Animals, Model
Adult male C57BL/6J mice (8-weeks-old) were purchased from Beijing Huafukang Biotechnology include Company Limited (LicenseNo.: SCXK (Beijing) 2019-0008). Adult male SD (8-weeks-old) were purchased from Beijing Weitonglihua include Company Limited (LicenseNo.: SCXK (Beijing) 2016-0011).The high-fat diet feed (HFD) was purchased from Beijing Keao Xieli Feed Co., Ltd. (license number: SCXK (Beijing) 2019-0003).The mice were housed in groups of four to fve per cage with ad libitum access to food and water, and were maintained under a 12-h light/dark cycle (lights on at 8:30 p.m., of at 8:30 a.m.) at a stable temperature (22 ± 2°C). The animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and all the procedures were approved by the Animal Ethics Committee of Tianjin Institute of Medical and Pharmaceutical Sciences (Tianjin, China; approval no.IMPS-EAEP-Z-MS20023-01 ). Animals were fed HFD (the basic diet was composed of sucrose 20%, lard 15%, cholesterol 2% and bile salt 0.3%) for 13 weeks to make hypercholesterolemia model.
The animals were divided into normal control group (NFD-control group) and hypercholesterolemia model group (HFD-model group). The normal control group was fed with normal diet (NFD-control), while the hypercholesterolemia model group was fed with high-fat diet (HFD-model). After the model was established, HFD-model rats were divided into shRNA blank control group (HFD-shRNA-control group) and shRNA PCSK9 group (HFD-shRNA-PCSK9 group).
Method for constructing shRNA-PCSK9
Packaging HIV plasmid mixture, GeneCopoeia 293Ta lentivirus packaging cell line (GenecopoeisCatNo. CLV-PK-01), EGFP positive control plasmid, EndoFectinTM transfection reagent; TiterBoostTM titer enhancer (500x), DMEM medium containing glucose, glutamine and sodium pyruvate, Fetal bovine serum (Thermoscientific catNo. sh300700.02), Opti-MEM I serum-free medium (invitrogen cat No.31985-062/31985-070), Polyamine (sigma-aldrich catNo. H9268), crystal violet (sigma-aldrich catNo. C3886), Penicillin-streptomycin double antibody (Sigma-Aldrich CatNo. P4333). Our previous experiment [13] has verified and screened out the effective silencing sequence of shRNA-PCSK9, and the sequence is shown in Table 1:
Table 1
Clone Name | Symbol | Location | Length | Target Sequence |
CSHCTR001-1-LVRH1GP(OSNEG20) | - | - | 19 | Gcttcgcgccgtagtctta |
MSH040042-33-LVRH1GP(OS637077) | Pcsk9 | 1228 | 21 | ggagtttattcggaagagtca |
The plasmid was synthesized by oligonucleotide annealing, plasmid PCSK9 linearization extraction, target fragment cloning to PCSK9 plasmid expression vector, vector transformation to competent cells, amplification of transfected competent cells, and plasmid restriction enzyme identification. Optimization steps of lentivirus production using 293Ta tool cells. The lentivirus yield of each 10cm culture plate added with eGFP or mCherry positive control group is 10ml supernatant, with 1–10×107 infected units per ml. The lentivirus titers were measured by H1299 cell line or drug sieve after culturing packaging cells, preparing DNA/EndoRectin lentivirus mixture, transfecting packaging cells, harvesting lentivirus and testing titer.
Silent transfection of shRNA-PCSK9 lentiviral vector: 10µl/ time was absorbed by microinjection, injected from tail vein of C57BL/6J mice and SD rats, and injected again at 48h and 72h. Blank lentivirus was injected with HFD-shRNA-control, and shRNA-PCSK9 lentivirus was injected with HFD-shRNA-PCSK9. Forty-eight hours after the last injection, the kidney tissue was taken and stored at -80℃ for later use.
0.1g sample was taken, total RNA was extracted, after quality inspection, 5µlRNA was electrophoresed with 1% agarose gel, the integrity of RAN was detected, the residual genomic DNA in RNA was digested, and after reverse transcription, it was determined by PCR instrument, and the data was analyzed by 2−△△CT method. PCSK9 primer is designed as: PCSK9-F5'-3': GCATCCCAAACACCCCT, 125bp, 3’-5’:CTGCCTCCGGACACTAA, 125bp。
Table 2
RT-PCR primers used in the study
Target gene | Forward | Reverse |
PCSK9 | GCATCCCAAACACCCCT | CTGCCTCCGGACACTAA |
Extraction Of Plasma Exosomes
At the end of the experiment, the circulating blood of mice/rats were taken,fully anticoagulated by EDTA anticoagulation tube, centrifuged at 3000 rcf/min×15min, and the plasma was sucked. Sample of plasma was 1ml/ tube at 4℃ and centrifuged at 3000 rcf/min×15min. Take out the precipitate and discard it, collect the supernatant, move it into another set of 1.5ml centrifuge tubes, centrifuge again at 4℃ and 10000 rcf/min×20min, collect the supernatant, and discard the precipitate. Transfer to another clean centrifuge tube, add 1mL of extract A, cover the centrifuge tube tightly, mix it upside down for about 1min, then add 0.5mL of extract B, cover the centrifuge tube tightly, mix it upside down for about 1min, make the liquid fully mix, and put it in a refrigerator at 2–8℃ for standing overnight. The next day, centrifuge at 4℃ and 10000 rcf/min×60min, remove the supernatant, and collect the precipitate. Add exosome preservation solution C to the precipitate, and resuspend the precipitate to obtain exosome samples for later identification and biological determination.
Exosome Identification Method
The extracted exosomes were observed by transmission electron microscope and analyzed by particle size. Take out 10 µL of exosomes, absorb 10 µL of samples, drop them on a copper net for precipitation for 1 min, filter paper to absorb floating liquid, 10 µL of uranyl acetate drop them on a copper net for precipitation for 1 min, filter paper to absorb floating liquid, dry them at room temperature for several minutes, and carry out electron microscope detection and imaging at 100 kv to obtain the imaging results of transmission electron microscope. Take frozen samples, thaw them in water bath at 25℃, and place them on ice. Exosome samples were diluted with 1 × PBS and directly used for NTA detection.
MicroRNA Extraction Method
After thawing the exosome sample, add 1ml Trizon, mix well, add 200 µl chloroform, shake for 15s, stand for 5min at 4℃, centrifuge at 12,000 rpm for 10min, suck the upper clear water layer, add 150 µl absolute ethanol, place it in RM column at 12,000 rpm for 30s at 4℃, discard RM column, and add 400 µl absolute ethanol. Add 700 µl RWT solution at 12,000 rpm for 30s, 4℃, and discard the waste liquid; Add 500 µl RW2 solution, centrifuge at 4℃ at 12,000 rpm for 30s, and discard the waste liquid; Add 500 µl RW2 solution, centrifuge at 4℃ at 12,000 rpm for 30s, and discard the waste liquid. Idle at 12,000 rpm for 60s 4℃, Drying at room temperature for 2min, adding 30 µl Rnase-Free water, standing for 2 min, at 12000 rpm for 120s at 4℃, and measuring RNA concentration.
MiRNA-222 Content In Plasma Exosomes Measure Method
Total RNA was extracted from tissue samples with ultrapure RNA extraction reagent. Add 2ml RNAAiso Plus to each 0.1g sample, completely cover the sample, and let stand at room temperature for 5min. Centrifuge at 4℃ and 12,000 rpm for 5 minutes, and transfer the supernatant to a new 1.5mL centrifuge tube. Add chloroform at the ratio of 200ul chloroform per 1 ml RNAiso Plus, shake vigorously until the solution is fully emulsified, and stand at room temperature for 5 minutes. Centrifuge at 4℃ and 12,000 rpm for 15 minutes. Add equal volume of isopropanol and mix well. After standing at room temperature for 10 minutes, centrifuge at 4℃ and 12,000 rpm for 10 minutes. Remove the supernatant, add 1mL of 75% ethanol (RNase-Free Water) precooled at -20℃, and clean the precipitate. Centrifuge at 4℃ and 12,000 rpm for 5 minutes, and remove the supernatant with a pipette. Dissolve the precipitate with RNase free H2O, and store the RNA solution in a refrigerator at -80℃. The ratio of A260/A280 of RNA was measured by ultraspectrophotometer (1.9–2.1). The expression of miRNA and mRNA was detected by RT-PCR with TaKaRa code DRRO47A reverse transcription kit, and the relative quantitative analysis of data was carried out by 2−△△CT method.
Western Blotting And Immunohistochemistry
Total protein was extracted by RIPA method, and protein concentration was detected by BCA kit. 10% separation gel, 5% concentrated gel, 80V 30min concentration, 120V 90min separation, 200mA film transfer for 2h, 5% skimmed milk sealed at room temperature for 30min, washed with TBST once, first antibody incubated overnight at 4℃, washed with TBST buffer the next day, second antibody incubated at room temperature for 1h, imaged and developed by chemiluminescence gel imaging analysis, and analyzed by Image J software.
Conventional paraffin sections are dewaxed to water; 3% H2O2 blocked endogenous peroxidase at room temperature for 10 minutes. Microwave repair antigen,Sealing with 5% BSA for 20 minutes,Adding tau and p-tau antibodies dropwise,Overnight at 4℃. Adding secondary antibody after washing PBS, DAB color development after PBS washing. Lignin re-dyeing, ethanol dehydration, xylene transparency, neutral gum sealing.
Statistical Analysis
Date are expressed as mean ± SEM and analyzed using GraphPad 6 statistical software. The measurement data is expressed by mean standard deviation, independent sample T test is used for two groups of analysis, and one-way ANOVA is used for multiple groups of analysis. P < 0.05 is statistically significant.