- Major reagents
Pyropheophorbide a methyl ester (MPPa, C34H36N4O3) was obtained from Sigma-Aldrich (St Louis, MO). Laser (laser of 630 nm) was purchased from Chongqing Jingyu Laser Technology Co., Ltd. (Chongqing, China). Dulbecco’s modified Eagle’s medium (DMEM) was gained from HyClone (Logan, UT). Cell Counting Kit-8 (CCK-8) was procured from Dojindo Molecular Technologies (Kumamoto, Japan). Akt, Phospho-Akt, Phospho-NF-kB p65 and NF-kB p65 were obtained from Cell Signaling Technology (Danvers, MA). Trypsin, Actin-tracker Green were procured from Beyotime (Shanghai, China).
- Cell culture
The human breast cell line MCF-7 (Shanghai Institute of cell biology China, catalogue number: SCSP-531) was cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin (Beyotime, Shanghai, China) in an incubator contains 5% CO2 at 37°C.
- PDT protocol
Four groups are designed in the present study—A: control group; B: MPPa-only group; C: irradiation-only group; D: MPPa-PDT group. After cells attachment, medium of group A and C were replaced with fresh medium. Medium of Group B and D were replaced with medium contained MPPa (2 μmol/L). Cells were washed with PBS in order to remove the MPPa after 12 hours. group C and D were exposed to LED light (630 nm, 30 mW/cm2) for 30, 60, 90, 120, 180 sec to obtain energy densities of 0.9, 1.8, 2.7, 3.6, 5.4 J/cm2, respectively. Energe density (J/cm2) = power (mW/cm2) × irradiation time (s) After irradiation, the cells were cultured in the incubator. All the operations were performed in the dark.
- Detection of intracellular MPPa
MPPa sparkle red fluorescence upon corresponding excitation. To observe the uptake of MPPa in MCF-7 cells, cells were seeded into 6-well plates and incubated with 2 μmol/L MPPa for different times (0 h, 3 h, 6 h, 12 h, and 24 h), the intracellular accumulation of MPPa was detected by Fluorescence microscope (Leica DMRE Fluorescence Microscope, Germany) .
- Cell viability and cytotoxicity tests
Cells were seeded in 96-well plates at a density of 5 x 103 cells/well. After 24 h of different treatments, 100 μl medium contained 10 μl CCK-8 was added to each well after 24 h and further incubated for some time. Optical densities (ODs) were measured by microplate reader. Cell viability (%) = (Average OD of experiment group – Average OD of blank group)/ (Average OD of control group – Average OD of blank group) × 100%. Wells of blank group contained only DMEM with CCK-8.
- ROS detection
MCF-7 cells were seeded in 24-well plates. After abovementioned treatments, medium of each group was replaced by DCFH-DA (Invitrogen, Paisley, UK) at a concentration of 10 μmol/L. After 30 min, cells were washed with PBS three times to wipe off the extracellular DCFH-DA. A fluorescence microscope was used for detecting the production of ROS (Zeiss Fluorescence Microscope, Germany).
- Wound healing assay
MCF-7 cells were seeded in 6-well plates at a density of 1 × 105 cells/well. MPPa-only group and MPPa-PDT group were subjected with MPPa-medium (2 μmol/ml) and incubated for 12 h. Then used media was replaced by PBS and a scratch was made with a sterile pipet tip (200 μl) in all groups, then the detached cells were removed. The corresponding irradiation was performed in irradiation-only group and MPPa-PDT group. Images were taken immediately after irradiation and 24 h later by using a fluorescence microscope. The area of scratch was analyzed using Image J software.
- Matrigel invasion assay
Matrigel invasion assay was utilized for evaluating the invasiveness of cells pre and post PDT. Cells were divided into 4 groups and received correspondent management. At the same time, Matrigel (Becton Dickinson, Bedford, MA) was added into transwell inserts (Corning Costar, Tokyo, Japan) for solidification in a 24-well plate. Cells were collected and transferred into the upper chambers with about 200 μl of serum-free medium and whose amount was 5 × 104 for each transwell insert. The lower wells were supplemented with 750 μl medium. After 48 h, cells those hadn’t invaded to the lower surface of transwell inserts were cleaned by a cotton swab while invaded cells of the inserts were fixed with 4% paraformaldehyde, washed with PBS for three times and subjected with crystal violet (Beyotime, Shanghai, China). Transwell inserts were investigated by a microscope under the white light mode (Zeiss Fluorescence Microscope, Germany).
- Real-Time PCR Analysis
RNA was extracted by RNA iso plus reagent (Takara). Then the compound was centrifuged for 15 min at 12000 rpm and supernate was collected in new EP tubes to get the sediment of RNA by Isopropyl alcohol. Extractive RNA was purifying with 75% ethyl alcohol and suspended with 20 μl diethyl pyrocarbonate (DEPC water). The cDNAs were synthesized through reverse transcriptase reactions with a mixture following the instruction book (Takara, Japan) and real-time polymerase-chain reaction (PCR) analysis was performed with Bio-Rad. Primers were synthesized by Qingke (Chongqing, China), and the sequences of our target genes were below: ATGGGGAAGGTGAAGGTCGG (Forward) and GACGGTGCCATGGAATTTGC (Reverse) for GAPDH. (Forward) CCGCTCACCTTCACTCG and CTCCGCGACACCAAACT (Reverse) for MMP9. (Forward) CCCACTGCGGTTTTCTCGAAT and CAAAGGGGTATCCATCGCCAT(Reverse) for MMP2.
- Western blotting
To collect the cell protein, cells were lysed with lysate (RIPA : PMSF= 100:1) and centrifuged at 12000 g at 4 ℃. Protein concentrations were qualified by BCA assay and prepared with RIPA and loading buffer to make the final concentration the same. Target proteins were obtained after gel electrophoresis and then they were transferred to PVDF membranes (Millipore). 5% nonfat dry milk was used for blocking of membranes at room temperature and Tris-buffered saline plus tween (TBST) was used to wash the membranes. Then the membranes were exposed to homologous primary antibodies and shaken tardily at 4 ℃ overnight. Next day, the membranes were washed with TBST to wipe off the nonspecific binding primary antibodies and then exposed to secondary antibodies of corresponding species and eventually the images were obtained by Fusion with the coreaction of ECL (Advansta, USA). All experiment results were analyzed by Fusion (Fusion, Vilber Lourmat, France).
- F-actin cytoskeleton analysis
MCF-7 cells were seeded onto glass coverslips in a 12-well plate. After treatment, the coverslips were collected, fixed with 4% paraformaldehyde (PFA). 0.1% Triton-100 was subjected to cells for permeability and 5% BSA was used for block. Coverslips were stained with the Actin-tracker green (Beyotime Biotechnology, China) for 1 h at room temperature. Then the surface of slides was smeared with some Antifade mounting medium and all coverslips were transferred onto slides. The image series were captured using a ZEISS LSM800 confocal microscope (Carl Zeiss AG, Germany).
- Tumor models
All female nude mice (4–6 w) were gained from the Experimental Animal Center of Chongqing Medical University. All animal studies were abided by an ethics approved by the Animal Ethics Committee of Chongqing Medical University. Back of the nude mice was inoculated subcutaneously with 1×106 MCF-7 cells in 100 μL PBS to form MCF-7 xenograft breast cancer. When the tumor grew to about 100 mm3, these mice were randomly divided into four groups including control group, MPPa group, laser group and MPPa-PDT group(n=3 in each group). MPPa was administrated intravenously to the tumor-bearing mice at a concentration of 15 mg/kg and the laser was applied 12 h after injection with 120 J/cm2 every 2 days for 10 days. Tumor sizes and body weights were recorded during treatment.
Tumor Volume (TV) = Length × Width2/2.
- Tissue histology and immunohistochemistry
Nude mice were euthanized by cervical dislocation and the major organs were harvested at day 16. In order to observe the metastatic foci, lung organs were fixed with 4% paraformaldehyde, embedded with paraffin, and performed with Hematoxylin and Eosin (H&E). Tumors were fixed with 4% paraformaldehyde and embedded with paraffin, then the tumor slices were stained with Actin-tracker green, collagen and DAPI at room temperature for immunohistochemistry.
14.Statistical analysis
Data are shown as mean ± SD. GraphPad Prism Software version 7.00 (San Diego, CA) was used for statistical analysis. The method of statistical analysis was one-way analysis of variance (ANOVA). P < 0.05 was regarded as statistically significant.