Cells and reagents
Human THP-1 monocytic cell line was purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA). The cells were cultured and maintained at a cell density between approximately 2.0 x 105 and 8.0 x 105 viable cells/mL as recommended by ATCC; 7αOHChol, 7βOHChol, and 7K were purchased from Research Plus, Inc. (Barnegat, NJ, USA). MMP-9 inhibitor I and LPS prepared from Escherichia coli K12 were purchased from Millipore Sigma (Burlington, MA, USA) and InvivoGen (San Diego, CA, USA), respectively. Antibodies against CD14 and β-actin were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).
Real-time polymerase chain reaction (PCR)
Total RNA was reverse-transcribed for 1 h at 42°C using Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA), and real-time PCR was performed in triplicate using a LightCycler® 96 Real-Time PCR System (Roche Holdings AG, Basel, Switzerland). Reactions (20 µL) contained 4 µL of cDNA template, 10 µL of SYBR Green Master Mix, and 2 µL of 10 pM forward and reverse primers of the target gene, which was amplified under the following cycling conditions: 95°C for 10 min, 45 cycles at 95°C for 10 s, 50°C for 10 s, and 72°C for 10 s. Gene expression was calculated relative to that of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), using LightCycler® 96 software (Version 1.1.0.1320, Roche), and mRNA levels of the target genes were normalized to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the 2−ΔΔCt method [19]. The forward and reverse (5′∀3′) primers were
CD14, F: ACGCCAGAACCTTGTGAGC, and R: GCATGGATCTCCACCTCTACTG:
CCL2, F: CAGCCAGATGCAATCAATGCC, and R: TGGAATCCTGAACCCACTTCT;
MMP-9, F: GCACGACGTCTTCCAGTACC, and R: CAGGATGTCATAGGTCACGTAGC;
GAPDH, F: GAAGGTGAAGGTCGGAGT, and R: GAAGATGGTGATGGGATTTC.
Flow cytometry
Following treatment with 7αOHChol, 7βOHChol, and 7K for 48 h, THP-1 cells were washed with phosphate-buffered saline (PBS) containing 0.5% bovine serum albumin (BSA), and 2 mM ethtlene diamine tetra acetic acid (EDTA) (washing buffer) and incubated with 3% BSA in phosphate-buffered saline (PBS). The cells were exposed to anti-CD14 antibody diluted 1:100 in washing buffer at 4°C overnight. The cells were washed three times and incubated with anti-mouse IgG-Alexa Fluor 488 diluted 1:200 in washing buffer for 40 min at room temperature in the dark. Fluorescence emission by the stained cells was analyzed using a FACSCanto™ II flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).
Enzyme-linked immunosorbent assay
The levels of sCD14 and CCL2 secreted from the cells into the culture media were measured using ELISA kits, according to the manufacturer’s instructions (BD Bioscience, Franklin Lakes, NJ, USA). After serum starvation with 0.1% BSA in RPMI 1640 medium overnight, THP-1 cells were exposed to oxysterols. The cells were centrifuged (200xg; 5 min), and the supernatants were collected and frozen at -20°C. The supernatants, which were thawed prior to use, and standards for CCL2 or sCD14 were added to a microtiter plate pre-coated with a monoclonal antibody against CCL2 or sCD14, followed by incubation for 1 h. Then, the wells were washed and incubated with an enzyme-conjugated antibody for each molecule. The substrate provided in the kit was added after three washes and the color intensity was measured using a Sunrise microplate reader (Tecan Austria GMBH, Grödig, Austria). The amounts of CCL2 and sCD14 were determined using a standard curve.
Western blot analysis
Cell lysates were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. Non-specific protein binding was blocked for 1 h in Tris-buffered saline (TBS) containing 0.05% Tween-20 (TBS-T) and 1% skimmed milk, and the membranes were incubated with primary antibodies at 4°C overnight. After three washes with TBS-T, the membranes were incubated for 1 h with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature. Bands were detected using chemiluminescent reagents. Chemiluminescent images were captured using an Amersham Imager 600 (GE Healthcare Life Sciences, Pittsburgh, PA, USA).
Migration assay
Cell migration was investigated using Transwell™ Permeable Supports (Costar, Cambridge, MA, USA) as previously described [8]. The top wells of 5-µm-pore polycarbonate Transwell™ inserts loaded with monocytic cells were inserted into reservoirs containing supernatants with chemoattractants. After 3 h in a CO2 incubator, the number of cells that migrated into the reservoir were counted using a Vi-Cell XR cell counter (Beckman Coulter, Life Sciences Division, Indianapolis, IN, USA).
MMP-9 gelatinolytic activity in cell supernatants
MMP-9 activity was assessed using gelatin zymography as previously described [20]. After serum-free incubation of THP-1 cells with or without the indicated 7-oxysterols, the supernatants were collected after centrifugation (200xg; 5 min) and concentrated 30-fold using a Vivaspin® 2 concentrator (Sartorius Lab Instruments AG., Göttingen, Germany). The concentrated supernatants were electrophoretically separated on 8% polyacrylamide gels containing 0.15% gelatin. The gels were washed, activated for 18 h at 37°C, stained with 0.2% Coomassie Brilliant Blue R-250, and destained with 20% methanol/10% acetic acid. The bands in the gels were visualized using ZoomBrowser EX 5.0 (Canon, Tokyo, Japan).
Statistical analysis
Data were statistically analyzed by one-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison tests using PRISM (version 5.0; GraphPad Software Inc., San Diego, CA, USA). A p-value less than 0.05 was considered statistically significant.