Mechanisms of human umbilical cord mesenchymal stem cells-derived exosomal lncRNA GAS5 in alleviating EMT of HPMCs via Wnt/β-catenin signaling pathway

doi:10.21203/rs.3.rs-2435901/v1

Download PDF

Research Article

Mechanisms of human umbilical cord mesenchymal stem cells-derived exosomal lncRNA GAS5 in alleviating EMT of HPMCs via Wnt/β-catenin signaling pathway

https://doi.org/10.21203/rs.3.rs-2435901/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The aim of this study was to reveal mechanisms of exosomal lncRNA GAS5 derived from human umbilical cord mesenchymal stem cells (hUC-MSCs) on epithelial-mesenchymal transition (EMT) of human peritoneal mesothelial cells (HPMCs) under high glucose (HG) conditions. HPMCs were stimulated with 2.5% glucose. The effects on EMT of HPMCs were observed by using an hUC-MSC conditioned medium (hUC-MSC-CM) and extracted exosomes. Four groups were established: ① control group,②HG group (2.5% glucose), ③conditioned medium (CM) group (2.5% glucose and 7.5% MSC-CM), and ④ exosome group (2.5% glucose and exosomes extracted from 7.5% MSC-CM), all treated for 48 h. After hUC-MSCs were transfected with GAS5 siRNA, exosomes were extracted to act on HPMCs. Western blot assay and real-time PCR were used to detect expressions of EMT markers, PTEN and Wnt/β-catenin pathway in HPMCs. Based on the real-time PCR, the changes in levels of expression of lncRNA GAS5 and miR-21 were detected. We found that HG could induce the EMT of HPMCs. Compared with the HG group, the hUC-MSC-CM could alleviate EMT of HPMCs induced by HG through exosomes. Exosomes in the hUC-MSC-CM entered HPMCs, by transferring lncRNA GAS5 to HPMCs, which down-regulates miR-21 and up-regulates PTEN, thus finally alleviating EMT of HPMCs. Wnt/β-catenin pathway plays an essential role in alleviating EMT of HPMCs by exosomes in the hUC-MSC-CM. By transferring lncRNA GAS5 to HPMCs, exosomes derived from hUC-MSCs may competitively bind to miR-21 to regulate suppression on target PTEN genes and alleviate EMT of HPMCs through Wnt/β-catenin pathway.

peritoneal dialysis

human umbilical cord mesenchymal stem cell

exosome

human peritoneal mesothelial cell

epithelial-mesenchymal transition

Peritoneal dialysis (PD) is one of the important alternative therapies for end-stage renal diseases (ESRD), however, owing to the peritonea of long-term PD patients being repeatedly exposed to high-glucose (HG) dialysate, biologically incompatible dialysate can make peritoneal mesothelial cells (PMCs) lose their normal morphologies and functions, eventually leading to ultrafiltration failure (UFF) and peritoneal fibrosis (PF)(1). In recent years, studies show that epithelial-mesenchymal transition (EMT) of human peritoneal mesothelial cells (HPMCs) induced by HG was an initiating and reversible step of PF in PD patients(2). Therefore, to explore the mechanisms of occurrence and effective measures to delay, or even reverse, the progression of EMT has important theoretical and clinical significance for prolonging the dialysis time and improving the quality of life of ESRD patients.

In recent years, stem cells have received extensive attention and clinical and basic experiments on stem cell therapy have been widely reported. Stem cell therapy has proven to be able to improve multi-system fibrosis including blood, heart, liver, and kidney(3–6). Due to advantages, such as more powerful proliferation and differentiation ability, convenient access to materials and low immunogenicity, human umbilical cord mesenchymal stem cells (hUC-MSCs) have better prospects for application compared with other stem cells. At present, the application of MSCs in the treatment of various systemic diseases has become a focus for researchers, but its mechanisms remain to be explored. In many disease models, MSCs could achieve therapeutic purposes through paracrine, rather than differentiation(7).

Exosomes, as important paracrine substances of MSCs, contain a variety of proteins, non-coding ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), and messenger RNAs (mRNAs), serve as important carriers for information transmission among cells(8). Recent studies by other researchers found that exosomes derived from hUC-MSCs could alleviate fibrosis of organs, such as liver, lung, and kidney(9–11). The latest research reports that exosomes in PD effluents could cause peritoneal injury by transferring substances, such as proteins, thus causing EMT of PMCs(12).

The latest studies indicates that there was a specific expression profile of long non-coding RNA (lncRNA) in fibrous tissues, such as lung, kidney, liver, and heart: these differentially expressed lncRNA may play an important regulatory role in the occurrence and development of fibrosis(13). lncRNA was found to also exist in exosomes(14), accounting for about 20% of exosomes in some patients(15), while the role of lncRNA in exosomes in regulating EMT of PMCs has rarely been reported. Previous studies conducted by this team show that miR-21 targeting phosphatase and tensin homolog deleted on chromosome ten (PTEN) plays an important role during EMT of HPMCs(16). Furthermore, some studies indicate that lncRNA growth-arrest-specific transcript 5 (lncRNA GAS5) could be used as competing endogenous RNA (ceRNA) to competitively bind to miR-21, to regulate the suppression of miR-21 on target PTEN genes, thus regulating EMT of tumor cells(17).

Recent studies showed that the Wnt signaling pathway play an important role in organ fibrosis and EMT, and they could be classified into canonical and non-canonical pathway according to different modes of action. Wnt/β-catenin canonical signaling pathway have been proved to be involved in the occurrence of fibrosis of myocardium, kidney, and liver(18–20). Furthermore, PTEN was found to be able to regulate EMT by reducing the level of Wnt(21), indicating that Wnt may interact with PTEN to regulate the progression of EMT of HPMCs.

The current study aimed to determine whether hUC-MSCs derived exosomal lncRNA GAS5 could competitively bind to miR-21 to regulate suppression of target PTEN genes and alleviate EMT of HPMCs through Wnt/β-catenin signaling pathway.

Cell culture and transfection

Human peritoneal mesothelial cell line, HPMCs was established by Professor Pierre Ronco of French Tenon Hospital(22), and donated by Professor Xu Huimian and Doctor Nadi of The First Hospital of China Medical University. HPMCs were cultured in a culture dish with a diameter of 60 mm with Dulbecco's modified Eagle medium (DMEM, Gibco) and then cultured in an incubator in an atmosphere containing 5% CO₂ at 37 ℃ by adding 10% foetal bovine serum (Serapro). Fresh complete culture medium was replaced every 2d. When HPMCs were cultured to complete confluence, they were passaged and grouped. HPMCs were cultured with 2.5% HG for 48 h and were then collected for subsequent testing. lncRNA GAS5 siRNA and negative control (NC) were purchased from GenePharma (Shanghai, China). According to the instructions provided by the manufacturers, GAS5 siRNA and NC were transfected with Lipofectamine 3000 (Invitrogen). The transfection efficiency was verified by real-time polymerase chain reaction (PCR) analysis within 24 h after transfection.

hUC-MSCs and stem cell culture medium were purchased from Shenyang Engineering Technology R&D Center of Cell Therapy Co., Ltd (Liaoning Province, China). When cells were cultured to about 80% confluence, the culture medium was replaced with fresh serum-free medium, and the hUC-MSC-CM was collected after further culturing for 48 h. hUC-MSC-CM was collected for downstream experiments after being filtered through a 0.22-µm filter. Characterization of MSC plastic adhesion is observed under a light microscope. Flow analysis revealed MSC specific surface markers, CD73, CD90, and CD14 (eBioscience, US). Osteogenesis, adipogenesis, and chondrogenesis were confirmed by Alizarin Red, Oil Red, and Alcian Blue staining (Cyagen, China).

Relevant experiments on exosomes

Extraction and identification of exosomes

The cultural hUC-MSC-CM was pre-filtered through a 0.22-µm PVDF filter (Millipore, USA), and the exosomes were collected by ultracentrifugation at 100,000 g for 2 h at 4°C followed by classical methods reported in the literature (23). The morphologies of extracted exosomes were observed by negative staining through an electron microscope (NOVEL). Moreover, Zeta view PMX110 (Particle Metrix) equipped with the Nanoparticle Tracking Analysis (NTA) software (ZetaView 8.02.28) was used for size determination and quantitative analysis of exosomes.

Exosome labeling

Those HPMCs in the logarithmic growth phase were inoculated on a 24-well plate at a seeding density of 10⁴/mL, with 1 mL in each well. After being cultured overnight under 5% CO₂ at 37 ℃, the cell confluence reached about 20%. The cells were washed three times with PBS, and cultured in the replaced serum-free medium under 5% CO₂ at 37 ℃. Those exosomes labelled as PKH67 were added. After 6 h of culture, the uptake of exosomes by cells was observed. By utilizing an inverted fluorescence microscope, the uptake of exosome by cells was observed and photographed under irradiation by light (485 nm) after 6 h.

Nuclear staining: the fixed cells were incubated with 4% PFA for 15 min at room temperature and then incubated with 5 µg/mL of 4’,6-diamidino-2 phenylindole (DAPI) for 10 min under protection against exposure to light at room temperature. The cells were washed with PBS. Moreover, by using an inverted fluorescence microscope, nuclear staining was observed and photographed under irradiation by light (365 nm) using a 40× objective lens.

Western Blot detection

HPMCs were collected in each group and fully lysed with radio immunoprecipitation assay for 15 to 20 min. The cells were centrifuged for 15 min at 12,000 rpm at a low temperature and the protein concentration was quantified by the bicinchoninic acid (BCA) method. The samples of 40 ug were subjected to 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) (Beyotime) and electro-transferred onto a polyvinylidene fluoride (PVDF) film for 120 min at a constant current of 200 mA. Then, the samples were sealed for 1 to 2 h at room temperature in 5% non-fat dry milk/ Tris-buffered saline Tween (TBST). The primary antibodies (rabbit monoclonal α-SMA, rabbit monoclonal E-cadherin, rabbit monoclonal Vimentin, rabbit monoclonal PTEN, rabbit monoclonal wnt3a, rabbit monoclonal β-catenin, rabbit monoclonal CD63, rabbit monoclonal TSG101 and mouse monoclonal βactin antibodies were obtained from Abcam) were diluted with TBST, and the corresponding bands were incubated overnight from primary antibody dilution buffer at 4 ℃. The secondary antibodies were incubated for 1 to 2 h at room temperature and bands were developed by electrochemiluminescence (ECL) method. Experiments were repeated at least 3 times.

Real-time PCR detection

The total RNAs of cells were extracted according to instructions provided with the Trizol kit and complementary DNAs (cDNAs) were synthesized by reverse transcription (RT) according to the instructions provided with the TAKARA reverse transcription kit. The primer sequences of real-time PCR were in Table 1. The reaction system included upstream and downstream primers of separately 1.0 ul, SYBR Premix Ex TapII of 12.5 ul, cDNA template of 2.0 ul, and ddH₂O of 8.5 ul (the reaction system volume was 25 ul in total). The reaction conditions were as follows: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 5 s, and annealing at 60 ℃ for 30 s (for a total of 45 cycles). The relative expression of mRNAs was expressed as 2^−ΔΔCt × 100%.

Table 1

The primer sequences of real-time PCR
Target	Primer sequences
lncRNA GAS5	Forward primer: 5’-CAGATGCAGTGTGGCTCTGGA‐3’
	Reverse primer: 5’-TGTGTGCCAATGGCTTGAGTTAG‐3’
β-catenin	Forward primer: 5’-CCTTCCTgggCATggAgTC‐3’
	Reverse primer: 5’- gAggAgCAATgATCTTgATCTTC‐3’
Wnt3a	Forward primer: 5’-GCCATCGGTGACTTCCTCAA‐3’
	Reverse primer: 5’- TTGAAGTAGGTGTAGCGCGG‐3’
E-cadherin	Forward primer: 5’-gtcactgacaccaacgataatcct‐3’
	Reverse primer: 5’- tttcagtgtggtgattacgacgtta‐3’
α-SMA	Forward primer: 5’- cctcccttgagaagagttacga‐3’
	Reverse primer: 5’- gatgctgttgtaggtggtttca‐3’
Vimentin	Forward primer: 5’-CAGTCACTCACCTGCGAAGT‐3’
	Reverse primer: 5’- agttagcagcttcaagggca‐3’
GAPDH	Forward primer: 5’-GCACCGTCAAGGCTGAGAAC − 3’
	Reverse primer: 5’- TGGTGAACACGCCAGTGGA − 3’
miR-21-5p	RT primer: 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACATCAGT‐3’
	Forward primer: 5’-GGCGGTAGCTTATCAGACTGATG‐3’
	Reverse primer: 5’-GTGCAGGGTCCGAGGTATTC‐3’
U6	RT primer: 5’-AACGCTTCACGAATTTGCGT‐3’
	Forward primer: 5’-CTCGCTTCGGCAGCACA‐3’
	Reverse primer: 5’-AACGCTTCACGAATTTGCGT‐3’

Immunofluorescence

HPMCs were grown to 60 ~ 70% confluence following which they were cultured with HG or exosomes for 48h. Cells were fixed with 4% paraformaldehyde for 15 min after washed with phosphate-buffered saline (PBS) 3 times, and then blocked in 5% Bovine Serum Albumin V for 1h at 37℃. The primary antibodies (rabbit monoclonal β-catenin were obtained from Abcam) were diluted with 1% Bovine Serum Albumin V, and 6-well plates were incubated overnight from primary antibody dilution buffer at 4 ℃. The secondary antibodies (TRITC Goat Anti-Rabbit IgG from Earthox) were incubated for 1h at 37℃ protected from light and nucleus were stained by DAPI. Images were taken with an inverted fluorescence microscope.

Dual luciferase reporter gene assay

PmirGLODual-Luciferase miR Target Expression Vector (Promega)was used to verify the targeting relationship between lncRNA GAS5 and miR-21. The wild-type reporter constructpmirGLO-GAS5 or the mutant reporter constructpmirGLO-GAS-mut(miR-21) was cotransfected withmiR-21 mimic or miR-Control in 293 T cells. Then we verified the targeting relationship between PTEN and miR-21. The wild-type reporter constructpmirGLO-PTEN or the mutant reporter constructpmirGLO-PTEN-mut(miR-21) was cotransfected withmiR-21 mimic or miR-Control in 293 T cells. Aftertransfection for 48h, the luciferase activity of each group of cells was detected using a Dual-Luciferase Reporter Assay System (Promega). Each experiment was repeated at least three times.

Statistical analysis

All data were statistically processed using SPSS21.0 software. The measurement data were expressed as mean ± SEM and one-way analysis of variance (ANOVA) was used for comparison between groups; p < 0.05 represented difference of statistical significance.

Identification of hUC-MSCs

According to ISCT, three criteria are proposed to define MSCs: adherence to plastic, specific surface antigen expression, and multipotent differentiation potential (24). The 4-5th generation hUC-MSCs adhered to the wall and grew in a fibroblast-like shape under a light microscope (Fig. 1A). A flow analysis revealed that the surface of hUC-MSCs was positively stained with CD73 (100%), CD90 (100%), and negatively with CD14 (0.50%) (Fig. 1B). The above results indicate that hUC-MSCs have been successfully identified. 21 days after osteogenesis induction, brownish red opaque calcium nodules appeared (Fig. 1C). Oil Red O staining of numerous lipid droplets indicated adipogenic differentiation (Fig. 1D). The endogenous acid mucopolysaccharide in cartilage tissue by Alcian Blue staining proved the chondrogenic differentiation ability of HUMSCs (Fig. 1E).

Identification of exosomes

Electron microscopic results showed that exosomes in the saucer-like structures could be clearly observed in the samples of the hUC-MSC-CM (Fig. 2A). NTA results indicated that the average size of exosome vesicles was 135.7 nm (Fig. 2B). Western Blot assay results suggested that CD63 and TSG101 proteins were significantly expressed (Fig. 2C). These results demonstrated that exosomes had been successfully extracted from the hUC-MSC-CM.

hUC-MSC-CM alleviating EMT of HPMCs stimulated by HG through exosomes

Compared with the control group, HPMCs stimulated by 2.5% HG significantly up-regulated expressions of α-SMA and vimentin and down-regulate the expression of E-cadherin, indicating that HG stimulation induced EMT of HPMCs (Fig. 3A-C). In comparison with the HG stimulation group, the hUC-MSC-CM could alleviate EMT of HPMCs induced by HG, as do exosomes extracted from the hUC-MSC-CM, suggesting that the hUC-MSC-CM mainly alleviates EMT through exosomes.

Furthermore, it was found that HG treatment could down-regulate the expression of lncRNA GAS5 in HPMCs and the treatments with the hUC-MSC-CM and with exosomes restored the expression of lncRNA GAS5 (Fig. 3D). Expressions of miR-21 and target PTEN proteins were also detected and the results showed that the expression of miR-21 was up-regulated (Fig. 3E), while that of PTEN was down-regulated (Fig. 3F-G) in HPMCs stimulated by HG, the hUC-MSC-CM and exosomes down-regulated the expression of miR-21(Fig. 3E) and restored the expression of PTEN (Fig. 3F-G). Based on the above results, it was considered that the hUC-MSCs-CM transfer lncRNA GAS5 through exosomes, thus alleviating EMT of HPMCs stimulated by HG through lncRNA GAS5/miR-21/PTEN.

Detection of exosomes entering recipient cells

Exosomes derived from hUC-MSCs were labelled with PKH67 and finally used to incubate HPMCs. It was found that PKH67 was expressed in HPMCs incubated with exosomes, indicating that exosomes secreted by hUC-MSCs could enter recipient cells, namely HPMCs (Fig. 4).

Exosomal lncRNA GAS5 from hUC-MSCs competitively bind to miR-21 to regulate suppression on target PTEN genes to alleviate EMT of HPMCs

To verify that exosomal lncRNA GAS5 from the conditioned media of hUC-MSCs regulate EMT of HPMCs, hUC-MSCs were transfected with GAS5siRNA, so that the expression of lncRNA GAS5 was significantly down-regulated in hUC-MSCs and exosomes (Fig. 5A-B). Compared with HG group, exosomes secreted from hUC-MSCs NC GAS5i group significantly reduced the levels of α-SMA and vimentin and increased the level of E-cadherin in HG treated HPMCs, indicating that exosomes secreted from hUC-MSCs NC GAS5i could attenuate EMT of HPMCs. Compared with HG + NC GAS5i exo group, exosomes secreted from hUC-MSCs low-expressing lncRNA GAS5 significantly increased the levels of α-SMA and vimentin and reduced the level of E-cadherin (Fig. 5C-E). Meanwhile, the expression of lncRNA GAS5 in HPMCs was down-regulated (Fig. 5F), the expression of miR-21 was up-regulated (Fig. 5G), and the expression of PTEN was significantly down-regulated (Fig. 5H-I). These data show that, exosomal lncRNA GAS5 from hUC-MSCs down-regulate miR-21 and up-regulate PTEN to alleviate EMT of HPMCs.

The preliminary study conducted by the research team demonstrated that miR-21 targeting PTEN played an important role in EMT of HPMCs(16). According to bioinformatics analysis, the bioinformatics software predicted that the binding sites of miR-21 were contained in lncRNA GAS5 and PTEN (Fig. 5J, L). Dual-luciferase reporter gene assay was used to verify the interaction between lncRNA GAS5 and miR-21, the relative luciferase activity was significantly decreased in GAS-WT and miR-21 mimic cotransfection group, and luciferase activity was not suppressed in GAS-MUT and miR-21 mimic cotransfection group. (Fig. 5K). Dual-luciferase reporter gene assay was then used to verify the interaction between PTEN and miR-21, the relative luciferase activity was significantly decreased in PTEN-WT and miR-21 mimic cotransfection group, and luciferase activity was not suppressed in PTEN-MUT and miR-21 mimic cotransfection group (Fig. 5M), suggesting that lncRNA GAS5 may act as ceRNA to bind competitively to miR-21, thus regulating the expression of target PTEN genes. These data show that, by transferring lncRNA GAS5 to HPMCs, exosomal lncRNA GAS5 from hUC-MSCs competitively bind to miR-21 to regulate suppression on target PTEN genes, so as to finally alleviate EMT of HPMCs.

lncRNA GAS5 in exosomes from hUC-MSCs-CM alleviating EMT through Wnt/β-catenin pathway

Compared with the control group, HPMCs stimulated by 2.5% HG significantly up-regulated the expressions of Wnt3a and β-catenin proteins and mRNA, indicating that HG could stimulate EMT of HPMCs through Wnt/β-catenin pathway (Fig. 6A-C). Compared with the HG stimulation group, the hUC-MSC-CM and exosomes could alleviate activation of Wnt/β-catenin pathway, showing that exosomes from the hUC-MSC-CM could alleviate EMT of HPMCs through Wnt/β-catenin pathway (Fig. 6A-C). Compared with HG group, exosomes secreted from hUC-MSCs NC GAS5i group significantly reduced the levels of Wnt3a and β-catenin in HG treated HPMCs, indicating that exosomes secreted from hUC-MSCs NC GAS5i could attenuate activation of Wnt/β-catenin in HPMCs EMT. Compared with HG + NC GAS5i exo group, exosomes secreted from hUC-MSCs low-expressing lncRNA GAS5 significantly increased the expressions of Wnt3a and β-catenin (Fig. 6D-F). Addtionally, transferring into nucleus of β-catenin in HG treated HPMCs was alleviated by exosomes secreted from hUC-MSCs (Fig. 6G). These results imply that exosomes from the hUC-MSCs-CM could suppress Wnt/β-catenin pathway to alleviate EMT of HPMCs by transferring lncRNA GAS5 to HPMCs.

In comparison with the traditional hemodialysis, PD had the advantages of simple operation, good removal of meso-molecular substances, slow decline of residual renal functions, and stable hemodynamics, thus saving medical resources and health expenditure to a great extent(25). However, long-term PD could result in UFF and PF, thus withdrawing from PD. At present, there was still a lack of effective and feasible methods with which to solve PF, therefore, exploring mechanisms of PF and effective measures to alleviate PF is of clinical significance in prolonging the survival of PD patients.

EMT of HPMCs was considered as the core step in PF(25). When EMT occurred in the presence of inflammation or pro-fibrosis stimulation, the phenotypic expression of epithelial cells, such as E-cadherin in HPMCs was suppressed, leading to a loss of cell junction. Furthermore, the cells have fibroblast-like morphologies and the phenotypic expression of mesenchymal cells, such as vimentin and α-SMA in cells was up-regulated, so that the cells could obtain the properties and functions of mesenchymal cells(25). Finally, this resulted in PF and UUF. This research shows that HG stimulation could induce EMT of HPMCs.

The therapeutic effects of MSCs on fibrosis of tissues, such as liver, lung, and kidney have been widely studied and such effects mainly depend on paracrine function(3–7). As important paracrine substances of MSCs, exosomes contained various proteins, non-coding RNAs, DNAs, and mRNAs, and were important carriers for information transmission among cells(8). Zhong et al. reported that micro-vesicles derived from mesenchymal stem cell could suppress cell cycle inhibitors P15 and P19 in vivo and in vitro and restart cell cycles, thus reversing EMT(26). Grange et al. considered that extracellular vesicles (EVs) derived from human liver stem-like cells (HLSCs) and MSCs could suppress and reverse the progression of fibrosis in a mouse model for diabetic nephropathy. This was realized by down-regulating fibrosis-related gene Serpina1a, FAS ligand, CCL3, TIMP1, MMP3, Collagen I, and Snail(27). Jin et al. proved that exosomes derived from adipose-derived mesenchymal stem cells (ADMSC-Exo) attenuated EMT of podocytes by suppressing ZEB2 gene transcription with miR-215-5p(28). Our research results confirmed that the hUC-MSCs-CM alleviates EMT of HPMCs through exosomes.

As carrier, exosomes can encapsulate various information molecules, including lipids, proteins, RNA, etc(29). Li C et al. suggested that LncRNA GAS5 in exosomes may candidate as an ideal noninvasive marker to identify early NSCLC(30). LncRNA GAS5 contained in exosomes derived from ADMSCs can modulate inflammation(31). Additionally, lncRNA GAS5 has been proved to inhibit EMT in prostate cancer(32). Cesana et al. revealed that lncRNA can be used as ceRNA sponge miRNAs to regulate the expression of downstream genes(33). As a competing endogenous RNA for miR-96-5p, lncRNA GAS5 promotes renal tubular epithelial fibrosis(34). Likewise, LncRNA GAS5 directly bind to miR-21 to suppress EMT in human uveal melanoma(35). By coincidence, our previous research confirmed that lncRNA GAS5 can competitively combine with miR-21 to regulate PTEN and influences EMT in HPMCs(36). This research further demonstrates that exosomal lncRNA GAS5 from hUC-MSCs competitively bind to miR-21 to regulate suppression on target PTEN genes to alleviate EMT of HPMCs (Fig. 7).

An increasing number of studies suggested that Wnt/β-catenin signaling pathway may be involved in the EMT process of tissues, such as lung, liver, and kidney(18–20). When the pathway was activated, Wnt ligands were likely to bind to receptors to activate β-catenin as a nuclear shuttle and bind to T-cell factor/lymphoid enhancer factor (TCF/LEF) to activate the transcription of fibronectin, MMP-7, PAI-1, and target genes, such as Twist and Snail(37). As shown in the latest studies, by detecting HPMCs in PD effluents of PD patients, it was found that compared with the group undergoing PD for less than one month, the expressions of Wnts and β-catenin in the group undergoing PD more than one year were significantly up-regulated. Moreover, the detection results of indices including E-cadherin and α-SMA indicated the occurrence of EMT. In addition, in vitro and animal experiments also confirm that HG may promote EMT of HPMCs by activating Wnt/β-catenin signaling pathway (38–40). This indicates that Wnt/β-catenin signaling pathway may be involved in EMT of peritoneal tissues. The research results also illustrated that Wnt/β-catenin signaling pathway could be activated after treatment with HG and exosomes from the hUC-MSCs-CM suppress Wnt/β-catenin pathway by transferring lncRNA GAS5 to HPMCs, thus finally alleviating the occurrence of EMT of HPMCs (Fig. 7).

In conclusion, exosomes from the hUC-MSCs-CM could alleviate EMT of HPMCs induced by HG. The mechanism is to regulate lncRNA GAS5/miR-21/PTEN through Wnt/β-catenin signaling pathway, and ultimately alleviate the occurrence of HPMCs EMT. This study provides a new scientific basis for illustrating effects and mechanisms of action of exosomes derived from hUC-MSC in PD-related PF and offers a new opportunity to prolong survival time and improve the quality of life of PD patients.

Ethical approval and consent to participate

Not applicable.

Consent for publication

All authors read and approved the final manuscript.

Availability of data and material

The data used to support the findings of this study are available from the corresponding author upon request.

Competing interests

The authors report no relationships that could be construed as a conflict of interest.

Funding

This research was supported by the National Natural Science Foundation of China (Grant No. 81970663) and Shenyang Science and Technology Planning Project (Grant No. 22-321-32-01).

Authors’ Contributions

Yi Fan and Lina Yang contributed to the study design. Yuling Huang, Yi Fan and Lina Yang performed the experiments, analyzed the data and wrote the article.

Acknowledgements

Not applicable.

Zhang, K., Zhang, H., Zhou, X., Tang, W.B., Xiao, L., Liu, Y.H., Liu, H., Peng, Y.M., Sun, L. and Liu, F.Y. (2012) miRNA589 regulates epithelial-mesenchymal transition in human peritoneal mesothelial cells. J Biomed Biotechnol, 2012, 673096.
de Graaff, M., Zegwaard, A.H., Zweers, M.M., Vlijm, A., de Waart, D.R., Vandemaele, F., Struijk, D.G. and Krediet, R.T. (2010) The effects of a dialysis solution with a combination of glycerol/amino acids/dextrose on the peritoneal membrane in chronic renal failure. Perit Dial Int, 30, 192-200.
Selicean, S.E., Tomuleasa, C., Grewal, R., Almeida-Porada, G. and Berindan-Neagoe, I. (2019) Mesenchymal stem cells in myeloproliferative disorders - focus on primary myelofibrosis. Leuk Lymphoma, 60, 876-885.
Lin, Y., Zhang, F., Lian, X.F., Peng, W.Q. and Yin, C.Y. (2019) Mesenchymal stem cell-derived exosomes improve diabetes mellitus-induced myocardial injury and fibrosis via inhibition of TGF-β1/Smad2 signaling pathway. Cell Mol Biol (Noisy-le-grand), 65, 123-126.
Manka, P., Zeller, A. and Syn, W.K. (2019) Fibrosis in Chronic Liver Disease: An Update on Diagnostic and Treatment Modalities. Drugs, 79, 903-927.
Xiang, E., Han, B., Zhang, Q., Rao, W., Wang, Z., Chang, C., Zhang, Y., Tu, C., Li, C. and Wu, D. (2020) Human umbilical cord-derived mesenchymal stem cells prevent the progression of early diabetic nephropathy through inhibiting inflammation and fibrosis. STEM CELL RES THER, 11, 336.
Zhao, T., Sun, F., Liu, J., Ding, T., She, J., Mao, F., Xu, W., Qian, H. and Yan, Y. (2019) Emerging Role of Mesenchymal Stem Cell-derived Exosomes in Regenerative Medicine. Curr Stem Cell Res Ther, 14, 482-494.
Tavasolian, F., Hosseini, A.Z., Soudi, S. and Naderi, M. (2020) miRNA-146a Improves Immunomodulatory Effects of MSC-derived Exosomes in Rheumatoid Arthritis. Curr Gene Ther, 20, 297-312.
Li, T., Yan, Y., Wang, B., Qian, H., Zhang, X., Shen, L., Wang, M., Zhou, Y., Zhu, W., Li, W. et al. (2013) Exosomes derived from human umbilical cord mesenchymal stem cells alleviate liver fibrosis. Stem Cells Dev, 22, 845-854.
Xu, C., Zhao, J., Li, Q., Hou, L., Wang, Y., Li, S., Jiang, F., Zhu, Z. and Tian, L. (2020) Exosomes derived from three-dimensional cultured human umbilical cord mesenchymal stem cells ameliorate pulmonary fibrosis in a mouse silicosis model. Stem Cell Res Ther, 11, 503.
Ji, C., Zhang, J., Zhu, Y., Shi, H., Yin, S., Sun, F., Wang, Q., Zhang, L., Yan, Y., Zhang, X. et al. (2020) Exosomes derived from hucMSC attenuate renal fibrosis through CK1δ/β-TRCP-mediated YAP degradation. Cell Death Dis, 11, 327.
Corciulo, S., Nicoletti, M.C., Mastrofrancesco, L., Milano, S., Mastrodonato, M., Carmosino, M., Gerbino, A., Corciulo, R., Russo, R., Svelto, M. et al. (2019) AQP1-Containing Exosomes in Peritoneal Dialysis Effluent As Biomarker of Dialysis Efficiency. Cells, 8.
Cao, G., Zhang, J., Wang, M., Song, X., Liu, W., Mao, C. and Lv, C. (2013) Differential expression of long non-coding RNAs in bleomycin-induced lung fibrosis. Int J Mol Med, 32, 355-364.
Huang, X., Yuan, T., Tschannen, M., Sun, Z., Jacob, H., Du, M., Liang, M., Dittmar, R.L., Liu, Y., Liang, M. et al. (2013) Characterization of human plasma-derived exosomal RNAs by deep sequencing. BMC Genomics, 14, 319.
Huang, X., Yuan, T., Liang, M., Du, M., Xia, S., Dittmar, R., Wang, D., See, W., Costello, B.A., Quevedo, F. et al. (2015) Exosomal miR-1290 and miR-375 as prognostic markers in castration-resistant prostate cancer. Eur Urol, 67, 33-41.
Yang, L., Fan, Y., Zhang, X., Gao, L. and Ma, J. (2018) Role of miRNA-21/PTEN on the high glucose-induced EMT in human mesothelial peritoneal cells. AM J TRANSL RES, 10, 2590-2599.
Zeng, B., Li, Y., Jiang, F., Wei, C., Chen, G., Zhang, W., Zhao, W. and Yu, D. (2019) LncRNA GAS5 suppresses proliferation, migration, invasion, and epithelial-mesenchymal transition in oral squamous cell carcinoma by regulating the miR-21/PTEN axis. Exp Cell Res, 374, 365-373.
Wang, Y., Zhou, C.J. and Liu, Y. (2018) Wnt Signaling in Kidney Development and Disease. Prog Mol Biol Transl Sci, 153, 181-207.
Akcora, B., Storm, G. and Bansal, R. (2018) Inhibition of canonical WNT signaling pathway by β-catenin/CBP inhibitor ICG-001 ameliorates liver fibrosis in vivo through suppression of stromal CXCL12. Biochim Biophys Acta Mol Basis Dis, 1864, 804-818.
Yang, D., Fu, W., Li, L., Xia, X., Liao, Q., Yue, R., Chen, H., Chen, X., An, S., Zeng, C. et al. (2017) Therapeutic effect of a novel Wnt pathway inhibitor on cardiac regeneration after myocardial infarction. Clin Sci (Lond), 131, 2919-2932.
Shan, G., Zhou, X., Gu, J., Zhou, D., Cheng, W., Wu, H., Wang, Y., Tang, T. and Wang, X. (2021) Downregulated exosomal microRNA-148b-3p in cancer associated fibroblasts enhance chemosensitivity of bladder cancer cells by downregulating the Wnt/β-catenin pathway and upregulating PTEN. Cell Oncol (Dordr), 44, 45-59.
Stylianou, E., Jenner, L.A., Davies, M., Coles, G.A. and Williams, J.D. (1990) Isolation, culture and characterization of human peritoneal mesothelial cells. KIDNEY INT, 37, 1563-1570.
Fan, B., Li, C., Szalad, A., Wang, L., Pan, W., Zhang, R., Chopp, M., Zhang, Z.G. and Liu, X.S. (2020) Mesenchymal stromal cell-derived exosomes ameliorate peripheral neuropathy in a mouse model of diabetes. DIABETOLOGIA, 63, 431-443.
Dominici, M., Le Blanc, K., Mueller, I., Slaper-Cortenbach, I., Marini, F.C., Krause, D.S., Deans, R.J., Keating, A., Prockop, D.J. and Horwitz, E.M. (2006) Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. CYTOTHERAPY, 8, 315-317.
Yáñez-Mó, M., Lara-Pezzi, E., Selgas, R., Ramírez-Huesca, M., Domínguez-Jiménez, C., Jiménez-Heffernan, J.A., Aguilera, A., Sánchez-Tomero, J.A., Bajo, M.A., Alvarez, V. et al. (2003) Peritoneal dialysis and epithelial-to-mesenchymal transition of mesothelial cells. N Engl J Med, 348, 403-413.
Zhong, L., Liao, G., Wang, X., Li, L., Zhang, J., Chen, Y., Liu, J., Liu, S., Wei, L., Zhang, W. et al. (2018) Mesenchymal stem cells-microvesicle-miR-451a ameliorate early diabetic kidney injury by negative regulation of P15 and P19. Exp Biol Med (Maywood), 243, 1233-1242.
Grange, C., Tritta, S., Tapparo, M., Cedrino, M., Tetta, C., Camussi, G. and Brizzi, M.F. (2019) Stem cell-derived extracellular vesicles inhibit and revert fibrosis progression in a mouse model of diabetic nephropathy. Sci Rep, 9, 4468.
Jin, J., Wang, Y., Zhao, L., Zou, W., Tan, M. and He, Q. (2020) Exosomal miRNA-215-5p Derived from Adipose-Derived Stem Cells Attenuates Epithelial-Mesenchymal Transition of Podocytes by Inhibiting ZEB2. Biomed Res Int, 2020, 2685305.
Huang, Y. and Yang, L. (2021) Mesenchymal stem cells and extracellular vesicles in therapy against kidney diseases. STEM CELL RES THER, 12, 219.
Li, C., Lv, Y., Shao, C., Chen, C., Zhang, T., Wei, Y., Fan, H., Lv, T., Liu, H. and Song, Y. (2019) Tumor-derived exosomal lncRNA GAS5 as a biomarker for early-stage non-small-cell lung cancer diagnosis. J CELL PHYSIOL, 234, 20721-20727.
Patel, R.S., Impreso, S., Lui, A., Vidyarthi, G., Albear, P. and Patel, N.A. (2022) Long Noncoding RNA GAS5 Contained in Exosomes Derived from Human Adipose Stem Cells Promotes Repair and Modulates Inflammation in a Chronic Dermal Wound Healing Model. Biology (Basel), 11.
Lu, T.T., Tao, X., Li, H.L., Gai, L., Huang, H. and Li, F. (2022) LncRNA GAS5 enhances tumor stem cell-like medicated sensitivity of paclitaxel and inhibits epithelial-to-mesenchymal transition by targeting the miR-18a-5p/STK4 pathway in prostate cancer. ASIAN J ANDROL, 24, 643-652.
Cesana, M., Cacchiarelli, D., Legnini, I., Santini, T., Sthandier, O., Chinappi, M., Tramontano, A. and Bozzoni, I. (2011) A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. CELL, 147, 358-369.
Wang, W., Jia, Y.J., Yang, Y.L., Xue, M., Zheng, Z.J., Wang, L. and Xue, Y.M. (2020) LncRNA GAS5 exacerbates renal tubular epithelial fibrosis by acting as a competing endogenous RNA of miR-96-5p. BIOMED PHARMACOTHER, 121, 109411.
Qi, Y., Cui, Q., Zhang, W., Yao, R., Xu, D. and Zhang, F. (2020) Long Non-Coding RNA GAS5 Targeting microRNA-21 to Suppress the Invasion and Epithelial-Mesenchymal Transition of Uveal Melanoma. CANCER MANAG RES, 12, 12259-12267.
Fan, Y., Zhao, X., Ma, J. and Yang, L. (2021) LncRNA GAS5 Competitively Combined With miR-21 Regulates PTEN and Influences EMT of Peritoneal Mesothelial Cells via Wnt/β-Catenin Signaling Pathway. FRONT PHYSIOL, 12, 654951.
Zhang, L.N., Zhao, L., Yan, X.L. and Huang, Y.H. (2019) Loss of G3BP1 suppresses proliferation, migration, and invasion of esophageal cancer cells via Wnt/β-catenin and PI3K/AKT signaling pathways. J Cell Physiol, 234, 20469-20484.
Clevers, H. and Nusse, R. (2012) Wnt/β-catenin signaling and disease. Cell, 149, 1192-1205.
Ji, S., Deng, H., Jin, W., Yan, P., Wang, R., Pang, L., Zhou, J., Zhang, J., Chen, X., Zhao, X. et al. (2017) Beta-catenin participates in dialysate-induced peritoneal fibrosis via enhanced peritoneal cell epithelial-to-mesenchymal transition. FEBS Open Bio, 7, 265-273.
Guo, Y., Sun, L., Xiao, L., Gou, R., Fang, Y., Liang, Y., Wang, R., Li, N., Liu, F. and Tang, L. (2017) Aberrant Wnt/Beta-Catenin Pathway Activation in Dialysate-Induced Peritoneal Fibrosis. Front Pharmacol, 8, 774.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Mechanisms of human umbilical cord mesenchymal stem cells-derived exosomal lncRNA GAS5 in alleviating EMT of HPMCs via Wnt/β-catenin signaling pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cell culture and transfection

Relevant experiments on exosomes

Extraction and identification of exosomes

Exosome labeling

Western Blot detection

Real-time PCR detection

Immunofluorescence

Dual luciferase reporter gene assay

Statistical analysis

Results

Identification of hUC-MSCs

Identification of exosomes

hUC-MSC-CM alleviating EMT of HPMCs stimulated by HG through exosomes

Detection of exosomes entering recipient cells

lncRNA GAS5 in exosomes from hUC-MSCs-CM alleviating EMT through Wnt/β-catenin pathway

Discussions

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1