Simultaneous expression of three reporter proteins from a porcine reproductive and respiratory syndrome virus-based vector

doi:10.21203/rs.3.rs-2438261/v1

Download PDF

Research Article

Simultaneous expression of three reporter proteins from a porcine reproductive and respiratory syndrome virus-based vector

https://doi.org/10.21203/rs.3.rs-2438261/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The mechanism of discontinuous transcription for the synthesis of a series of sub-genomic mRNAs to express the porcine reproductive and respiratory syndrome virus (PRRSV) structural proteins potentially allows for the simultaneous expression of multiple foreign genes. This can occur by insertion of multiple novel independent transcription units between ORF sequences of the PRRSV genome. Here, an expression cassette consisting of a red fluorescent protein (RFP) gene flanked at its 3′ end by transcription-regulating sequences (TRS) and an expression cassette consisting of an iLOV gene flanked at its 5′ end by TRS was constructed. The resulting expression cassette containing a RFP gene and containing iLOV gene was introduced between ORF1b and 2, and between ORF7 and 3′UTR, respectively, in an infectious PRRSV cDNA clone. Transfection of the resulting clone (pGX-12RFP-73iLOV) into cells resulted in the recovery of a recombinant virus (rGX-12RFP-73iLOV). Simultaneous expression of RFP and iLOV was observed in MARC-145 cells infected with rGX-RFP-iLOV. To test the ability of the PRRSV genome to express three reporter genes simultaneously, an expression cassette containing the Gluc gene and an expression cassette containing iLOV gene were also inserted in between ORF1b and 2, and between ORF7 and 3′UTR, respectively. This was performed in a recently obtained infectious PRRSV cDNA clone carrying a RFP gene in nsp2. Transfection of the construct (pGX-R-Gluc-iLOV) carrying three reporter genes into cells allowed the rescue of the recombinant reporter virus (rGX-R-Gluc-iLOV) which showed similar growth characteristics to the parental virus and yet yielded 100-fold less infectious viruses. Fluorescence microscopy of cells infected with rGX-R-Gluc-iLOV demonstrated the presence of both GFP and iLOV genes. Gluc activities in supernatants harvested at different time points from cells infected with recombinant viruses carrying Gluc showed the levels of Gluc activity increased as the infection progressed, indicating that the expression of Gluc gene and its activity were parameters for monitoring viral propagation. These results indicate that it is possible to introduce at least three foreign proteins simultaneously in a PRRSV-based vector and this will prove invaluable in our future understanding of these viruses.

PRRSV

Gluc

RFP

GFP

Recombinant virus

Reporter gene

Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically important swine viral pathogen which causes reproductive and respiratory disease in pigs throughout the world [8]. PRRSV is a positive-sense, single-stranded RNA virus that belongs to the genus Porartevirus, family Arteriviridae [6]. The other members of the family Arteriviridae are equine arteritis virus (EAV), simian hemorrhagic fever virus (SHFV) and lactate dehydrogenase-elevating virus (LDV) [10]. The PRRSV genomic RNA has a length of approximately 15.5 kb and contains a 5′ cap structure and a 3′poly(A) tail. At least nine functional open reading frames (ORFs) have been identified in the PRRSV genome. The two largest of these, ORF1a and ORF1b, occupy the 5′ two-thirds of the genome and encode two polyproteins (pp1a and pp1ab). These two large polyproteins are proteolytically processed by virus-encoded proteases to at least 16 mature non-structural proteins (nsps) [4]. The other ORFs (ORF2 through 7) are located at the 3′-terminus of the PRRSV genome and encode several viral structural proteins including glycoprotein (GP) 2a, 2b, GP3, GP4, ORF5a protein, GP5, matrix protein (M) and nucleocapsid Protein (N) [10, 11, 19]. The genes for these viral structural proteins are expressed from a 3′–5′ co-terminal, nested set of sub-genomic (sg) mRNAs. The transcription of sg mRNAs of PRRSV is discontinuous [10] which is regulated by transcription-regulating sequences (TRS). The TRS contains a hexanucleotide sequence which is located at the 3′-terminus of the 5′UTR (leader TRS and TRS-L) as well as the TRS upstream of each ORF coding for the structural proteins (body TRS and TRS-B) [13, 21]. Base pairing between the TRS-L in 5′UTR and the negative-sense TRS-B has been shown to be one of critical factors for mediating the discontinuous transcription of sg mRNAs [13].

The usefulness of PRRSV as a viral expression vector has been systematically investigated [1]. These recombinant PRRSVs usually express heterologous genes through either insertion of foreign genes in the nsp2 region or introduction of a novel independent transcription unit into the viral genome which then directs the synthesis of a novel sg mRNA [3, 9, 14, 16]. The intergenic regions between ORF1b and 2, ORF4 and 5a and ORF7 and 3′UTR have usually been chosen for insertions of an extra independent transcription unit in order to express foreign genes [9, 14, 18]. In this case, an expression an expression cassette consisting of TRS and its flanking sequences, which can function as the extra independent transcription unit, were inserted into the intergenic regions of PRRSV genome in order to produce a novel sg mRNA which can express the foreign gene [9, 15]. Some recombinant PRRSVs expressing foreign genes by inserting independent transcription units in between ORF1 and 2 or between ORF7 and 3′UTR, show genetic stability after they are added to cells [5, 7, 12]. However, recombinant PRRSV expressing GFP by inserting expression cassette between the ORF4 and 5a is unstable during serial passages of the recombinant viruses in vitro [18].

The unique mode of the discontinuous transcription of sg mRNAs for the viral structural proteins potentially allow co-expression of multiple foreign genes by insertion of multiple expression cassettes consisting of genes of interest and TRS between PRRSV ORFs [2]. Previously studies have shown that insertion of an extra independent transcription unit into the PRRSV genome could produce a novel sg mRNA which can subsequently express a foreign gene [9, 14]. In the present study, we hypothesized that co-expression of two foreign genes in a PRRSV genome could be achieved by insertion of two extra independent transcription units between both ORF1b and ORF2 and ORF7 and 3′UTR, respectively. Furthermore, the ability of the PRRSV genome to simultaneously express triple foreign genes through insertion of two independent transcription units and internal insertion into the hypervariable region (HVR) of the nsp2 was also tested. We showed that the insertion of two transcription units co-expressing a red fluorescent protein (RFP) and an iLOV gene into a PRRSV recombinant clone is replication-competent. Furthermore, the PRRSV genome was shown to simultaneously express the triple reporter genes RFP, iLOV and Gluc.

Cells

MARC-145 and BHK-21 cells were cultured in essential modified Eagle’s medium (EMEM) supplemented with 10% fetal bovine serum (FBS) and treated with an antibiotic/antimycotic solution (Gibco, Life) as described in our previous study [16].

Plasmid construction

In order to insert an expression cassette between ORF7 and 3′UTR based on an infectious clone for a cell adapted PRRSV strain (GXNN1396-P96) (pGXAM) [18], SOE-PCR was performed. Briefly, an upstream fragment P1, was amplified using pGXAM as a template with primers JX14402MluI-F and 73BS-R. A downstream fragment P2 was amplified using pGXAM as a template with primers 73BS-F and JX25NotI-R. A fusion PCR was performed using the resulting fragment P1 and P2 as the templates with primers JX14402MluI-F and JX25NotI-R. The resulting PCR fragment bearing the introduced SbfI and BstBI F restriction enzyme site was digested with Mlu I and Not I and ligated into a similarly digested pGXAM, generating a plasmid, pGX73BS. To introduce foreign TRS into pGX73BS, a fragment was amplified from pGX73BS with primers JX14402MluI-F and 73BSTRS-R. The resulting fragment was digested with Sbf I and Mlu I and ligated into a similarly digested pGX73BS, generating a plasmid, pGX73BSTRS. A reporter gene iLOV was amplified using primers iLOV-BstBI-F and iLOV-SbfI-R. The amplified product was digested with BstB I and Sbf I and cloned into pGX73BSTRS, which was digested with BstB I and Sbf I, resulting in a recombinant clone, pGX-73iLOV.

In order to generate a recombinant PRRSV clone carrying an expression cassette containing an RFP inserted between ORF1b and ORF2, the primers RFP-BstBI-F and RFP- SbfI-R were used to amplify the RFP gene. The resulting PCR product of the RFP gene was digested with BstB I and Sbf I and then cloned into a similarly digested pGX12BSTRS, which was a PRRSV recombinant clone we developed previously [16]. This created a PRRSV recombinant clone carrying an expression cassette expressing the RFP gene, (pGX-12RFP). Using the same strategy, a Gluc gene was inserted into pGX12BSTRS, generating a plasmid, pGX-12Gluc.

To generate a plasmid containing two expression cassettes, pGX73BSTRS was digested with Asc I and Not I and then cloned into either pGX-12RFP or pGX-12Gluc. These were then digested with BstB I and Mlu I, generating plasmids pGX-12RFP-73iLOV and pGX-12Gluc-73iLOV, respectively. To construct an infectious PRRSV clone carrying three reporter genes, the obtained pGX-12Gluc-73iLOV was digested with Asc I and Not I and then cloned into pGXNSP2RFP, which was a previously developed plasmid [16]. This was then digested with Asc I and Not I, creating a PRRSV recombinant clone carrying the three reporter genes (RFP, Gluc and iLOV). All the primers used in this study are listed in Table 1.

DNA Transfection

BHK-21 cells were transfected with 2 μg DNA plasmid using Lipofectamine 2000 (Thermo Fisher, Waltham, MA, USA) according to the manufacturer's instructions. For viral rescue, 300 µL of the BHK-21 cell culture supernatants were harvested at 48 hours post-infection (hpi) and these were used to inoculate fresh MARC-145 cells. After incubation for 1 hour, 3 mL of EMEM containing 2% FBS was added and these were further incubated for 3-4 days at 37℃. The supernatants from the cultured MARC-145 cells were used for serial passages until the appearance of cytopathic effects (CPEs).

RT-PCR detection

Cell supernatants were used for viral nucleic acid extraction by using the Viral DNA/RNA Mini Prep kit (Axygen AXY). The extracted RNA was then used for synthesis of cDNA with random hexamers (Fermentas, Glen Burnie, MD, USA) using PrimeScript Reverse Transcriptase and random hexamers (Takara Bio, Inc., Dalian, China). PCR was then used to amplify the targeted regions with different sets of primers and these are listed in Table 1. The PCR products were gel purified and cloned into PMD18-T clone vectors (TaKaRa, Dalian, China) and these were sequenced in both directions.

Indirect Immunofluorescence assay (IFA)

IFA was used to detect PRRSV N protein expression in MARC-145 cells infected with the recombinant viruses. Briefly, MARC-145 cells were inoculated with recombinant viruses at 0.1 multiplicity of infection (MOI). At 48 hpi, the cell culture media were discarded, and the cells were washed twice with PBS followed by fixing in cold methanol for 15 min at 4℃. The fixed cells were washed with PBS and blocked in 0.5% BSA at room temperature for 1 hour. The cells were then incubated at 37°C for 2 hours with a monoclonal antibody against N protein (SR30-A). Next, the cells were washed five times with PBS and incubated with secondary antibodies, which were either goat anti-mouse IgG H&L (green) or goat anti-mouse IgG H&L (red) (Alexa Fluor® 568, Invitrogen), for 1h at 37°C. Following five washes with PBS, the cells were observed under a fluorescence microscope whilst in PBS.

Virus titers and growth curves

MARC-145 cells were infected with recombinant viruses (passage 3) at a MOI of 0.01. After 1 h of incubation at 37°C, the cells were washed twice with PBS, and then maintained in DMEM containing 2% FBS. At 6, 12, 24, 48, 72 and 96 hpi, the cell supernatants were collected and stored at -80°C. The growth curves were determined after measuring the mean titers of two duplicates at each time point. The virus titers were determined according to the Reed-Muench method. The multi-step growth curves of the virus were drawn using GraphPad Prism software, with the hpi as the vertical coordinate and the virus titers (TCID₅₀/mL) as the horizontal coordinate.

Statistical Analysis

Statistical analysis of virus titers was performed using SPSS 12.0 for Windows (SPSS Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) was used to evaluate the differences among the geometric means of the virus titers. The Duncan honestly significant difference test was then used to examine multiple comparisons between the different groups.

Construction and characterization of a PRRSV expressing iLOV in an independent transcription unit inserted between ORF7 and 3′UTR.

In order to insert an independent transcription unit for the expression of any foreign genes between ORF7 and 3′UTR, we introduced a TRS and the BstB I and Sbf I enzyme sites at that site in an infectious cDNA clone (pGXAM). The resulting construct was designated pGX73TRS. We then cloned the iLOV gene into the pGX73TRS by using BstB I and Sbf I sites. The resulting construct was designated pGX-73iLOV (Fig. 1A).

We assessed the specific infectivity of the iLOV reporter-encoding the full-length PRRSV clone pGX-73iLOV and the parent clone pGXAM. The plasmid DNAs were transfected into BHK-21 cells. CPEs were observed in MARC-145 cells infected with supernatants harvested from the transfected BHK-21 cells (data no shown). At 72 hpi, PRRSV N protein expression of the recovery of recombinant viruses (rGX-73iLOV and rGXAM) were assessed by IFA (Fig. 2A). The expression of iLOV was analyzed in MARC-145 cells infected with rGX-73iLOV. As shown in Fig. 2B, at 12 hpi, iLOV expressing cells were detected. More iLOV positive cells were observed at 48 and 72 hpi, which indicated that the virus had spread to the neighboring cells as the infection progressed.

Construction and recovery of full-length PRRSV cDNA clones expressing two reporter proteins

In order to construct a recombinant PRRSV clone carrying two reporter genes by insertion of an expression cassette between both ORF1b and ORF2a, and between ORF7 and 3′UTR, we placed a RFP and a Gluc gene into expression cassette of pGX12BSTRS. This was a plasmid we developed previously [10], and it resulted in plasmids pGX-12RFP and pGX-12GLuc, respectively. The region containing the transcription unit and iLOV were inserted between ORF7 and 3′UTR of pGX-73iLOV was replaced with the corresponding regions of pGX-12RFP or pGX-12Gluc, resulting in recombinant plasmids pGx-12RFP-73iLOV and pGX-12GLuc-73iLOV, respectively (Fig. 1B).

To assess the infectivity of the two reporter-encoding full-length PRRSV clones, BHK-21 cells were transfected with plasmids pGX-12RFP, pGX-12GLuc, pGX-12RFP-73iLOV, pGX-12GLuc-73iLOV and pGXAM. At 48 hpi, the supernatants from the plasmids-transfected cells were inoculated into MARC-145 cells for recovery of the recombinant viruses. CPEs were generated in MARC-145 cells at approximately 72 hpi (data no shown). The expression of viral proteins was analyzed by IFA using a mAb against N protein in the rescued virus-infected cells. As shown in Fig. 2A, N protein was expressed in cells inoculated with all of the rescued viruses. iLOV and RFP expression in the live cells infected with rGX-12RFP-73iLOV, rGX-12GLuc-73iLOV, rGX-12RFP and rGX-12GLuc and rGXAM were imaged under a fluorescent microscope. Fig. 2 shows the RFP and iLOV expression in MARC-145 cells infected with rGX-12RFP and rGX-12GLuc-73iLOV were seen as early as 12hpi. At 48 and 72 hpi, more RFP- or iLOV-positive cells were detected as infection progressed. Both RFP and iLOV expression in live cells infected with rGX-12RFP-73iLOV were observed as early as 12hpi, and the number of positive cells increased as the virus infection progressed (Fig. 3B). No RFP and iLOV expression in live cells were observed in cells infected with neither rGX-12GLuc nor rGXAM.

Construction and recovery of a full-length PRRSV cDNA clone expressing three reporter proteins

To construct a recombinant PRRSV clone carrying three reporter genes, the regions containing the introduced transcription units, GLuc and iLOV of pGX-12GLuc -73iLOV were replaced with the corresponding region of pGX-NSP2RFP, resulting in a recombinant plasmid, pGX-R-Gluc-iLOV.

To test whether the recombinant PRRSV clone carrying the three reporter genes was capable of replication, we transfected pGXAM and pGX-R-Gluc-iLOV into BHK-21 cells. At 48 h.p.i, the supernatants from the plasmids-transfected cells were inoculated into MARC-145 cells for recovery of the recombinant viruses. CPEs appeared in MARC-145 cells at 72 hpi (data no shown). The expression of iLOV and RFP in live MARC-145 cells infected with pGX-R-Gluc-iLOV was imaged under a fluorescent microscope. Fig. 3 shows both iLOV and RFP expression live cells were observed as early as 12hpi and the number of positive cells was increased at a later time point, suggesting that virus had spread to the neighboring cells as the infection progressed.

We then characterized the multi-step growth kinetics of the recombinant viruses in MARC-145 cells. As shown in Fig. 4A, rGXAM, rGX-12Gluc, rGX-12RFP and rGX-73iLOV displayed similar multi-step growth curves. However, the overall yields of rGX-12Gluc-73iLOV, rGX-12RFP-iLOV and rGX-R-Gluc-iLOV were 10-100 folds less than that of rGXAM. The activity of GLuc was evaluated in MARC-145 cells after the infection of rGX-12Gluc, rGX-12Gluc-73iLOV and rGX-R-Gluc-iLOV. MARC-145 cells were mock-infected or infected with rGXAM as a negative control in order to determine the Gluc activity. The Gluc activity was observed as early as 24 hpi and it increased sharply and reach a peak at 48hpi (rGX-12Gluc) and 72 hpi (rGX-12Gluc -73iLOV and rGX-R-Gluc-iLOV) and then dropped markedly at 120 hpi. Neither mock-infected nor rGXAM-infected cells exhibited any Gluc activity.

The recombinant reporter PRRSVs are genetically unstable

In order to determine the genetic stability of the reporter genes in the genomes of the recombinant viruses, the P3, P6, P9, P12 and P15 of each reporter virus (rGX-12RFP, rGX-73iLOV, rGX-12Gluc-73iLOV and rGX-R-Gluc-iLOV) were used to infect MARC-145 cells. The live cells were imaged at 48 hpi in order to evaluate cells expressing fluorescent reporter protein. As shown in Fig. 5, green fluorescence was detected in most of the MARC-145 cells inoculated with P3 of rGX-73iLOV and P3, P6 and P9 of rGX-12RFP, rGX-12Gluc-73iLOV and rGX-R-Gluc-iLOV. The number of cells showing green fluorescence markedly decreased in MARC-145 cell cultures infected with P6 of rGX-73iLOV, P15 rGX-12Gluc-73iLOV and rGX-R-Gluc-iLOV. Red fluorescence was also detected in the MARC-145 cells infected with P3 and P6 of rGX-12RFP and rGX-12RFP-73iLOV, while the RFP-positive cells were dramatically decreased with P9 and P10 viruses. Red fluorescence was also detected in cells infected with P3 to P15 of rGX-R-Gluc-iLOV.

To further investigate the stability of reporter genes in the genome of these reporter viruses, the genomic regions containing the reporter gene insertions of P3, P6, P9, P12 and P15 reporter viruses as well as the parental virus were amplified by RT-PCR (Fig. 6). For detection of the iLOV, RFP and Gluc genes in one reporter-encoding recombinant PRRSV, PCR products of the expected bands were obtained after using P3 rGX-73iLOV, rGX-12RFP and rGX-12Gluc RT-PCR products as templates. An additional smaller PCR product was observed in addition to the expected fragment when using the P6 rGX-12Gluc, rGX-12RFP and rGX-73iLOV RT-PCR products as templates. For detection of the iLOV, RFP and Gluc genes in two or three reporter-encoding recombinant viruses, PCR products of the expected band for Gluc gene was obtained using P3 to P12 of rGX-12Gluc-73iLOV and P3 and P6 of rGX-R-Gluc-iLOV. A smaller PCR product became apparent in addition to the expected fragment when using the P15 of rGX-12Gluc-73iLOV and P9, P12 and P15 of rGX-R-Gluc-iLOV. PCR products of the expected band for iLOV gene was obtained using P3 to P12 of rGX-12Gluc-73iLOV, rGX-12RFP-73iLOV and rGX-R-Gluc-iLOV. Only a small DNA fragment was obtained for the P15 of the two or three reporter-encoding recombinant viruses. PCR products of expected band for the RFP gene was obtained using the P3 and P6 of rGX-12RFP-73iLOV and P3 to P15 of rGX-R-Gluc-iLOV RT-PCR products as templates. Only a small DNA fragment was obtained for the P9, P12 and P15 of rGX-12RFP-73iLOV. These results indicated that the reporter viruses were not stable during passaging in MARC-145 cells.

The generated smaller sized PCR products were cloned, sequenced and then they were aligned with the respective parental reporter virus sequences. This showed that the reporter viruses produced nucleotide deletions of different lengths and these included not only the entire or partial reporter genes, but also the introduced TRS and restriction sites. The information regarding the nucleotide deletions of the introduced sequences in the genomes of recombinant viruses are shown in Table 2.

PRRSV adopt a unique mode of the discontinuous transcription to produce a nested sequence of sg mRNA for the expression of their viral structural proteins [10, 21]. An increasing number of studies have shown that insertion of an extra independent transcription unit into the PRRSV genome can produce a novel sg mRNA which then expresses a heterologous gene [9, 14, 18]. Some recombinant PRRSVs expressing foreign genes inserted between either ORF1b and 2 or ORF7 and 3′ UTR are able to replicate well and show genetic stability [7, 12, 14]. Inconsistent with these studies, in this study we showed that a recombinant PRRSV expressing the iLOV gene inserted between ORF7 and 3′ UTR and recombinant PRRSVs expressing Gluc or RFP gene inserted between ORF1 and ORF2 are able to grow well and yet show genetic instability in cells. The discrepancy of genetical stability of reporter genes in recombinant viruses reported by different studies may be attributed to the size and the sequence differences of the heterologous product, as well as the insertion of TRS and TRS-like into the heterologous sequences and different infectious clones of PRRSV strains used. The process of discontinuous transcription for PRRSVs is regulated by the leader TRS present at the 5′UTR as well as the body of the TRS upstream of each ORF that codes for the structural protein [13, 21]. It has been shown that a recombinant EAV carrying an expression cassette consisting of a GFP gene inserted between ORF5 and 6 was genetically unstable [2].The TRS-like sequences in the GFP gene could be used by the recombinant EAV to generate a novel sg RNA[2]. Consistent with this study, a recombinant PRRSV carrying a capsid gene of porcine circovirus 2 (PCV2) was inserted directly between ORF1b and ORF2 and this was shown to be genetically unstable [20]. The recombinant virus could utilize TRS-like sequences in the capsid gene as a transcriptional promoter to produce a series of novel sg RNA species [20]. In another study, internal nucleotide deletions in the GPF gene emerged during serial passages of a recombinant PRRSV carrying an expression cassette consisting of a GFP gene inserted between ORF1b and ORF2. This study also showed that the loss of the GFP gene may have been due to the potential RNA recombination that occurred between the introduced TRS in the inserted expression cassette and the authentic TRS in PRRSV genome [17]. In the present study, the foreign genes in the two or three reporter genes carrying viruses were found to be more genetically stable than one reporter carrying viruses during the process of passages. It is possible that the two or three reporter genes carrying viruses replicated more slowly (between 10 and 100-fold slower) than the one reporter gene carrying the viruses.

Insertion two extra independent transcription units into the PRRSV genome based on an infectious PRRSV clone allowed the recovery of recombinant viruses expressing two reporter genes (rGX-12RFP-73iLOV and rGX-12Gluc-73iLOV). The two foreign genes in the recombinant virus genomes were genetically stable after at least six times passages in cells when are in culture. This indicated that it is possible to express simultaneously multiple foreign genes by insertion of multiple novel independent transcription units between the ORFs of PRRSVs. Previously, we combined the internal insertion into the nsp2 with an insertion of independent transcription unit in order to produce a recombinant PRRSV expressing two reporter genes [16]. In the present study, for the first time, we explored the ability of the PRRSV genome to express simultaneously three reporter proteins through the insertion of two independent transcription units between the PRRSV ORFs and an internal insertion into the HVR of nsp2.

The results of this study showed that the genome of PRRSV can be engineered to express three heterologous proteins simultaneously in infected cells. Although the size of the all the three foreign sequences inserted into viral genome was up to 1700 nt, the recombinant PRRSV clone (pGX-R-Gluc-iLOV) carrying the three reporter genes was replication-competent and infectious in cells. The expression of all the three reporter proteins occurred following infection of cells with rGX-R-Gluc-iLOV. Insertion of three reporter genes caused a loss of viral infectivity as evidenced by the lower virus titers and Gluc activity of the three-reporter carrying PRRSV when compared with the parental virus. Gluc activity was detectable in the supernatants of cells infected with rGX-12Gluc, rGX-12Gluc-73iLOV and rGX-R-Gluc-iLOV. The Gluc activities and multi-step growth curves for virus titers of the three recombinant viruses were similar. It is suggested that Gluc activities can be used as a convenient parameter to monitor viral replication in a cell culture environment.

The three reporter-expressing PRRSV obtained showed the biological activities of iLOV, Gluc and RFP in cultured cells. This suggest that it is possible to use a single PRRSV vector to express three immunogens of interest for a specific pathogen simultaneously. Moreover, a single PRRSV vector expressing three such immunogens from different pathogens might be used in the development of a multivalent vaccine in order to provide immune protection against challenges from different pathogens. Our two and three reporter-expressing PRRSVs can provide a novel way not to express multiple foreign genes simultaneously. In addition, this technique will be an extra invaluable tool to study viral replication.

Ethics approval and consent to participate

This article does not contain any studies with human participants or animals performed by any of the authors.

Competing interests

The authors declare they have no conflict of interest.

Funding

This work was funded by the National Natural Science Foundation of China (grant No. 32172889) and the Guangxi Natural Science Foundation (grant No. 2018GXNSFDA281021).

Acknowledgement

The authors would like to thank Dr. Dev Sooranna, Imperial College London, for editing the manuscript.

Chaudhari J, Vu HLX (2020) Porcine Reproductive and Respiratory Syndrome Virus Reverse Genetics and the Major Applications. Viruses 12
de Vries AA, Glaser AL, Raamsman MJ, Rottier PJ (2001) Recombinant equine arteritis virus as an expression vector. Virology 284:259-276
Fang Y, Christopher-Hennings J, Brown E, Liu H, Chen Z, Lawson SR, Breen R, Clement T, Gao X, Bao J, Knudsen D, Daly R, Nelson E (2008) Development of genetic markers in the non-structural protein 2 region of a US type 1 porcine reproductive and respiratory syndrome virus: implications for future recombinant marker vaccine development. J Gen Virol 89:3086-3096
Fang Y, Snijder EJ (2010) The PRRSV replicase: exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus Res 154:61-76
Gao F, Jiang Y, Li G, Zhou Y, Yu L, Li L, Tong W, Zheng H, Zhang Y, Yu H, Shan T, Yang S, Liu H, Zhao K, Tong G (2018) Porcine reproductive and respiratory syndrome virus expressing E2 of classical swine fever virus protects pigs from a lethal challenge of highly-pathogenic PRRSV and CSFV. Vaccine 36:3269-3277
Kuhn JH, Lauck M, Bailey AL, Shchetinin AM, Vishnevskaya TV, Bao Y, Ng TF, LeBreton M, Schneider BS, Gillis A, Tamoufe U, Diffo Jle D, Takuo JM, Kondov NO, Coffey LL, Wolfe ND, Delwart E, Clawson AN, Postnikova E, Bollinger L, Lackemeyer MG, Radoshitzky SR, Palacios G, Wada J, Shevtsova ZV, Jahrling PB, Lapin BA, Deriabin PG, Dunowska M, Alkhovsky SV, Rogers J, Friedrich TC, O'Connor DH, Goldberg TL (2016) Reorganization and expansion of the nidoviral family Arteriviridae. Arch Virol 161:755-768
Li Z, Wang G, Wang Y, Zhang C, Huang B, Li Q, Li L, Xue B, Ding P, Cai X, Wang C, Zhou EM (2015) Immune responses of pigs immunized with a recombinant porcine reproductive and respiratory syndrome virus expressing porcine GM-CSF. Vet Immunol Immunopathol 168:40-48
Neumann EJ, Kliebenstein JB, Johnson CD, Mabry JW, Bush EJ, Seitzinger AH, Green AL, Zimmerman JJ (2005) Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States. J Am Vet Med Assoc 227:385-392
Pei Y, Hodgins DC, Wu J, Welch SK, Calvert JG, Li G, Du Y, Song C, Yoo D (2009) Porcine reproductive and respiratory syndrome virus as a vector: immunogenicity of green fluorescent protein and porcine circovirus type 2 capsid expressed from dedicated subgenomic RNAs. Virology 389:91-99
Snijder EJ, Meulenberg JJ (1998) The molecular biology of arteriviruses. J Gen Virol 79 ( Pt 5):961-979
Sun L, Li Y, Liu R, Wang X, Gao F, Lin T, Huang T, Yao H, Tong G, Fan H, Wei Z, Yuan S (2013) Porcine reproductive and respiratory syndrome virus ORF5a protein is essential for virus viability. Virus Res 171:178-185
Tian D, Sooryanarain H, Matzinger SR, Gauger PC, Karuppannan AK, Elankumaran S, Opriessnig T, Meng XJ (2017) Protective efficacy of a virus-vectored multi-component vaccine against porcine reproductive and respiratory syndrome virus, porcine circovirus type 2 and swine influenza virus. J Gen Virol 98:3026-3036
van Marle G, Dobbe JC, Gultyaev AP, Luytjes W, Spaan WJ, Snijder EJ (1999) Arterivirus discontinuous mRNA transcription is guided by base pairing between sense and antisense transcription-regulating sequences. Proc Natl Acad Sci U S A 96:12056-12061
Wang C, Huang B, Kong N, Li Q, Ma Y, Li Z, Gao J, Zhang C, Wang X, Liang C, Dang L, Xiao S, Mu Y, Zhao Q, Sun Y, Almazan F, Enjuanes L, Zhou EM (2013) A novel porcine reproductive and respiratory syndrome virus vector system that stably expresses enhanced green fluorescent protein as a separate transcription unit. Vet Res 44:104
Wang C, Meng H, Gao Y, Gao H, Guo K, Almazan F, Sola I, Enjuanes L, Zhang Y, Abrahamyan L (2017) Role of transcription regulatory sequence in regulation of gene expression and replication of porcine reproductive and respiratory syndrome virus. Vet Res 48:41
Wang H, Xie X, He W, Wang Y, Ren T, Ouyang K, Chen Y, Huang W, Wei Z (2020) Generation of a Recombinant Porcine Reproductive and Respiratory Syndrome Virus Stably Expressing Two Marker Genes. Front Vet Sci 7:548282
Wang L, Hou J, Gao L, Guo XK, Yu Z, Zhu Y, Liu Y, Tang J, Zhang H, Feng WH (2014) Attenuation of highly pathogenic porcine reproductive and respiratory syndrome virus by inserting an additional transcription unit. Vaccine 32:5740-5748
Wang Y, He W, Li Q, Xie X, Qin N, Wang H, Huang J, Lin S, Ouyang K, Chen Y, Huang W, Wei Z (2020) Generation of a porcine reproductive and respiratory syndrome virus expressing a marker gene inserted between ORF4 and ORF5a. Arch Virol 165:1803-1813
Wu WH, Fang Y, Farwell R, Steffen-Bien M, Rowland RR, Christopher-Hennings J, Nelson EA (2001) A 10-kDa structural protein of porcine reproductive and respiratory syndrome virus encoded by ORF2b. Virology 287:183-191
Zheng H, Sun Z, Zhu XQ, Long J, Lu J, Lv J, Yuan S (2010) Recombinant PRRSV expressing porcine circovirus sequence reveals novel aspect of transcriptional control of porcine arterivirus. Virus Res 148:8-16
Zheng H, Zhang K, Zhu XQ, Liu C, Lu J, Gao F, Zhou Y, Zheng H, Lin T, Li L, Tong G, Wei Z, Yuan S (2014) Genetic manipulation of a transcription-regulating sequence of porcine reproductive and respiratory syndrome virus reveals key nucleotides determining its activity. Arch Virol 159:1927-1940

Table 1. The primers used in this study.

Primers	Sequences(5＇-3＇)	Note
Gluc-BstBⅠ-F	ACGTTCGAAATGGGAGTCAAAGTTCTG	Primers for amplification of the Gluc gene
Gluc-SbfⅠ-F	ACGCCTGCAGGTTAGTCACCACCGGCCCC	Primers for amplification of the Gluc gene
RFP-BstBⅠ-F	ACGTTCGAAATGGTGAGCAAGGGCGAGGA	Primers for amplification of the RFP gene
RFP-SbfⅠ-F	ACGCCTGCAGGCTAGTTTCCGGACTTGTACA	Primers for amplification of the RFP gene
iLOV-BstBⅠ-F	ACGTTCGAAATGATAGAGAAGAA	Primers for amplification of the iLOV gene
iLOV-SbfⅠ-F	ACGCCTGCAGGTTATACATGATC	Primers for amplification of the iLOV gene
NSP2-465-JD-F	TGAGCCTCTGGATTTGTC	Primers for detection of the RFP gene in NSP2
NSP2-465-JD-R	ACATCCACGCCGTCTGAA	Primers for detection of the RFP gene in NSP2
TF11804	ATTTGAATCGGATACAGCGTATCTG	Primers for detection of the RFP/Gluc gene between ORF1 and ORF2
PR12186	CAGGGTGAACGGTAGAGC
GXAM--N-14981	GACTGCCTTCAATCAAGGCG	Primers for detection of the iLOV gene between ORF7 and 3’UTR
3'UTR-15203	CATGCGGTCGCCCTAATTGA
JX14402Mlul-F	AATGATAACCACGCGTTTGTCGTCCG	Primers for the introduction of BstBⅠ and SbfⅠ between ORF7 and 3'UTR by using SOE
73BS-R	AAAAAATGCCAGCCCACCTGCAGGATCCTTCGAATCATGCTGAGGGGGA
73BS-F	TCCCCCTCAGCATGATTCGAAGGATCCTGCAGGTGGGCTGGCATTTTTT
JX25NotI-R	CCGCGGTGGCGGCCGCCATAGAGCCC
73BSTRS-R	GATCCTTCGAAACTCCATTGTTCCGCTGAAACTCTGGTTAAAGGAGTTGCCGCAGAACCATCAAGCTCATGTTGAGGGTGATGCT	Primers for the introduction of TRS6 before BstBⅠ

¹The introduced restriction sites are underlined.

Table 2 The information of nucleotide deletions of introduced sequences in the genomes of recombinant viruses

Recombinant viruses	Inserted genes	Reporter gene (Passages)	*Bst*bⅠ	*Sbf*Ⅰ	TRS6	The length of deletion（bp）
rGX-12Gluc	Gluc	－ (P6)	－	－	＋	558
rGX-12RFP	RFP	±(P6)	＋	＋	＋	627
rGX-73iLOV	iLOV	±(P6)	－	＋	±	224
rGX-12Gluc-73iLOV	Gluc	±(P6)	＋	－	±	517
rGX-12Gluc-73iLOV	iLOV	－(P15)	－	－	－	336
rGX-12RFP-73iLOV	RFP	±(P6)	＋	－	±	710
rGX-12RFP-73iLOV	iLOV	－(P15)	＋	＋	＋	166
rGX-R-Gluc-iLOV	RFP	＋(P15)	＋	＋	＋	0
	Gluc	±(P9)	－	－	±	558
	iLOV	±(P15)	－	＋	±	224

“＋” represent no nt deletion; “－” represent nt complete deletion; “±” represent nt partial deletion

Download PDF

Version 1

posted

You are reading this latest preprint version

Simultaneous expression of three reporter proteins from a porcine reproductive and respiratory syndrome virus-based vector

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Status:

Version 1