Phylogenetic relationship among species of Rubus (Rosaceae) from southern Western Ghats of India: Morphological data aligns with the combined dataset of plastic and nuclear markers

doi:10.21203/rs.3.rs-2435634/v1

Download PDF

Research Article

Phylogenetic relationship among species of Rubus (Rosaceae) from southern Western Ghats of India: Morphological data aligns with the combined dataset of plastic and nuclear markers

https://doi.org/10.21203/rs.3.rs-2435634/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The present study explores the taxonomic delineation of Rubus taxa within south Western Ghats of India. Most of the species are aligned in two major subgenera, Idaeobatus and Malachobatus but were lacking systematic botany. The external morphological study developed fine dichotomous key characters for the discrimination of Rubus under study, but it was inadequate for the closely allied species. Therefore, the delineation of the taxa was studied by using the alignment of molecular sequences from three barcode regions (matK, rbcL, and nrITS) and phylogenetic tree of plastid (matK + rbcL), nuclear (nrITS), and combined (plastid + nuclear) genome was constructed for taxa discrimination. Fifteen Rubus collections were comparatively analyzed for the phylogenetic analysis including the inter-specific distance of eleven taxa and the intra-specific distance of four species. It was observed that the nuclear ITS marker had much higher sequence variations compared to the other loci. Phylogenetic relationship within Rubus is well resolved in combined datasets than nuclear and plastid data separately and in this study, the analyzed samples included in both Idaeobatus and Malachobatus formed a polyphyletic clade in all datasets except plastid phylogeny. Wherein the plastid genome, subgenus Malachobatus have shown more conserved sequences than subgenus Idaeobatus. Whereas, subgenus Malachobatus had shown limited species resolution than Idaeobatus in all barcode markers because a group of species belonging to subgenus Malachobatus has shown inadequate genetic variations within species similar to its limited morphological variability. Hence we considered this group a complex species among southern Western Ghats Rubus and it is recommended further studies.

Phylogeny

Plastid markers

Subgenus Idaeobatus and Malachobatus

Southern Western Ghats Rubus

Taxonomic delineation

The genus Rubus Linnaeus (1753: 492) is one of the largest genera in the family Rosaceae; comprising 1407 species (Plants of the World Online 2020). Most of them are perennial shrubs with biennial canes and few produce perennial or annual canes (Hummer 1996). The genus consists of raspberries, blackberries, arctic fruits flowering raspberries and is commonly referred to as brambles or briers. The plant possesses economic and ecological importance as fruit crops, ornamental, invasive weeds and one of the species in early forest succession (Thompson 1995; Hummer 1996; Howarth et al. 1997), and are promising excellent germplasm resources for plant breeding programme (Graham and Jennings 2009).

The genus is widely distributed in temperate to subtropical regions of the northern hemisphere (Lu and Boufford 2003), especially in south eastern Asia, East Asia and South America (Kalkman 1993). South-western China is being considered as centre of origin of Rubus species in the world because of the rich genetic diversity, large number of subgenera, extensive morphological variation and most endemism on species (Lu 1983; Lu and Boufford 2003). In India, the genus is represented by more than 75 taxa with the largest concentration in eastern Himalayan states (Hooker 1878; Gupta et al. 2016).

Rubus is recognised as one of the most disputed taxa of flowering plant and is complicated by frequent hybridization, polyploidy, apomixis and lack of a universal species concept (Nybom and Schaal 1990; Nybom and Hall 1991; Kraft et al. 1996; Alice and Campbell 1999) and to cause wide morphological variation within the genus. It is therefore, essential to construct a phylogenetic tree for their species discrimination and relationship analysis. Several molecular phylogenetic studies on Rubus species by using maternally inherited chloroplast markers or a bi-parentally inherited ribosomal DNA marker have been reported by different authors (Howarth et al. 1997; Alice and Campbell 1999; Alice et al. 2001; Morden et al. 2003; Michael 2006; Yang and Pak 2006; Imanishi et al. 2008; Alice et al. 2008; Zhang et al. 2015). Wang et al. (2016) employed three chloroplast DNA loci (rbcL, rpl20-rps12, and trnG-trnS), nuclear ribosomal ITS and two low-copy nuclear markers (GBSSI-2 and PEPC) on 142 Rubus taxa of China to understand the phylogenetic relationships within species, where the phylogeny has shown some contradiction between chloroplast and nuclear marker.

The southern part of the Western Ghats has eleven Rubus taxa of the total genus in India, which are including endemic species (eg. R. racemosus) (Ahmedulla and Nayar 1986; Sasidharan 2004; India Biodiversity 2014), threatened montane habituated species (eg. R. rugosus var. thwaitesii) (Sasidharan 2004; Robin and Nandini 2012), therapeutically useful species (eg. R. ellipticus, R. niveus, R. fairholmianus) (George et al. 2013a, b, c; George et al. 2014a, b; George et al. 2015) etc. Despite the study related to the ethnomedicinal and pharmacological values for southern Western Rubus taxa (Nayagam et al. 1993; Kumar and Vaidyalingam 2010; George et al. 2013a, b, c; George et al. 2014a, b; George et al. 2015; Mundargi et al. 2017), the information regarding the identity of Rubus taxa were in state of flux due to the absence of comprehensive work. Taxonomical treatment of genus Rubus across southern Western Ghats disclosed that the external morphological characters can serve as key traits for the discrimination of Rubus under study. However, it is sometimes difficult to delineate close allied species due to the existence of overlapping characters, and there are no systematic studies on the development of molecular marker for Rubus species. Hence, the present study was aimed to develop molecular sequences of the southern Western Ghats Rubus taxa based on the evidence of three barcode markers (matK, rbcL and nrITS) and to resolve the identity and phylogenetic relationships among southern Western Ghats Rubus taxa. The eleven taxa with total 15 collections, having different geographical locations were used in the study.

All the species under study were collected from the high-altitude evergreen and montane forest of Sothern Western Ghats, India. The fresh twig samples were collected and kept for herbarium preparation and for DNA based marker studies. Fifteen specimens were selected for molecular analysis, which includes Rubus ellipticus Sm. (2 accessions), Rubus rugosus var. thwaitesii Focke, Rubus niveus Thunb. (2 accessions), Rubus racemosus Roxb., Rubus fairholmianus Gard., (2 accessions), Rubus micropetalus Gard., Rubus gardnerianus Kuntz., Rubus glomeratus Bl., Rubus Indicus Thunb. (2 accessions), Rubus rosifolius var. coronarius, Rubus leucocarpus Arn. The selected taxa are sorted in to two subgenera viz. Malachobatus and Idaeobatus as per the literature of Focke (1910, 1911) and Thompson (1997) (Table 1). The dichotomous key characters of southern Western Ghats Rubus based on external morphological study are also given in Table 1 for the taxa identification.

Rosa leschenaultiana a member of the family Rosaceae was used as the out group species. The samples were also collected from the same study area. It represents woody plants and keeps distinct morphological features than Rubus.

Genomic DNA was isolated from 100 mg fresh leaves using the DNeasy® Plant Mini Kit (Qiagen, USA). Quality and quantity were confirmed using 0.8% Agarose Gel Electrophoresis and spectrophotometric methods. The PCR amplification was performed in a 20 µl reaction mixture, consisting of 1X PCR buffer (2 mM Mgcl2), 200 µM each of dATP, dCTP, dGTP, dTTP; 0.5 µM of each forward and reverse primers and 1 U of Taq polymerase (TakaRa-Taq), and DNA template (20 ng) DNA amplification was performed in a thermal cycler (Eppendorf, Germany). PCR products were separated by agarose gel electrophoresis (1.8%). The list of primers used their nucleotide sequences, annealing temperature and the specific PCR cycling conditions are shown in Table 2. The PCR products were purified using Nucleospin Gel and PCR Clean-up kit (Macherey-Nagel, Germany). The purified PCR products were sequenced using M13 universal primers (M13 forward and M13 reverse primers) on ABI 3730xl DNA sequencer at AgriGenome labs facility, Kochi, India. All the primers used in the study had an added universal M13 primer sequence at their 5’ ends, thus enabling the direct sequencing of the PCR products using the universal M13 primer.

Sequence Analysis

The genetic relationships between the selected Rubus species were analysed through statistical attributes and phylogenetic tree. Statistical analysis of sequence identity and nucleotide variation, inter- or intra-species genetic distances were calculated by using the Kimura-2-parameter model of MEGA6 (Tamura et al. 2013). The sequences were manually edited and aligned in MAFT-Multiple alignment program vr.7 (Katoh et al. 2019). The partition homogeneity test (PHT) was done for the matK and rbcL plastid markers separately and also the combined plastid data with the nuclear ITS data using the PAUP 4.0a (100 replicates with uninformative sites excluded (Swofford 2002). The MrModelTest2.4 (Nylander 2004) was used to identify the best substitution model for implementing the Maximum Likelihood (ML) and Bayesian Inference (BI) analysis using the data from MAFT alignment. The plastid (matK + rbcL), nuclear (ITS) and plastid + nuclear datasets were separately analysed to select the best suited models according to Akaike Information Criterion (AIC) (Akaike 1974). The BI was carried out using the MrBayes3.2.7a (Ronquist et al. 2012) using the parameter settings derived from the MrModelTest2.4. The Markov chains Monte Carlo (MCMC) algorithm was run for 1,000,000 generations with 4 chains with 2 independent runs, sampling one tree every 1000 generations. The distribution map and trace value were accessed by using Tracer v 1.6 (Rambaut et al. 2013) and FigTree1.4.4 (Rambaut 2014) was used to prepare the phylogenetic tree outputs. The ML settings from the AIC were implemented in PAUP4 with bootstrap support of 100000 replications.

Table 1

The infrageneric classifications of genus *Rubus* in southern Western Ghats region ^{a, b} and its phenotypic characters
Sl No.	Name of taxa including subgenus, section and series	Dichotomous key characters based on external morphology
Subg.-Malachobatus (Focke) Focke, sect.-Moluccani Focke (ser.-Rugosi)^a
1	R. micropetalus Gardner	Simple leaf; lobes present on leaf lamina; terminal lobes never sub-lobed; golden yellow colour on abaxial surface of leaflets; bracts linear in outline; petal 1/3rd length of the calyx lobe; fruit black in mature stage
2	R. fairholminaus Gardner	Simple leaf; 5 lobes present on leaf lamina; terminal lobes again sub-lobed; silvery white on abaxial surface of leaflets; bracts oblong-elliptic in outline; petal white and half to the length of calyx lobe; fruit red turn to black when mature
3	R. glomeratus Blume	Simple leaf; leaves sub-orbicular or ovate; bracts oblong in outline; flower white; petal equal or less than equal to calyx lobes; fruit red turn to black when mature
4	R. gardnerianus Kunthze	Simple leaf; leaves broadly ovate; flower pink or rose; fruit black; drupelets large and 8–14 number
5	R. rugosus var. thwaitesii Focke	Simple leaf; leaves orbicular; rugosus above; flower pink; black fruit; drupelets 10–35
Subg. Malachobatus (Focke) Focke ^b
6	R. indicus Thunb.	Simple leaf; lanceolate shaped lamina; inflorescence always laxly arranged; bracts boat shaped; flower white; fruit red
Subg. Idaeobatus (Focke) Focke, Sect. Idaeanthi Focke (Ser. nivei) ^a
7	R. niveus Thunb.	Compound leaf; imparipinnate; softly pubescent on adaxial surface and villous pubescent throughout abaxial surface; glaucous; greyish-white tomentose below; petal pink; shorter than sepal; fruit purple black
8	R. racemosus Roxb.	Compound leaf; imparipinnate; stem densely covered with red glandular hairs throughout; flower pink; petal same or less than equal to calyx lobe; fruit black
9	R. leucocarpus Arn.	Compound leaf; imparipinnate; leaf surface membranous; abaxial surface of leaflets glabrous except on nerves; white tomentose absent on abaxial area of leaf; flower pink; size of petal excluded in calyx lobe; drupelets white; no flavour.
Subg. Idaeobatus (Focke) Focke, Sect. Idaeanthi Focke (Ser. Elliptici) ^a
10	R. ellipticus Sm.	Compound leaf; palmately compound; white flower; yellow fruit
Subg. Idaeobatus (Focke) Focke, Sect. Rosaefolii ^a
11	R. rosifolius Sm. var. coronarius (Sims) Focke	Compound leaf; imparipinnate; flower solitary and white in colour, petals numerous, 100–150 in number, arranged in many rows; seems like rosa.

^afor an overview infrageneric classifications see Focke (1910, 1911) and ⁱnfrageneric classification of R. indicus provided by Thompson (1997) subg.(subgenus),sect.(section),ser.(series)

Table 2

List of primers used for the amplification of different loci and their PCR conditions
Sl.No	DNA region	Primers Name	Sequence (5'-3')	PCR reaction conditions
1	matK ^a	472F	CCCRTYCATCTGGAAATCTTGGTTC	94ºC for 3 min. 94 ºC for 30 sec. 48ºC for 40 sec. 35x 72 ºC for 1min. 72 ºC for 10 min.
1	matK ^a	1248R	GCTRTRATAATGAGAAAGATTTCTGC
2	ITS ^b	ITS-P5	CCTTATCAYTTAGAGGAAGGAG	94 ºC for 4 min. 94 ºC for 30 sec. 55 ºC for 40 sec. 34x 72 ºC for 1min. 72 ºC for 10 min.
2	ITS ^b	ITS- u4	RGTTTCTTTTCCTCCGCTTA
3	rbcL	1F ^c	ATGTCACCACAAACAGAAAC	95 ºC for 4 min. 95 ºC for 45 sec. 55 ºC for 30 sec. 35x 72 ºC for 50sec. 72 ºC for 8 min.
3	rbcL	724R ^d	TCGCATGTACCTGCAGTAGC

For an overview report see the references: ^a Yu et al. 2011; ^b Cheng et al. 2016; ^c Olmstead et al. 1992; ^d Fay et al. 1997.

Illustration of morphological traits

Table 1 represents infrageneric classification of genus Rubus in southern Western Ghats based on external morphological traits, and were disclosed the identity of eleven taxa so far from there. The taxa which includes two subgenera (Malachobatus and Idaeobatus) and three Sections (Moluccani, Idaeanthi and Rosaefolii). The genus is primarily segregated out as simple and compound leaves, in which all species represents simple leaf were categorised as subgenus Malachobatus and the rest of species having compound leaf character were grouped as subgenus Idaeobatus.

The following characters like occupancy of lobes and sub lobes on leaf lamina, leaf shape, colour of tomentose present underneath of leaflets, nature of inflorescence (either laxly or not) and bract (either boat shape or not) in plant, flower colour (either pink or white), ratio of petals and calyx lobes (small or greater), size and number of drupelets in fruit etc. were identified as key traits for discriminating taxa under subgenus Malachobatus. Whereas in subgenus Idaeobatus, the traits were seen as types of leaflets (either palmate or pinnate compound leaf), nature of tomentose in abaxial surface of leaflets (either glabrous or not), ratio of petals and calyx lobe, colour of flower and fruit, types of inflorescence (either solitary or not), number of petals (either five or numerous) in receptacles etc. However, some characters regarding the arrangements of leaflets, outline of leaf lamina, flower and fruit colour, shape of bracts and stipule etc. were observed here as an overlapping trait among close proximate taxa in each subgenus (Table 1).

Statistical analysis

The PCR amplification was done successfully in all Rubus species with one or the other primers and the results indicated that all the three DNA barcode regions (matK, rbcL and nrITS) were amplified and had 100% sequencing success. A comparative statistical analysis of genetic divergence and species specific substitution of the eleven Rubus species was legitimated the identity of individual species (Table 3). The inter-specific distances ranged from 0.051 − 0.021 in nrITS, 0.035 − 0.0074 in matK, 0.012 − 0.0056 in rbcL, and the number of marker nucleotide site ranged between 1–28 in nrITS, 0–23 in matK and 0–8 in rbcL. From those data we found that genetic distances and species specific substitution was maximum in nrITS and minimum in rbcL. Among the selected Rubus species, R. rosifolius var. coronarius, which had the highest inter-specific distances and marker nucleotide in all barcode region. The lowest distance was exhibited by R. fairholmianus, R. glomeratus and R. micropetalus in matK, and R. glomeratus, R. gardnerianus and R. micropetalus in rbcL. (Table 3).

Table 3

Statistical attributes of 11 *Rubus* taxa by using three barcode regions
DNA barcode region	Taxa	Amplicon length (bp)	Inter-specific distances	Intra-specific distances	Marker nucleotide site
matK	R. rugosus var. thwaitesii	630–633	0.013 ± 0.010	_____	4
	R. indicus	630–633	0.008 ± 0.009	0.000	1
	R. ellipticus	630–633	0.017 ± 0.0056	0.0003 ± 0.002	9
	R. niveus	630–633	0.011 ± 0.009	0.0000	6
	R. fairholmianus	630–633	0.0074 ± 0.010	0.0000	0
	R. racemosus	630–633	0.0125 ± 0.009	_____	7
	R. gardnerianus	630–633	0.0074 ± 0.001	_____	0
	R. micropetalus	630–633	0.0074 ± 0.001	_____	0
	R. rosifolius var. coronarius	630–633	0.035 ± 0.0022	_____	23
	R. glomeratus	630–633	0.0074 ± 0.010	_____	0
	R. leucocarpus	630–633	0.010 ± 0.0082	_____	2
rbcL	R. rugosus var. thwaitesii	505	0.0066 ± 0.0048	_____	0
	R. indicus	505	0.0064 ± 0.005	0.0000	1
	R. ellipticus	505	0.009 ± 0.0016	0.0000	5
	R. niveus	505	0.0105 ± 0.0046	0.0000	7
	R. fairholmianus	505	0.0064 ± 0.0054	0.0000	1
	R. racemosus	505	0.0090 ± 0.0041	_____	6
	R. gardnerianus	505	0.0056 ± 0.0046	_____	1
	R. micropetalus	505	0.0056 ± 0.0046	_____	1
	R. rosifolius var. coronarius	505	0.0121 ± 0.0015	_____	8
	R. glomeratus	505	0.0056 ± 0.0046	_____	1
	R. leucocarpus	505	0.0090 ± 0.0041	_____	5
NRITS	R. rugosus var. thwaitesii	428–430	0.025 ± 0.013	_____	4
	R. indicus	428–430	0.022 ± 0.0093	0.0000	8
	R. ellipticus	428–430	0.038 ± 0.0083	0.0000	18
	R. niveus	428–430	0.0235 ± 0.0135	0.0000	2
	R. fairholmianus	428–430	0.022 ± 0.0187	0.0000	17
	R. racemosus	428–430	0.021 ± 0.0125	_____	1
	R. gardnerianus	428–430	0.021 ± 0.0175	_____	16
	R. micropetalus	428–430	0.025 ± 0.0183	_____	18
	R. rosifolius var. coronarius	428–430	0.051 ± 0.0062	_____	28
	R. glomeratus	428–430	0.022 ± 0.0187	_____	16
	R. leucocarpus	428–430	0.023 ± 0.0126	_____	2

Phylogenetic Analysis

This is the first-ever genetic and phylogenetic report for the southern Western Ghats Rubus taxa. Here, we submitted 48 genetic sequences of three DNA markers, which represent 16 collections and 12 taxa (including Rosa leschenaultiana). Among these sequences, ten taxa and its corresponding sequences are new addition to the Genbank. The accession number obtained from the Genbank and the herbarium number from Centre for Medicinal Plant Research (CMPR- index Herbarium) are provided in Table 4.

Table 4

Herbarium voucher and NCBI Genbank accession numbers of 16 collections
Sl No.	Taxa	Herbarium No.	Accession No.
Sl No.	Taxa	Herbarium No.	matK	rbcL	nrITS
1	R. rugosus var. thwaitesii *	CMPR11781	MK157043	MK157044	MK144273
2	R. indicus (Accn. 1) *	CMPR11776	MK157053	MK157054	MK144278
3	R. indicus (Accn. 2) *	CMPR11784	MK157061	MK157062	MK144282
4	R. fairholmianus (Accn. 1) *	CMPR11783	MK157045	MK157046	MK144274
5	R. fairholmianus (Accn. 2) *	CMPR11775	MK157069	MK157070	MK144286
6	R. glomeratus *	CMPR11778	MK157071	MK157072	MK144287
7	R. gardnerianus *	CMPR11777	MK157055	MK157056	MK144279
8	R. micropetalus *	CMPR11785	MK157057	MK157058	MK144280
9	R. leucocarpus *	CMPR11773	MK157073	MK157074	MK144288
10	R. niveus (Accn. 1)	CMPR11780	MK157049	MK157050	MK144276
11	R. niveus (Accn. 2)	CMPR11787	MK157065	MK157066	MK144284
12	R. racemosus *	CMPR11782	MK157047	MK157048	MK144275
13	R. ellipticus (Accn.1)	CMPR11763	MK157051	MK157052	MK144277
14	R. ellipticus (Accn. 2)	CMPR11757	MK157063	MK157064	MK144283
15	R. rosifolius var. coronarius *	CMPR11772	MK157059	MK157060	MK144281
16	Rosa leschenaultiana *	CMPR11789	MK157067	MK157068	MK144285

Remarks: “*” denotes the taxa new to NCBI genbank. “Accn.” denotes Accession

After treating gaps as missing characters in the 16 collections including the outgroup, the aligned matK, rbcL and ITS loci had 707 base pair (bp), 619 bp and 686 bp length respectively. The combined cpDNA matrix had 1326 bp and plastid + nuclear DNA matrix had 2012 bp. The selected best fit models for matK + rbcL (plastid), ITS (nuclear) and plastid + nuclear were GTR + I, GTR + G and GTR + I + G respectively. The statistical attributes of sequence characteristics were estimated by using MEGA version 7 software, and the information is illustrated in Table 5. The data was estimated for plastid (matK + rbcL), Nuclear-ITS and combined plastid + nuclear datasets. The data matrix included Aligned nucleotide lengths (bp), GC (%) Variable sites (%), AIC selected models, Base Frequencies, Substitution Model (Rate Matrix), pinvar and gamma shape (G). The sequence characteristics vary in both in-group and out-group samples according to marker genes. Mean GC content is higher in DNA-nrITS than other markers for the in group and the outgroup. DNA-nrITS has shown much higher sequence variation than matK and rbcL marker gene.

Table 5

Comparison of sequence variation and best-fitting models selected for the plastid and nuclear markers
Region	matK + rbcL	ITS	Combined plastid + nuclear DNA
Aligned nucleotide lengths (bp)
Rubus plus outgroup	1326	686	2012
Rubus	1326	685	2011
GC content (%)
Rubus plus outgroup	38.6	56	44.5
Rubus	38.6	55.9	44.5
within section Idaeobatus	38.6	55.6	44.3
within section Malachobatus	38.6	56.1	44.6
Variable sites (%)
Rubus plus outgroup	74 (5.6%)	111 (16.2%)	185 (9.2%)
Rubus	52 (3.9%)	64 (9.3%)	116 (5.8%)
within section Idaeobatus	43 (3.24%)	46 (6.7%)	89 (4.4%)
within section Malachobatus	8 (0.6%)	27 (3.9%)	35 (1.7%)
AIC selected model	GTR + I	GTR + G	GTR + I + G
Base Frequencies
A	0.2839	0.2176	0.2596
C	0.1898	0.2726	0.2192
G	0.1929	0.2805	0.2230
T	0.3334	0.2293	0.2982
Substitution Model (Rate Matrix)
A-C	0.8894	0.7999	0.9796
A-G	0.9153	2.2060	1.4402
A-T	0.1669	1.7560	0.4617
C-G	0.6880	0.4002	0.4681
C-T	1.5509	7.9064	3.4698
G-T	1.0000	1.0000	1.0000
Pinvar	0.8406	0.0000	0.6772
G	-	0.3034	0.9098

Phylogeny of combined plastid (matK + rbcL) markers

The results of the BI and ML were congruent on major lines for the plastid dataset with three major clades A, B and C with good support (Fig. 1). The clade A had all members belonging to the subg. Malachobatus Sect. Moluccani Focke (ser. Rugosi), while clade B had two subclades B1 belonging to the sect. Idaeanthi Focke (ser. Elliptici) and B2 belonging to sect. Rosaefolii. The clade C had members belonging to sect. Idaeanthi Focke (Series nivei).

Phylogeny Of Nuclear Marker

For the nuclear dataset, few rearrangements were seen in the clades that were not obtained for the plastid dataset (Fig. 2). The clades A and C formed monophyletic sister clades in nuclear datasets in contrast to A and B in plastid dataset. One major incongruence between the results of the two datasets was the placement of the R. rugosus var. thwaitesii which was placed in the clade A in plastid based phylogeny and in clade C in the nuclear dataset. This placement of R. rugosus var. thwaitesii in nuclear dataset can be assumed to be probably wrong as it has a lower support and posterior values as compared to much higher support and confidence values in the plastid datasets. All the clades had placement of different sections and subgenus on expected lines, except for the placement of R. rugosus var. thwaitesii in nuclear dataset. The clade A had all the species of subg. Malachobatus sect. Moluccani Focke (Ser. Rugosi); clade B had sect. Idaeanthi Focke (ser. Elliptici); clade C had sect. Idaeanthi Focke (ser. nivei) and clade D had sect. Rosaefolii, all of which belonged to the Subgenus Idaeobatus (Focke) Focke.

Phylogeny Of Combined Plastid And Nuclear (Plastid + nuclear) Markers

The combined datasets clearly showed the best resolved taxonomic grouping as compared to the inconsistencies in the results of the plastid and the nuclear datasets taken exclusive of each other. The phylogeny based on plastid + nuclear dataset had 3 clades viz., clade A, clade B and clade C (Fig. 3)., Clade A (75% BS, 0.99 PP) and clade C (98% BS, 1 PP) having sect. Moluccani Focke (ser. Rugosi) and sect. Idaeanthi Focke (ser. nivei) respectively. Whereas Clade B had again been divided into two subclades viz., B1 (100% BS, 1 PP) and B2 (100% BS, 1 PP), which including sect. Idaeanthi Focke (ser. Elliptici) and sect. Rosaefolii. respectively. The Clades B and C were belonging to subg. Idaeobatus (Focke) Focke., while clade A exclusively had subg. Malachobatus (Focke) Focke. The BS and PP supports the major clades. The clade A was further subdivided into three clades A1, A2 and A3. The A1 (100% BS, 1 PP) had R. rugosus var. thwaitesii; A2 (98% BS, 1 PP) - R. indicus and A3 (98% BS, 1 PP) - R. gardennerianus, R. micropetalus, R. fairholmianus and R. glomeratus. The clade A3 was again subdivided in to A3.1 (> 50% BS, 0.6 PP) and A3.2 (> 50% BS, 0.7 PP), had R. gardenerianus, R. micropetalus and R. fairholmianus, R. glomeratus respectively.

The clade C, sect. Idaeanthi Focke (ser. nivei) had clades C1 (100% BS, 1 PP) R. leucocarpus and C2 (67% BS, 0.95 PP) R. niveus Thunb. and R. racemosus Roxb., indicating that the species R. leucocarpus was aligned as outgroup in the ser. nivei.

The results of the ML and BI analysis were in agreement on major lineages for the analysis of the three datasets. The Figs. 1, 2 and 3 represents 50% majority rule consensus tree from BI analysis with ML bootstrap support (BS) and BI posterior probabilities (PP) for the plastid, nuclear and plastid + nuclear datasets respectively. The intra-specific distance of Rubus species (Figs. 1, 2 and 3), collected from different geographical locations did not express much genetic variation within these molecular regions.

Sequence variation and discriminatory quality of marker gene

In this study, we assessed three DNA barcode regions, such as matK, rbcL and DNA-nrITS for the identification of eleven Rubus taxa. The matK and rbcL datasets were combined and used for phylogenetic analysis. Among the individual markers, nrITS has had a much higher sequence variation and GC content in all groups (Tables 3 and 4). The comparison of species resolution within the subgenus revealed that it was limited within subgenus Malachobatus because of insufficient inter-specific variation, which was in line with what Wang et al. (2016) had reported. The most important reasons, which leads to reduction of species resolution are insufficient data, noisy sequences, rapid diversification, polyploidization and reticulate evolution (Sochor et al. 2015; Spalink et al. 2016).

The amplification based on three DNA regions had 100% success, however, perusal of the quality of markers, none of them fits for inter-specific discrimination. Hence, individually, markers did not seem to support key morphological characters (Alice and Campbell 1999). Multiple studies reported that the combination of two or more DNA markers have ability to discriminate the inter-specific variation, and the studies suggested both coding and non-coding regions are useful for sequence analysis (Kress and Erickson 2007; CBOL plant working group 2009; Yang et al. 2012; Tripathi et al. 2013; Vassou et al. 2015; Kim et al. 2016). The Plant Working Group of the Consortium for the Barcode of Life (CBOL) proposed the combination matK and rbcL as the core marker for land plants, with non-coding plastid region (trnH–psbA, atpF–atpH, and psbK–psbI) as supplementary barcode. The multiple marker gene analysis was previously done in Rubus species, and could trace out the phylogenetic relationship among the closely associated species (Morden et al. 2003; Yang and Pak 2006; Alice et al. 2008; Wang et al. 2016; Li et al. 2019). In our present study, we exercised two coding chloroplast region (matK and rbcL) and one non coding nuclear region (nrITS) to infer the phylogenetic relationships among the Rubus taxa from the Western Ghats of South India. The study revealed that, combined barcode region (matK + rbcL + nrITS) is more reliable for the resolving of Rubus taxa in a meaningful manner and has shown excellent discriminative power than that of nrITS or plastid locus alone (Fig. 3). Probably the plastid data gave a very good back bone for the arrangement of the phylogeny with the data from the nuclear datasets helping in resolving the ends of the tree.

Phylogeny of southern Western Ghats Rubus taxa

The only one comprehensive world monographic treatment of Rubus was made more than 100 years ago (Focke 1910, 1911), where the genus was divided into 12 subgenera, the largest being Rubus (132 species), Idaeobatus (117 species) and Malachobatus (115 species) (Yu et al. 2022). Subgenus Rubus is concentrated mainly in Europe and North America region, whereas, subgenus Idaeobatus and Malachobatus are typically found throughout Asia, especially China (Lu and Boufford 2003). According to his monographic study, the taxa habituating in southern Western Ghats region are categorised in two subgenera namely, Idaeobatus and Malachobatus, and representing five and six taxa respectively (Table 1). The other important sub generic classification of Rubus was provided by Thompson (1997) in his cytological survey of Rubus and included chromosome count for Rubus species. As per his study, subgenus Idaeobatus are predominantly diploid species, while subgenus Malachobatus have polyploidy species. Phylogenetic insights of taxa based on two subgenera are given below.

Phylogenetic insights of subgenus Idaeobatus and Malachobatus

Subgenus Idaeobatus (Focke) Focke subsection Idaeobatus is considered as one of the largest sections in Rubus, and contains predominantly diploid species (Thompson 1997; Naruhashi et al. 2002). Present study demonstrated that subg. Idaeobatus was a polyphyletic group with at least two independent evolutionary route, that means the analysed samples included in the sect. Idaeobatus was occurring in more than two clades even in the plastid phylogeny. This is congruent with its morphological heterogeneity (Wang et al. 2016). Therefore, all data sets were ideal for the illustration of morphological heterogeneities of species within the sect. Idaeobatus except for nrITS based tree, where R. rugosus var. thwaitesii forms part of clade C which was having all the species of the sect. Ideanthi Focke (ser. nivei). Rubus taxa belonging to subgenus Idaeobatus represents compound leaves having pinnate and palmate arrangements, while the taxa of subg. Malchobatus has advanced with simple leaves. R. rugosus var. thwaitesii had simple leaves which was wrongly placed in the phylogenetic tree derived from the nr-ITS data in a clade C which had all the members with compound leaves. In the combined phylogenetic tree all the members of subgenus Idaeobatus sect. Idaeanthi, included R. niveus Thunb., R. leucocarpus Arn. and R. racemosus Roxb. (sect. Idaeanthi; ser. nivei, clade C) characterised by raspberry type fruit, woody stem, pinnately arranged compound leaves and pink coloured petals, and the species R. ellipticus (sect. Idaeanthi; ser. elliptici, clade B) possess raspberry type fruit, woody stem, palmately trifoliate leaves, white petals, and yellow drupelets. The other Idaeobatus species, R. rosifolius var. coronarius (clade D) is a subshrub and possess pinnately compound leaf and white petals arranged in two rows almost rivalling Rosa (Table 1). Hence, subg. Idaeobatus habituating in southern Western Ghats region have shown clean discriminative characters and are resolved in expected line corresponding to its external traits.

Critical Note: The identity of three allied species viz. R. niveus, R. racemosus and R. leucocarpus are in a state of flux due the absence of comprehensive study. The existence of overlapping characters between these species and the lack of detailed description led them for misidentification in many herbaria. The present phylogenetic study based on three DNA markers shows that three species are aligned in three lineages with more than 60% of boot strap values. Therefore, the obtained results can reduce the taxonomical complexities among these allied species and also behave as supplementary data for the previously identified R. racemosus species (Bhavadas et al. 2019).

Subgenus Malachobatus (Focke) Focke., primarily known as Asian subgenus which represents polyploidy complex (Thompson 1997; Naruhashi et al. 2002; Wang et al. 2016). Southern Western Ghats samples of this subgenus Malachobatus are all simple leaved with lobed lamina. The present study inferred that subgenus Malachobatus formed monophyletic clade only in plastid phylogeny, where all samples were clustered together within single clade. However, the later have shown more than two independent evolutionary routes for their samples segregation. But, in the case of nrITS, we were observed one phylogenetic incongruent between the nuclear and plastid topologies, and it was previously discussed in the ITS phylogeny. Therefore, we considered combined datasets is ideal phylogenetic tree for the illustration of morphological discrimination within subg. Malachobatus. Four of the six members of clade A, belonging to subclades A3 viz., R. fairholmianus, R. micropetalus, R. gardnerianus, R. glomeratus and the rest of them are in subclade A1 (R. rugosus var. thwaitesii) and subclade A2 (R. indicus) (Fig. 3). The dichotomous key characteristics of R. rugosus var. thwaitesii (sect. moluccani ser. Rugosi) shows simple leaved taxon having orbicular shaped lamina, rugosus characteristics on adaxial surface of leaflets, pink coloured flower and black drupelets, while R. indicus has lanceolate shaped lamina, boat shaped bracts and laxly arranged inflorescence with white petals and red drupelets (Table 1). These morphological discriminations can be clearly matched in the phylogenetic tree.

However, a group of species (sect. Moluccani Focke) placed in subclade A3 (Fig. 3) has shown lower resolution, it may due to insufficient inter-specific variation among those species (Table 5). Present study disclosed that subg. Malachobatus are more conserved in plastid gene fragments and have sharing close proximate characters such as leaf lamina shape, pectinate elongated bracts, white coloured petals with erratic size and red (immature stage) and black (mature stage) drupelets, which may have led them to be positioned in less expressive clade. The R. gardnerianus was unique in this group by its rose coloured petals and large finite (8–14) black drupelets (Table 1).

Critical Note: In the present study it is observed that R. rugosus var. thwaitesii are nested within distantly related ser. nivei clade in nr ITS phylogeny (Fig. 2). Many studies (Linder and Rieseberg 2004; Wang et al. 2016) reported that frequent hybridization and genetic introgression can cause phylogenetic incongruence in genus. Hence, the possibility for Rubus hybridization may have occurred not only between closely related species but also between species from different section (Bammi and Olmo 1966; Iwatsubo and Naruhashi 1992; Thompson 1997; Randell et al. 2004). However, we need to take the combined data as best possible solution as was done here, which could then either support or reject the incongruent grouping.

Evolution of morphological characters

The evolutionary study of genus Rubus is still controversial. The existing studies have suggested that evolution in Rosaceae (Kalkman 1987) and Rubus (Lu 1983) proceeded from woody to herbs and from compound leaf to simple leaf. Here, Lu (1983) treated subgenus Idaeobatus as the most primitive, but the molecular phylogenetic study based on nrITS were not support to this hypothesis and were considered semi herbaceous and simple leaved species are to be the most primitive (Alice and Campbell 1999). Whereas, Yang et al. (2012) were inferred distinct evolutionary hypothesis on Korean Rubus taxa by using cpDNA and nrDNA and to suggested that the evolution proceed from herbs to woody plant and from a compound leaf to simple leaf.

In our study, the evolutionary route of Rubus was analysed on the basis of combined dataset (Fig. 3) and the study shows the taxa from same subgenus and sections having clustered together as single unit. Two distinctive branches were seen in molecular phylogeny, in which basal parts of the tree (B and C) represent species from subg. Idaeobatus with compound leaves and clade A had subg. Malachobatus with simple leaved species. The other remarkable observation is that the placement of R. rosifolius var. coronarius in basal parts of tree and are the representatives of subshrub habit species. Herein, the taxon keeps distinct lineage than other Rubus in-groups (the representative woody shrub).

Molecular sequencing has been carried out in southern Western Ghats Rubus taxa by using three barcode markers such as matK, rbcL and nrITS and the subsequent phylogenetic trees were constructed by using plastid genome (MatK + rbcL), nuclear genome (nr ITS) and combined barcode DNA (plastid + nuclear). Among the individual markers nrITS has shown much better degree of resolution in Rubus taxa. However, the plastid and nuclear genome provided new genetic information for the southern Western Ghats Rubus taxa, but has low resolution among close proximate taxa and exhibit phylogenetic incongruence between gene trees, when using either of the genome types was encountered. The existing studies revealed that pervasive incongruence between the datasets might be due to frequent hybridization and genetic introgression. Combination of plastid and nuclear data provided an alignment data that resolved Rubus taxa on expected line. Here, the plastid marker may act as good backbone for the expression of genetically variable nuclear marker. Totally eleven taxa are reported so far from southern Western Ghats region, in which 5 taxa are belonging to subgenus Idaeobatus and the rest of them to subgenus Malachobatus. In this study, it is clear that both subg. Idaeobatus and Malachobatus are polyphyletic within and between the subgenus, except in plastid phylogeny. In the case of plastid genome, all species which are included in subg. Malachobatus have shown comparatively more conserved sequences than Idaeobatus. Whereas, some species belonging to subg. Malachobatus have shown fewer sequence variations similar to its limited morphological variability. Therefore, we recommended further studies for this disputed species in order to complete its systematic botany.

This is the first report of taxonomic and phylogenetic analysis from southern Western Ghats Rubus taxa. Systematics of Rubus along with the phylogenetic relationship were supporting conventional morphology to a great extent and this could relax the taxonomical complexities existing in subg. Idaeobatus. Moreover, the obtained genomic sequences will open a new insight for the selected Rubus taxa in global phylogeny studies and the result will be serve as supplementary data for the Rubus revision.

Data availability The datasets generated or analysed during the current study are available from the corresponding author on reasonable request.

Code availability Not applicable.

Author’s contribution BN collected the specimen as part of Ph. D work, analysed its molecular taxonomy and wrote initial manuscript. UBT mentored the Ph. D work, and provided research guidance and corrections. RPR supervised the research work and provided technical and academic support.

Conflict of interest The authors declare no competing interests.

Acknowledgments I express my great sense of gratitude to the Registrar, Research co-ordinator and staff of Research and Evaluation Centre, Bharathiar University, Coimbatore for giving me the opportunity to do my doctoral work. Authors are also thankful to Project Director (Dr. Indira Balachandran), Deputy Project Director (Dr. Geetha S Pillai) and Scientist (Dr. S. Sadheeshna Kumari) of the Centre for Medicinal Plants Research, Kottakkal Arya Vaidyasala, Malappuram for giving me the facilities to do my research work. We are also thankful to Dr. K.M. Prabhukumar, Senior Scientist, Plant Diversity, Systematics and Herbarium, CSIR-National Botanical Research Institute, Lucknow for supporting me while during the field exploration and identification time. Authors are grateful to the Department of Forests for providing necessary assistance during the fieldwork.

Funding Not applicable

Ahamedhullah M, Nayar MP (1986) Endemic plants of the Indian region. Botanical Survey of India, Calcutta.
Akaike H (1974) A new look at the statistical model identification. IEEE Trans Automat Contr 19(6): 716–723. https://doi.org/10.1109/TAC.1974.1100705.
Alice LA., Campbell CS (1999) Phylogeny of Rubus (Rosaceae) based on nuclear ribosomal DNA internal transcribed spacer region sequences. Am J Bot 86(1): 81–97. https://doi.org/10.2307/2656957
Alice LA, Dodson TM, Sutherland BL (2008) Diversity and relationships of Bhutanese Rubus (Rosaceae). Acta Hort 777: 63–70. https://doi.org/10.17660/ActaHortic.2008.777.5
Alice LA, Eriksson T, Eriksen B, Campbell CS (2001) Hybridization and gene flow between distantly related species of Rubus (Rosaceae): Evidence from nuclear ribosomal DNA internal transcribed spacer region sequences. Sys Bot 26(4): 769–778. https://doi.org/10.1043/0363-6445-26.4.769
Bammi RK Olmo HP (1966) Cytogenetics of Rubus. V. Natural Hybridization between R. procerus P.J. Muell. and R. laciniatus Willd. Evol 20(4): 617–633. https://doi.org/10.2307/2406596
Bhavadas N, Prabhukumar KM, Umesh BT (2019) On the identity and occurrence of Rubus racemosus (Rosaceae) in India with note on its neotypification. Plant Sci Today 6(3): 342–345. https://doi.org/10.14719/pst.2019.6.3.541
CBOL Plant Working Group (2009) A DNA Barcode for Land Plants. Proc Natl Acad Sci U.S.A 106: 12794–12797. http://dx.doi.org/10.1073/pnas.0905845106
Cheng T, Xu C, Lei L, Li C, Zhang Y, Zhou S (2016) Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity. Mol Ecol Resour 16: 138–149. https://doi.org/10.1111/1755-0998.12438
Fay MF, Cameron KM, Prance G, Lledo TD, Chase MW (1997) Familial relationships of Rhabdodendron (Rhabdodendraceae): plastid rbcL sequences indicate a caryophyllid placement. Kew Bull 52(4): 923–932. https://doi.org/10.2307/4117819
Focke WO (1910) Species Ruborum. Monographiae Generis Rubi Prodromus part I. Bibliotheca Botanica 17. Stuttgart E Schweizerbart, NewYork.
Focke WO (1911) Species Ruborum. Monographiae Generis Rubi Prodromus part II. Bibliotheca Botanica 17. Stuttgart E Schweizerbart, NewYork.
George BP, Parimelazhagan T, Chandran R (2013a) Evaluation of total phenolic content, antioxidant and analgesic potential of Rubus fairholmianus Gard. Int J Pharm Pharm Sci 5(3): 484–488.
George BP, Parimelazhagan T, Chandran R (2014a) Anti-inflammatory and wound healing properties of Rubus fairholmianus Gard. root—an in vivo study. Ind Crops Prod 54 216–225. https://doi.org/10.1016/j.indcrop.2014.01.037
George BP, Parimelazhagan T, Saravanan S (2013b) Anti-inflammatory, analgesic and antipyretic activities of Rubus ellipticus Smith. leaf methanol extract. Int J Pharm Pharm Sci 5(2): 220–224.
George BP, Parimelazhagan T, Saravanan S, Chandran R (2013c) Anti-inflammatory, analgesic and antipyretic properties of Rubus niveus Thunb. root acetone extract. Pharmacologia 4(3): 228–235. DOI:10.5567/pharmacologia.2013.228.235
George BP, Parimelazhagan T, Sulaiman C, Piramanayagam S, Ramaswamy SK (2014b) Bioassay Directed Isolation and Biological Evaluation of Compounds Isolated from Rubus fairholmianus Gard. BioMed Res Int 2014: 15. https://doi.org/10.1155/2014/204340
George BP, Parimelazhagan T, Yamini TK, Sajeesh T (2015) Antitumor and wound healing properties of Rubus ellipticus Smith. J Acupunct Meridian Stud 8(3): 134–141. https://doi.org/10.1016/j.jams.2013.10.002
Graham J, Jennings N (2009) Raspberry breeding. In: Priyadarshan PM Mohan Jain S (eds) Breeding Plantation Tree Crops, New York, Springer, pp 233–248.
Gupta C, Dash SS, Brach AR (2016) Lectotypification of two names in the genus Rubus L. (Rosaceae). Phytotax, 266: 297–300. https://doi.org/10.11646/phytotaxa.266.4.8
Hooker JD (1878) Rosaceae. In: Hooker JD (ed) The Flora of British India, Vol 2. L. Reeve and Co., London, pp 307–342.
Howarth DJ, Gardner DE, Morden CW (1997) Phylogeny of the Rubus subgenus Idaeobatus (Rosaceae) and its implication towards the colonization of Hawaiian Islands. Syst Bot 22(3): 433–441. https://doi.org/10.2307/2419819
Hummer KE (1996) Rubus diversity. HortScience 31 (2): 182–183. https://doi.org/10.21273/HORTSCI.31.2.182
Imanishi H, Nakahara K, Tsuyzaki H (2008) Genetic relationships among native and introduced Rubus species in Japan based on rbcL sequence. Acta Hortic 769: 195–199. https://doi.org/10.17660/ActaHortic.2008.769.26
India Biodiversity (2014) Online portal of India Biodiversity. Available at https://indiabiodiversity.org/species/show/263943, Accessed 1 January 2023.
Iwatsubo Y, Naruhashi N (1992) Cytotaxonomical studies of Rubus (Rosaceae) I. Chromosome numbers of 20 species and 2 natural hybrids. J Jap Bot 67: 270–275.
Kalkman C (1987) The genus Rubus (Rosaceae) in Malesia 3: The subgenus Micranthobatus. Blumea 32: 323–341.
Kalkman C (1993). Rosaceae. In de Wilde WJJO, Nooteboom HP, Kalkman C (eds) Flora Malesiana, Flowering Plants Seri. I- Spermatophyta. Rijksherbarium, Leiden University, Leiden, pp 227–351.
Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108
Kim WJ, Ji Y, Choi G, Kang YM, Yang S, Moon BC (2016) Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences. Genet Mol Res 15 (3): 1–12. https://doi.org/10.4238/gmr.15038472
Kraft T, Nybom H, Werlemark G (1996) DNA fingerprint variation in some blackberry species (Rubus subg. Rubus, Rosaceae). Pl Syst Evol 199: 93–108. https://doi.org/10.1007/BF00985920
Kress WJ, Erickson DL (2007) A two-locus global DNA barcode for land plants: The coding rbcL gene complements the non-coding trnH-psbA Spacer Region. PLos One 2(6): 508. https://doi.org/10.1371/journal.pone.0000508
Kumar PR Vaidyalingam V (2010) Isolation, characterization and evaluation of anti-convulsant activity of Rubus racemosus. International Journal of Pharmacognosy and Phytochemical Research, 2(3), 26–29.
Li Y, Wang Y, Guo F, Xiong, J, Liu L, Liu Y, Chen Q, Tang H, Wang X (2019) Phylogenetic relationships among Tibet Rubus (Rosaceae) Species inferred from multiple chloroplast and nuclear DNA sequences. AIP Conf Procee 2079. 8th Int Conf Biotech Bioeng 2079 (1). https://doi.org/10.1063/1.5092380
Linder CR., Rieseberg LH (2004) Reconstructing patterns of reticulated evolution in plants. Am J Bot 91(10): 1700–1708. https://doi.org/10.3732/ajb.91.10.1700
Linnaeus C (1753) Species Plantarum Vol. 1. Laurentius Salvius, Stockholm (Holmiae).
Lu LD, Boufford DE (2003) Rubus L: In Wu ZH, Raven PH (eds) Flora of China, 9. Science Press, Beijing and Missouri Botanical Garden Press, St. Louis, pp 195–286.
Lu LT (1983) A study on the genus Rubus of China. Acta Phytotax Sin 21: 13–25.
Michael K (2006) Clarification of Basal Relationships in Rubus (Rosaceae) and the Origin of Rubus chamaemorus. Master’s Thesis and Specialist Project, University of Western Kentucky. https://digitalcommons.wku.edu/theses/250
Morden CW, Gardner DE, Weniger DA (2003) Phylogeny and biogeography of Pacific Rubus subgenus Idaeobatus (Rosaceae) species: Investigating the origin of the endemic Hawaiian raspberry R. macraei. Pac Sci 57(2): 181–197. https://muse.jhu.edu/article/40666/pdf
Mundaragi A, Devarajan T, Jeyabalan S, Bhat S, Hospet R (2017) Unexploited and underutilized wild edible fruits of Western Ghats in southern India. Agronomy 60: 326–339.
Naruhashi N, Iwatsubo Y, Peng C (2002) Chromosome numbers in Rubus (Rosaceae) of Taiwan. Bot Bull Acad 43(3): 193–201.
Nayagam MC, Pushparaj MS, Rajan S (1993) Less known edible fruit – yielding plants of Nilgiris. Anc. Sci Life 12(3–4),:363–376.
Nybom H, Hall HK (1991) Minisatellite DNA fingerprints can distinguish Rubus cultivars and estimate their degree of relatedness. Euphytica, 53: 107–114. https://doi.org/10.1007/BF00023790
Nybom H, Schaal BA (1990) DNA fingerprints reveal genotypic distributions in natural populations of blackberries and raspberries (Rubus, Rosaceae). Am J Bot 77(7): 883–888. https://doi.org/10.1002/j.1537-2197.1990.tb15183.x
Nylander JAA (2004) MrModeltest version 2.4. Program Distributed by the Author Evolutionary Biology Centre, Uppsala University, Uppasala, Sweden.
Olmstead RG, Michaels HJ, Scott KM, Palmer JD (1992) Monophyly of the Asteridae and identification of the major lineages inferred from DNA sequences of rbcL. Ann Mo Bot Gard 79(2): 249–265. https://doi.org/10.2307/2399768
POWO (2022) Plants of the World Online. Facilitated by the Royal Botanic Gardens, Kew. Available at http://www.plantsoftheworldonline.org/, Accessed 1 January 2023
Rambaut A (2014) FigTree v1.4.2, Tree Figure Drawing Tool Version 1.4.2. http://tree.bio.ed.ac.uk/software/figtree/
Rambaut A, Suchard MA, Xie W. Drummond AJ (2013) Tracer: MCMC Trace Analysis Tool. Version v1.6.0. http://tree.bio.ed.ac.uk/software/tracer/
Randell RS, Howarth DG, Morden CW (2004) Genetic analysis of natural hybrids between endemic and alien Rubus (Rosaceae) species in Hawai’i. Conserv Gene 5: 217–230. https://doi.org/10.1023/B:COGE.0000030006.30410.5d
Robin VV, Nandini R (2012) Shola habitats on sky islands: Status of research on montane forests and grasslands in southern India. Curr Sci 103(12): 1427–1437.
Ronquist F, Teslenko M, Mark P, Ayres D, Darling A, Hohna S, Larget B, Liu L, Suchard M, Huelsenbeck J (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space Syst Biol 61: 539–42. https://doi.org/10.1093/sysbio/sys029.
Sasidharan N (2004) Biodiversity documentation of Kerala. Part 6. Flowering Plants. KFRI Handbook. No. 17. Kerala Forest Research Institute, Peechi, Thrissur.
Sochor M, Vasut RJ, Sharbel TF, Travnícek B (2015) How just a few makes a lot: Speciation via reticulation and apomixes one example of European brambles (Rubus subgen. Rubus, Rosaceae). Mol Phylogenet Evol 89: 13–27. https://doi.org/10.1016/j.ympev.2015.04.007
Spalink D, Drew BT, Pace MC, Zaborsky, JG, Li P, Cameron KM (2016) Evolution of geographical place and niche space: Patterns of diversification in the North American sedge (Cyperaceae) flora. Mol Phylogenet Evol 95: 183–195. https://doi.org/10.1016/j.ympev.2015.09.028
Swofford DL (2002) PAUP. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. DOI:10.1111/j.0014-3820.2002.tb00191.x
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30: 2725–2729. http://dx.doi.org/10.1093/molbev/mst197
Thompson MM (1995) Chromosome numbers of Rubus species at the National Clonal Germplasm Repository. HortScience 30 (7): 1447–1452. https://doi.org/10.21273/HORTSCI.30.7.1447
Thompson MM (1997) Survey of chromosome numbers in Rubus (Rosaceae: Rosoideae). Ann Mo Bot Gard 84(1): 128–164.
Tripathi AM, Tyagi A, Kumar A, Singh A, Singh S, Chaudhary LB, Roy S (2013) The Internal Transcribed Spacer (ITS) region and trnH-psbA are suitable candidate loci for DNA barcoding of tropical tree species of India. PLos One 8(2). https://doi.org/10.1371/journal.pone.0057934
Vassou SL, Kusuma G, Parani M (2015) DNA barcoding for species identification from dried and powdered plant parts: A case study with authentication of the raw drug market samples of Sida cordifolia. Gene 559(1): 86–93. https://doi.org/10.1016/j.gene.2015.01.025
Wang Y, Chen Q, Chen T, Tang H, Liu L, Wan X. (2016) Phylogenetic Insights into Chinese Rubus (Rosaceae) from Multiple Chloroplast and Nuclear DNAs. Front Plant Sci 7: 968. https://doi.org/10.3389/fpls.2016.00968
Yang JY, Pak J (2006) Phylogeny of Korean Rubus (Rosaceae) based on its (nrDNA) and trnL/F intergenic region (cpdna). J Plant Biol 49: 44–54. https://doi.org/10.1007/BF03030787
Yang JY, Jang SY, Kim H, Park SJ (2012) Development of a molecular marker to discriminate Korean Rubus species medicinal plants based on the nuclear ribosomal DNA internal transcribed spacer and chloroplast trnL-F intergenic region sequences. J Korean Soc Appl Bi 55: 281–289. https://doi.org/10.1007/s13765-012-1044-6
Yu J, Fu J, Fang Y, Xiang J, Dong H (2022) Complete chloroplast genomes of Rubus species (Rosaceae) and comparative analysis within the genus. BMC Genom 23(32). https://doi.org/10.1186/s12864-021-08225-6
Yu J, Xue J, Zhou S (2011) New universal matK primers for DNA barcoding angiosperms. J Syst Evol 49 (3): 176–181. https://doi.org/10.1111/j.1759-6831.2011.00134.x
Zhang L, Wang Y, Chen Q, Luo Y, Zhang Y, Tang HR (2015) Phylogenetic utility of Chinese Rubus (Rosaceae) based on ndhF sequences. Acta Hortic Sin 42: 19–30. https://doi:10.16420/j.issn.0513353x.2014-0752

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Phylogenetic relationship among species of Rubus (Rosaceae) from southern Western Ghats of India: Morphological data aligns with the combined dataset of plastic and nuclear markers

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Sequence Analysis

Results

Illustration of morphological traits

Statistical analysis

Phylogenetic Analysis

Phylogeny of combined plastid (matK + rbcL) markers

Phylogeny Of Nuclear Marker

Phylogeny Of Combined Plastid And Nuclear (Plastid + nuclear) Markers

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1