaker NJ, Glenn WK. Early human papilloma virus (HPV) oncogenic influences in breast cancer. Breast Cancer (Auckl) (2015) 9:93–7. 10.4137/BCBCR.S35692
Ohba K, Ichiyama K, Yajima M, Gemma N, Nikaido M, Wu Q, et al. In vivo and in vitro studies suggest a possible involvement of HPV infection in the early stage of breast carcinogenesis via APOBEC3B induction. PLoS One (2014) 9: e97787. 10.1371/journal.pone.0097787
Özgü E, Yılmaz N, Başer E, Güngör T, Erkaya S, Yakut Hİ. Could 25-OH vitamin D deficiency be a reason for HPV infection persistence in cervical premalignant lesions? J Exp Ther Oncol 2016; 11:177–80
Pendas-Franco N., Gonzalez-Sancho J.M., Suarez Y., Aguilera O., Steinmeyer A., Gamallo C. et al. Vitamin D regulates the phenotype of human breast cancer cells. Differentiation, 75 (3), 2007, p. 193-207
Randomized trial of vitamin D supplementation to prezent seasonal influenza A in schoolchildren. Am J Clin Nutr, 91 (2010), pp. 1255-1260
Rosso, C., Fera, N., Murugan, N. J., & Voutsadakis, I. A. (2022). Vitamin D Levels in Newly Diagnosed Breast Cancer Patients according to Tumor Sub-Types. Journal of Dietary Supplements, 1-13.
Roy D., Calaf G., Hei T.K Role of vitamin D receptor gene in radiation-induced neoplastic transformation of human breast epithelial cell. Steroids, 68 (7-8), 2003, p. 621-627
Sato S, Tanino Y, Saito J, et al.— The relationship between 25-hydroxyvitamin D levels and treatment course of pulmonarytuberculosis. Respir Investig, 2012,50, 40-45.
Shim J, Pérez A, Symanski E, Nyitray AG. Association between serum 25-hydroxyvitamin D level and human papillomavirus cervicovaginal infection in women in the United States. J Infect Dis 2016; 213:1886–92.
Troja C, Hoofnagle AN, Szpiro A, Stern JE, Lin J, Winer RL. Serum concentrations of emerging vitamin D biomarkers and detection of prevalent high-risk HPV infection in mid-adult women. Cancer Epidemiol Biomarkers Prev 2020; 29:1468–74.
Vieira VC, Leonard B, White EA, Starrett GJ, Temiz NA, Lorenz LD, et al. Human papillomavirus E6 triggers upregulation of the antiviral and cancer genomic DNA deaminase APOBEC3B. MBio (2014) 5: e2234–2214. 10.1128/mBio.02234-14
W. Grant, H. Lahore, S.L. McDonnell, et al.Evidence that vitamin D supplementation could reduce risk of influenza and COVID-19 infections and death.Nutrients, 12 (2020), p. 988,
W.F. Rigby, T. Stacy, M.W. Fanger.Inhibition of T lymphocyte mito-genesis by 1.25-dihydroxyvitamin D3 (calcitriol).J Clin Invest, 74 (1984), pp. 1451-1455
Wu, Y.; Sarkissyan, M.; Clayton, S.; Chlebowski, R.; Vadgama, J.V. Association of Vitamin D3 Level with Breast Cancer Risk and Prognosis in African-American and Hispanic Women. Cancers 2017, 9.
Yamshchikov AV, Nirali DS, Blumberg HM, Ziegler TR, Tangpricha V. Vitamin D for the treatment of infectious diseases: a systematic review. Endocr Pr 2009; 15:438–49.
Yasmeen A, Bismar TA, Kandouz M, Foulkes WD, Desprez PY, Al Moustafa AE. E6/E7 of HPV type 16 promotes cell invasion and metastasis of human breast cancer cells. Cell Cycle (2007) 6:2038–42. 10.4161/cc.6.16.4555
zur Hausen H, de Villiers EM. Dairy cattle serum and milk factors contributing to the risk of colon and breast cancers. Int J Cancer (2015) 137:959–67. 10.1002/ijc.29466

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Human papilloma virus profiles in breast cancer in correlation with Vitamin D

Status:

Version 1

Abstract

Introduction

Materials And Methods

Blood samples

Determination Of Vitamin D

Dna Extraction

Internal Control

Detection Of Hpv

Statistical analysis:

Results

Discussion

Vitamin D and HPV

Vitamin D and breast cancer

HPV and breast cancer

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1