Plant material and growth conditions
Seeds of a P. fugax population resistant to ACCase-inhibiting herbicides (referred to as R population) were collected from Qingsheng County (29° 54’ 1” N, 103° 48’ 57” E), Sichuan Province, China, where clodinafop-propargyl has been used for over five years and failed to control P. fugax in wheat and canola. A susceptible population of P. fugax (referred to as S population) were collected from a non-cultivated area in Xichang City of Sichuan (27° 50’ 56” N, 102° 15’ 53” E), where herbicides have never been used. The original R and S populations of P. fugax were identified by Dr. Wei Tang (China National Rice Research Institute) and Dr. Fengyan Zhou (Anhui Academy of Agricultural Sciences) [20], and these populations were obtained from the wild without any specifically permissive requirement and now are deposited in the specimen room of Anhui Academy of Agricultural Sciences. The current experiments were conducted in the glasshouse of Anhui Academy of Agricultural Sciences, and no specific permissions were required for samples collection. We stated that the field studies were in accordance with local legislation and no specific licenses were required.
Seeds of the fourth generations of the R and S populations were generated by self-crossing and used in this study. After germination, the seedlings were transplanted into individual 1-L pots containing potting medium (1:1:1:2 vegetable garden soil/compost/ peat/dolomite, pH 6.3). Plants were grown in a glasshouse with average day/night temperatures of 20/10°C under natural sunlight.
Arabidopsis thaliana (L.) Heynh Columbia (Col) was obtained from the SALK collection (http://signal.salk.edu/), and used as the wild-type (WT) for transgenic manipulation. The transformed and untransformed control Arabidopsis seedlings were transplanted into individual 0.25L pots containing potting medium (4:1:1 sphagnum/vermiculite/perlite) and grown at 19°C under 100 µmol m− 2 s− 1 photo density of cool white fluorescent light with a photoperiod of either 16/8 h (long day condition, LD), or 8/16 h, light/dark (short day, SD).
Cloning of the PfAG5 cDNA from P. fugax
Total RNA from P. fugax R and S plants were isolated using the SGTriEx Total RNA extract Kit (SinoGene), and then used for reverse transcription by Thermo First cDNA Synthesis Kit (SinoGene) according to manufacturer’s instructions. The PfAG5 cDNA fragment was amplified using the primer pair S1 and S2 based on the contig sequence (Table 2), ligated into the pMD18-T vector, and confirmed by sequencing as partial sequence of an AGAMOUS-like gene. The full-length coding sequence of the PfAG5 gene was obtained using 5’-RACE and 3’RACE with the gene-specific primers GSP1 and GSP2 (Table 2) (Clontech, US), and amplified from plants by the primers FK and RB (Table 2) which include introduced Hind III and EcoR I restriction sites based on the known 5’ and 3’ sequences.
Table 2
Primers used in the study
Primer | Sequences (5’-3’) | Purpose |
S1 | AATGAGCATGATGACCGATTTGAGC | Clone cDNA fragment |
S2 | GTTGAAGGGCTGCTGGCCGAGCTG |
GSP1 | GGTGTCACTGTTGGCCTTTTTGTACCTC | 5’RACE and 3’RACE |
GSP2 | GAGATCAAGCGCATCGAGAACACCAC |
FK | GGGGTACCATGAGCATGATGAGCATGATGACCG | Clone full-length cDNA fragment |
RB | CGGGATCCCTAGTTGAAGGGCTGCTGGCC |
pfAG5-F | CATGGAGGCCGAATTCATGAGCATGATGAGCATGATGACC | Bait vector construction |
pfAG5-R | GCAGGTCGACGGATCCCTAGTTGAAGGGCTGCTGGCCGAGC |
ACTIN8-F | CGTCCCTGCCCTTTGTACAC | Reference gene for Arabidopsis |
ACTIN8-R | CGAACACTTCACCGGATCATT |
FLC-F | GCTCTTCTCGTCGTCTCC | Analysis of Flowering locus C gene expression in Arabidopsis |
FLC-R | GTTCGGTCTTCTTGGCTC |
CO-F | AAGGTGATAAGGATGCCAAGGAG | Analysis of Constans gene expression in Arabidopsis |
CO-R | GGAGCCATATTTGATATTGAACTGA |
SOC1-F | TCAGAACTTGGGCTACTC | Analysis of Suppressor of over- expression of CO1 gene expression in Arabidopsis |
SOC1-R | TTCTCGTCGTCTCCGCCTCC |
AP1-F | TAAGCACATCCGCACTAG | Analysis of Apetala 1gene expression in Arabidopsis |
AP1-R | TTCTTGATACAGACCACCC |
FT-F | TGGTGGAGAAGACCTCAGGAAC | Analysis of Flowering locus T gene expression in Arabidopsis |
FT-R | TGCCAAGCTGTCGAAACAATAT |
LFY-F | TGTGAACATCGCTTGTCGTC | Analysis of LEAFY gene expression in Arabidopsis |
LFY-R | TAATACCGCCAACTAAAGCC |
EF1-F | GAACCTCCCAGGCTGATTGT | Reference gene for P. fugax |
EF1-R | CAAGAGTGAAAGCAAGAAGAGCA |
pfAG5-F | CAGGCTGGAGAAAGGCATAG | Analysis of pfAG5 expression in P. fugax |
pfAG5-R | GGAGCTCCATTTCCCTCTTC |
AD1-F | GCTGAAACAGCAGGAGAAGG | Analysis of AD1 expression in P. fugax |
AD1-R | AGTCAGCTCCTTAGCCACCA |
AD2-F | CCAGTGAAACAGCAGTGAGC | Analysis of AD2 expression in P. fugax |
AD2-R | TGCCTTCTGGTTCTGATGTG |
AD3-F | AGGTCACTGCAGGAGGAGAA | Analysis of AD3 expression in P. fugax |
AD3-R | GGCTTGTTGTGTTTGGGTCT |
Molecular characterization and phylogenetic analysis of PfAG5
The open reading frame (ORF) of PfAG5 cDNA sequence was identified using the ORF finder software (https://www.ncbi.nlm.nih.gov/orffinder/). For homology analysis, the amino acid sequence of PfAG5 was aligned and compared with the sequences of other species. Phylogenetic analysis was conducted using the neighbor-joining method implemented in MEGA software version 5.0, and the robustness of the inferred phylogeny was validated by including 1000 bootstrap replicates.
Plasmid Construction And Arabidopsis Transformation
The pCAMBIA2300 and pCAMBIA1303 plasmid vectors were digested by Hind III and EcoR I, respectively. The (CaMV) 35S promoter of pCAMBIA2300 (1008 bp) and the large skeleton of pCAMBIA1303 were recovered and purified. Then, T4 DNA ligase (TaKaRa) was used to connect the two parts and a new two-element expression vector pCAMBIA1303-35S:35ST including the 35S promoter was obtained.
The full-length ORF of PfAG5 gene was ligated into the binary vector pCAMBIA1303-35S:35ST (empty plasmid control, Mock) to generate the plasmid pCAMBIA1303-35S-35ST:PfAG5 (Fig. 6A). The plasmid was transferred into WT Arabidopsis plants (Col) using the floral dipping method. All transgenic Arabidopsis seeds (T0) were screened on 1/2 MS solid medium containing 50 mg-L− 1 hygromycin. Positive transgenic lines (T1, n = 40) were confirmed by PCR amplification of the hygromycin gene, and the target gene (PfAG5) was visualized by the GUS gene histochemical localization (Fig. 6B). Introduction of the target gene (PfAG5) in T2 generation plants was verified by PCR, and positive plants (n = 27) all showed an early flowering phenotype. Twenty of these lines were used to produce the T3 generation and were used in the following experiments.
Flowering Time And Seed Production Measurements
To measure flowering time, seeds of WT (Col), empty plasmid control (Mock) and PfAG5 transgenic Arabidopsis plants (35S::PfAG5) were surface sterilized with 10% hypochlorite, then placed on MS agar medium and stratified at 4°C for 48 h before being placed at 19°C. Ten-day-old seedlings (at the four leaf stage) were transferred to growth medium (1:4:1 of vermiculite, sphagnum and perlite), and grown under LD or SD conditions.
The flowering time of 20 T3 transgenic lines were recorded from the day of transplanting until the first Arabidopsis flower bloomed. Rosette leaf numbers were recorded when peduncle was 1–2 cm in length, and above-ground plant height and pod numbers were determined on day 55 after transplanting. Seeds were collected on day 62 after transplanting, and weighed after drying at 37°C for 24 h.
Yeast Two-hybrid Assay
Above-ground plant tissue of three R P. fugax plants at early flowering stage were harvested randomly, and the cDNA library (cloned into Prey vector pGADT7) was obtained using the Clontech kit (catalog number 630490). The full-length PfAG5 (with yeast codon optimization) was cloned into vector pGBKT7 (Bait vector) and then transformed into the yeast strain Y2HGold (Clontech).
The Matchmaker™ Gold Yeast Two-Hybrid System (Clontech, US) was used to screen the PfAG5 interaction proteins from the R P. fugax library according to the manufacturer’s instructions. The primers used for pGBKT7 vector construction were listed in Table 2. To confirm the interactions, the identified Prey and Bait vectors were validated by one-to-one interaction hybridization.
PfAG5 expression analysis in Arabidopsis and P. fugax
To analyze the expression pattern of PfAG5 in different tissues of transgenic Arabidopsis plants, leaf, flower and pod samples from 3–5 T3 lines were collected at the seedling (6–8 leaves), flowering (full open) and podding (new formation) stages. Harvested samples were snap frozen in liquid nitrogen and stored at -80°C until use. In addition, the whole above ground part of PfAG5 transgenic and WT Arabidopsis plants were collected before midday (Zeitgeber time 6, ZT6) at the flowering stage (13and 28 d after transplanting, respectively) for analysis of the expression patterns of six other Arabidopsis genes relevant to flowering regulation: CO, SOC1, FT, LFY, FLC and AP1.
Tissue samples of the R and S P. fugax plants were collected at the seedling and tillering stages, and the samples collected at the early flowering stage of R plants correspond to the heading stage of the S plants. The expression of PfAG5 and interacting proteins (AD-1, AD-2 and AD-3) were compared between R and S samples which were collected at the same time.
Total RNA was extracted using the SGTriEx Total RNA extract Kit (SinoGene), and DNA contamination removed by RNase-free DNaseⅠ(Fermentas). The DNA-free RNA was then used for reverse transcription by Thermo First cDNA Synthesis Kit (SinoGene). The primer sequences used for Real-time quantitative PCR are provided in Table 2. The ACTIN8 and EF1 gene was used respectively for normalization of Arabidopsis and P. fugax samples. The qPCR amplification was conducted for up to 40 cycles using the following thermal profile: denaturation at 95°C for 15 s, annealing at 55°C for 15 s and extension at 72°C for 45 s. The RT-qPCR results were presented as means ± SE of three biological replicates each performed in triplicate. Gene expression level was estimated as 2−△△Ct.