HHV-8 status in oral squamous cell carcinoma tissues in a group of Sri Lankan male patients

doi:10.21203/rs.3.rs-2431539/v1

Download PDF

Research Article

HHV-8 status in oral squamous cell carcinoma tissues in a group of Sri Lankan male patients

https://doi.org/10.21203/rs.3.rs-2431539/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Head and neck cancers (HNSCCs) are notable as a poignant public health menace and rank as the 8th most common cancer type according to a 2020 global estimation. Oral squamous cell carcinoma (OSCC) accounts for 90–95% of oral malignancies in most countries. Moreover, oral cancer as well as Kaposi’s sarcoma-associated herpes virus (KSHV) prevalence demonstrates geographic and population specificity. Immunosuppression in oral cancer patients could trigger the multiplication and transmission of oncogenic γ-herpes viruses in oral cancer patients. The objective of this study was to find out the HHV-8 status in oral squamous cell carcinoma tissues in a group of Sri Lankan male patients. Incisional biopsies of cases and excisional biopsies of controls collected, transported, stored, and dispatched as frozen tissues at -80⁰ C. Then, DNA extracted from frozen specimens using Gentra Puregene Tissue kit (Qiagen, Germany), solid tissue protocol according to the manufacturer’s instructions. Subsequently, real-time PCR was performed to detect HHV 8 in these OSCC cases and FEP controls. HHV- 8 was not detected in 22 OSCC cases and 29 FEP control samples. Thus, HHV-8 viral infections may not be a problem in oral cancer patients in Sri Lanka.

Molecular Biology

Head and neck cancers

HHV-8

real-time PCR

Immunosuppression

Head and neck cancers (HNSCCs) are notable as a poignant public health menace and rank as the 8th most common cancer type according to a 2020 global estimation ¹. Oral squamous cell carcinoma is the most common subgroup of head and neck squamous cell carcinomas includes malignant neoplasms, beginning from the lining mucosae of the lips and the mouth (oral cavity) including the anterior two-thirds of the tongue as defined by the WHO International Classification of Disease ².

Sri Lanka contributes to the global oral cancer burden with Papua New Guinea, Bangladesh, Hungary, and Sri Lanka currently having the highest incidence rates ³. This non-communicable disease becomes a healthy economic burden when considering the cost of treatment modalities namely advanced surgery, and radiation, This deadly disease with geographic and population specificity ranking 1st among Sri Lankan males ³ due to lifestyle-related modifiable risk factors among them tobacco chewing with or without areca (betel) nut is the major risk factor ^{3, 4, 5}. The oncogenic Human Herpes virus 8 (HHV 8) also known as Kaposi sarcoma (KS) - associated herpes virus KSHV discovered in 1994 ^{1, 6}. Furthermore, non-ubiquitous, hence endemic HHV-8 is established as the causative agent of uncommon neoplasms such as multicentric Castleman’s disease (MCD) and primary effusion lymphoma (PEL) typically associated with HIV-infected patients and the commonest HIV-associated malignancy in the world. ^{1, 7}. Molecular pathological evidence unveiled the mechanisms of oncogenesis of HHV-8, via molecular mimicry, viral encoded proteins are found to be activated by several cellular signaling cascades whilst evading immune surveillance ^{1, 8}. Immunosuppressive conditions in oral cancer patients may provide an ideal opportunity to activate oncogenic viruses from their latent stage ³. Viral infections due to Epstein Bar Virus (EBV), one of the oncogenic γ-herpes viruses among OSCC cases reported previously in local ^{3, 9}, regional ^{10, 11} and global ¹² oral cancer patients Nevertheless, there are no published studies on the status of HHV-8, the other γ-herpes virus in Sri Lankan OSCC patients.

Against this backdrop, the present study aims to assess the HHV-8 status in a group of Sri Lankan male, oral squamous cell carcinoma (OSCC) cases confirmed by histopathologically diagnosis, which fulfilled the specific inclusion criteria, and a control group of clinically diagnosed FEP.

2.1 Ethical Approval:

Ethical approval for present study was taken from the Faculty Research Committee, Faculty of Dental Sciences, University of Peradeniya, Sri Lanka (FRC/ FDS/UOP/E/2014/32) and Griffith University Human Research Ethics Committee, Australia (DOH/18/14/ HREC).

2.2 Study design, sample size calculation, setting, and subjects:

Present molecular epidemiology study was centered on a multicenter field study in Sri Lanka ³. A representative sub-sample of 29 OSCC cases and 25 FEP controls was selected from the main unmatched case-control as described previously. The scientific sample size calculation for the unmatched case-control study was based on Kelsey et al., 1996 ³. Selected Oral and Maxillo- Facial (OMF) Units across Sri Lanka were visited located in six provinces for profiling of bacteriome comprised Sinhala, ≥ 40-year-old with a clinical diagnosis of FEP also involving the buccal mucosa or tongue. Written informed consent was obtained from each participant ^{3, 13}.

2.3 Risk habit profile:

Pre tested interviewer administered questioner was used to collect the details of oral risk habits and other socio-demographic information of study subjects as described previously ³.

2.4 Tissue sampling and DNA extraction:

Deep tissue pieces (~3 mm3) from excisional FEP biopsies were taken. Subsequently, DNA extraction from frozen samples (=80⁰C) was performed according to (solid tissue protocol) as described previously^{3, 5, 13}.

2.5 Real Time PCR for HHV 8

β-globin PCR with the primers PCO3 and PCO4 was performed to ensure the quality of DNA and to confirm the absence of PCR inhibiting agents ³.The real time PCR assay was set up to amplify 106 bp of HHV-8, from previously published primer sequences as described previously³. Then, the real time PCR was performed on a Quant Studio 6- real -time machine with an initial step of hold stage of polymerase activation step at 95⁰ C for 5 minutes, followed by 45 cycles of amplification (5 seconds denaturation at 95⁰ C for 5 minutes; 30 seconds annealing (TM)/extension at 55⁰ C) and melt curve stage of 3 steps (95⁰ C for 10 minutes, 50⁰ C for 10 minutes and 95⁰ C for 15 minutes) ³. Overall run duration was 72 minutes and 24 seconds. Amplicon detection was determined via rt PCR screen and melt curve analysis ³.

Neither OSCC cases nor FEP controls contained HHV-8 DNA by 26-01.1 AGCCGAAAGGATTCCACCA TT and HHV 8_2 6 -02.1 TCCGTGTTGTCTACGTCCAG A primers ³.

In the present study HHV-8 was not detected either in OSCC cases nor FEP controls. Comparable findings were reported in a study conducted by Yang et al. and colleges ¹⁴ as this virus was not detected in any of 25 archival FFPE samples. HHV-8 was detected in one of 22 archival FFPE samples of head and neck squamous cell carcinomas in a separate study of HIV positive patients ¹⁵. However, it has been revealed that the KSHV infection is not ubiquitous with seroprevalence, risk factors and transmission routes exhibiting considerable variations across populations in different geographic region which justify the negative finding of present study ¹⁶. KSHV transmits via saliva during childhood in endemic areas. Whereas, KSHV transmission could be associated with homosexual contact in non-endemic countries. Small sample size is a limitation of the present study ¹⁶.

HHV-8 infection was not a problem in this study population. Further case control studies with large sample size representing younger oral cancer is recommended as KSHV transmission is possible with homosexual contact in non-endemic countries

Author Contributions: M. Perera, contributed to conception, design, data acquisition and interpretation, scientifically improved the manuscript; I. Perera, contributed to design, data acquisition, interpretation and statistical analysis.

Acknowledgments: First and foremost, I would like to sincerely thank Prof. Newell W.Johnson for allowing me to work under him as the Principal Supervisor for my Ph.D., establishing metagenomic studies at the School of Dentistry and Oral Health, Gold Coast Campus, Griffith University, Australia. I express my gratitude to Prof. G.C. Ulett for his overall supervision in the DNA extraction phase of my Ph.D. under the guidance of Dr. D. Ipe in his lab. Special thanks go to Dr. D.J. Speicher for his contribution to dispatching extracted DNA samples for amplicon sequencing. I am indebted to Dr. T.Chen for spending long hours of metagenomic data processing. Above all, I am overwhelmed by my deepest appreciation to Prof. Al-hebshi for his valuable guidance from nucleotide sequencing to three papers based on my Ph.D. thesis.

Conflict of Interest: The authors declare no potential conflicts of interest with respect to the authorship and/or publication of this article.

Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA A Cancer J Clin. 2021;71(3): 209-249. doi:10.3322/caac.21660.
Gupta B, Lalloo R, Johnson NW. Life course models for upper aero-digestive tract cancer. International dental journal. 2015; 65(3):111-9.
Perera ML. (2017) “The Microbiome Profile Of Oral Squamous Cell Carcinoma Tissues In A Group Of Sri Lankan Male Patients”. Griffith University, Queensland, Australia.
Perera M, Al-hebshi NN, Speicher DJ, Perera I, Johnson NW. (2016) Emerging role of bacteria in oral carcinogenesis: a review with special reference to perio-pathogenic bacteria. J Oral Microbiol. 8:32762
Perera M, Al-hebshi NN, Perera I, Ipe D, Ulett GC, Speicher DJ, Chen T and Johnson NW (2018) Inflammatory bacteriome and oral squamous cell carcinoma”. Journal of Dental Research 97.6: 725-732
Chang Y, Cesarman E, Pessin MS, Lee F. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science. 1994;266(5192):1865.
Chang Y, Cesarman E, Pessin MS, Lee F. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science. 1994; 266 (5192):1865.
Speicher and Johnson BMC Infectious Diseases 2012, 12:210 http://www.biomedcentral.com/1471-2334/12/210
Jalouli J, Jalouli MM, Sapkota D, Ibrahim SO, Larsson P-A, Sand L. Human papilloma virus, herpes simplex virus and epstein barr virus in oral squamous cell carcinoma from eight different countries. Anticancer research. 2012;32(2):571-80
D' Costa J, Saranath D, Sanghvi V, Mehta AR. Epstein-Barr virus in tobacco-induced oral cancers and oral lesions in patients from India. Journal of oral pathology & medicine. 1998; 27(2):78-82.
Acharya S, Ekalaksananan T, Vatanasapt P, Loyha K, Phusingha P, Promthet S, et al. Association of Epstein-Barr virus infection with oral squamous cell carcinoma in a case–control study. Journal of Oral Pathology & Medicine. 2015;44(4):252-7.
Kis A, Fehér E, Gáll T, Tar I, Boda R, Tóth ED, et al. Epstein–Barr virus prevalence in oral squamous cell cancer and in potentially malignant oral disorders in an eastern Hungarian population. European journal of oral sciences. 2009;117(5):536-40.
Perera, M. (2017). The microbiome profile of oral squamous cell carcinoma tissues in a group of Sri Lankan male patients. https://doi.org/10.25904/1912/3833
Yang Y-Y, Koh L-W, Tsai J-H, Tsai C-H, Wong EF-C, Lin S-J, et al. Involvement of viral and chemical factors with oral cancer in Taiwan. Japanese journal of clinical oncology. 2004;34(4):176-83
McLemore MS, Haigentz M, Smith RV, Nuovo GJ, Alos L, Cardesa A, et al. Head and neck squamous cell carcinomas in HIV-positive patients: a preliminary investigation of viral associations. Head and neck pathology. 2010;4(2):97-105
Zhang et al. 2022 Prevalence and correlates of Kaposi’s sarcoma-associated herpesvirus and herpes simplex virus type 2 infections among adults: evidence from the NHANES III data Virology Journal 19:5 https://doi.org/10.1186/s12985-021-01731-9

ManoshasSamplesNanoDropandPCRdata30.03.2016.xlsx

Download PDF

Version 1

posted

You are reading this latest preprint version

HHV-8 status in oral squamous cell carcinoma tissues in a group of Sri Lankan male patients

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

3. Results

4. Discussion

5. Conclusion and Recommendation

Declarations

References

Supplementary Files

Status:

Version 1