Antibiotics Susceptibility testing of Meropenem-resistant bacterial isolates from pigs in some selected farms in Ado Ekiti

doi:10.21203/rs.3.rs-2439522/v1

Download PDF

Research Article

Antibiotics Susceptibility testing of Meropenem-resistant bacterial isolates from pigs in some selected farms in Ado Ekiti

https://doi.org/10.21203/rs.3.rs-2439522/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Antibiotic resistance has been a global problem, especially in the clinical setting, however little is known about antibiotics resistance, especially Meropenem resistance in pigs in Ekiti which is broad spectrum and mostly used as a last resort for ill patients harboring resistant strains in animals and understanding the molecular basis of resistance will help in combating the rate of resistance

Methods

This study was basically focused on farm animals especially pigs and a total of 100 samples were collected from the rectum of pigs in selected farms. Bacterial isolates were isolated using conventional methods of isolation of bacteria, antibiotics susceptibility testing using single oxoid disc of Gentamycin (30µg), Fosfomycin (100µg), Nitrofurantoin (300µg), Tigercycline (15 µg), and Polymyxin b (200µg) (Yohei et al., 2021) and Molecular identification by PCR (Mahmoud et al.,2020) and Multiplex PCR was used to determine the presence of carbapenemase genes. Evolutionary analyses were conducted using Molecular Evolutionary Genetics Analysis version 11 software (MEGA11).

Results

The result showed that about 13 bacterial isolates were identified from species of Proteus mirabilis, Providencia alcalifaciens, E.coli, Shigella flexneri, Enterococcus faecalis and Bacillus cereus. All 13 bacterial isolate sequences have been submitted to the NCBI database with their accession numbers ON715737- ON715749. The most effective antibiotics for the treatment of Meropenem-resistant bacteria were Gentamycin (92.86%), Fosfomycin (92.86%), Tigercycline (92.86%), Nitrofurantoin (85.71%) , and Polymyxin b (64.23%. All the bacterial isolates have one or more carbapenemase genes except Bacillus cereus (MR5) and Enterococcus feacalis (Fr2) . the percentage occurrence of carbapenemase genes in bacterial isolates with the highest from bla_NDM, 9(42.85) ,bla_VIM5(23.81), bla_OXA-48, 3(14.29),bla_kpc,2(9.52), bla_spm1(4.76)_{and ,}bla_IPM1(4.76) respectively

Conclusions

Finding from the research has revealed that carbapenamase producing bacterial has been isolated from farm animal especially pig in Ado Ekiti and most of the bacterial isolates produces resistant genes that are plasmid mediated which makes the resistance to be acquired and can easily spread and cause high mortality rate, especially to humans beings. Therefore more research should be focused on other farm animals, farm managers, and environments where farm animals are reared

Antibiotics

Antimicrobial resistance

blaNDM

blaVIM

blaOXA-48

blakpc

blaspm

blaIPM

Pig

bacterial isolates

carbapenamase genes

Ado Ekiti

Nigeria

Meropenem is active against a broad spectrum of gram-positive and -negative pathogens including beta-lactamase producers. Meropenem is two- to fivefold more active against Enterobacteriaceae and gram-positive. Meropenem one of the carbapenems, among the beta-lactams, are the most effective against Gram-positive and Gram-negative bacteria presenting a broad spectrum of antibacterial activity due to this broad spectrum activity, they are often used as “last-line agents” or “antibiotics of last resort” when patients with infections become gravely ill or are suspected of harboring resistant bacteria (Krisztina et al 2011). Their unique molecular structure is due to the presence of Carbapenems together with the beta-lactam ring. This combination confers exceptional stability against most beta-lactamases (enzymes that inactivate beta-lactams) including ampicillin and carbenicillin (AmpC) and the extended-spectrum beta-lactamases (ESBLs) (Georgios, 2016). The main Carbapenem drugs are Imipenem, Meropenem. Ertpenem and Doripenem (Queenan et al., 2010. Tilahun et al 2021). Most resistance to Meropenem is due Carbapenemase which are resistant enzyme produced by bacteria against Carbapenems antibiotics (Tilahun et al., 2021). Carbapenemase can be intrinsic or acquired (David, 2014). The main carbapenemase include KPC (Klebsiella pneumoniae carbapenemase), IMP (Imipenem Metallo-beta-lactamase), NDM (New Delhi Metallo-beta-lactamase), VIM (Verona integron-encoded metallo-beta-lactama) and OXA (Oxacillin carbapenemases) and SPM specifically blaSPM-1 Metallo-β-Lactamase Gene in Imipenem-Resistant (Sao Paulo Metallo-β-lactamase) first isolated from Pseudomonas aeruginosa Strains. Bacterial resistance to antimicrobials has been a global problem, and knowledge of carbapenamase-producing bacteria in food animals, especially in pigs being a source of food and livestock is not sufficient to guide clinicians on the use of antibiotics when resistant bacterial from the animal source is the causes of diseases in human (Ekundayo, 2021). Most resistance to Meropenem is seen in Enterobacteriaceae which are mostly found everywhere especially intestines of animals, humans, the environment, soil, etc. (Ekundayo, 2021). Enterobacteriaceae resistant to Meropenem has been reported in clinical sector especially in humans, however, little is known about Meropenem resistant in farm animals especially pigs in Ado Ekiti, Ekiti state, Nigeria. Therefore, the research was conducted to identify bacterial isolates resistant to Meropenem, determine the susceptible antibiotics to be used for treatment or diseases caused by Meropenem-resistantcteria and identify the possible carbapenamase genes in isolated bacterial isolates

Study design

This was a cross cross-sectional which that was done to determine the presence of carbapenamasee genes in bacterial isolates from pigs in the selected farm in Ado Ekiti, Ekiti State Nigeria. The pigs were about 18 months old of both male and female pigs

Collection Of Samples

A sterile swab was inserted approximately 2.5cm into the anal canal of the pig, then rotate swab from side by side in the anal canal. The swab was allowed to rema10 seconds for absorption of organism onto the swab. This was removed and inserted into 5mls sterile peptone water in McCartney bottles and then transport into the laboratory in an ice pack immediately for microbiological analysis (Olateru et al, 2018).

Isolation Of Bacterial Isolates From The Sample

The McCartney bottle containing the rectal swab was incubated at 37^oC for 18-24hours and after 24hours of incubation, a loop full of samples of peptone water was streaked on a sterile prepared MacConkey agar plate and incubate at 37^oC for 24hours. After 24hours of incubation, distinct colonies were sub-cultured to obtain pure culture.

Molecular Identification Of Bacteria Isolates

DNA extraction, PCR sequencing preparation cocktail consisting of 10 µl of 5x GoTaq colourless reaction, 3 µl of 25mM MgCl2, 1 µl of 10 mM of dNTPs mix, 1 µl of 10 pmol each 27F 5’- AGA GTT TGA TCM TGG CTC AG-3’ and − 1525R, 5′-AAGGAGGTGATCCAGCC-3′ primers and 0.3units of Taq DNA polymerase (Promega, USA) made up to 42 µl with sterile distilled water 8µl DNA template was prepared. PCR was carried out in a GeneAmp 9700 PCR System Thermalcycler (Applied Biosystem Inc., USA) with a PCR profile consisting of an initial denaturation at 94°C for 5 min; followed by 30 cycles consisting of 94°C for 30 s, 50°C for the 60s and 72°C for 1 minute 30 seconds and a final termination at 72°C for 10 mins. And chill at 4^oC.GEL (Sameer, 2011). The integrity of the amplified about 1.5Mb gene fragment was checked on a 1.5% Agarose gel run to confirm amplification.. The gel was electrophoresed at 120V for 45 minutes visualized by ultraviolet trans-illumination and photographed. The sizes of the PCR products were estimated by comparison with the mobility of a 100bp molecular weight ladder that was ran alongside experimental samples in the gel (Sameer, 2011). The amplified fragments were sequenced using a Genetic Analyzer 3130xl sequencer from Applied Biosystems using manufacturers’ manual while the sequencing kit used was that of Big Dye terminator v3.1 cycle sequencing kit. Bio- Edit software and MEGA X was used for all genetic analysis

Selection Of Antibiotic

Commercially available single Oxoid disc was used for the antibiotic sensitivity test and the antibiotics include Gentamycin (30µg), Fosfomycin (100µg), Nitrofuratoin (300µg), Tigercycline (15 µg), and Polymyxin b (200µg), was used for the test. Escherichia coli ATCC 25922 was used as control strains for antimicrobial susceptibility testing (CLSI 2021). Antimicrobial susceptibility testing Kirby-Bauer Disk diffusion method was performed to assess the antibiotic susceptibility of all the bacterial isolates using Mueller-Hinton agar plate and measure Zones of inhibition to determine if it resistant or sensitive to the selected antibiotics (Sheu et al; Yohei et al., 2019)

Multiplex PCR For Genetic Characterisation Of Carbapenemase Producing Bacterial

Molecular detection of the identified bacteria

Molecular investigations of carbapenemase genes coding gene in the 14 bacteria isolates were by multiplex PCR on the extracted DNA using carbapenemase genes coding regions specific primers. Primer sequences were as earlier documented by (Mahmoud et al 2020)

Reaction cocktail was used for all PCR per primer set included (Reagent Volume µl) − 5X PCR SYBR green buffer (2.5), MgCl2 (0.75), 10pM DNTP (0.25), 10pM of each multiplex forward and backwards primer (0.25), 8000U of taq DNA polymerase (0.06) and made up to 10.5, with sterile distilled water to which 2 µl template was added. Buffer control was also added to eliminate any probability of false amplification.

PCR profile included An initial denaturing 5min at 94ºC, then 35 cycles of 94ºC for 50 sec, suitable annealing temperature for 45s and 72ºC for 50s then terminate at 72ºC for 10mins. PCR was carried out in a GeneAmp 9700 PCR System Thermalcycler (Applied Biosystem Inc., USA) using the appropriate profile as designed for each primer pair.

Primer sequence and PCR profile used in amplifying each fragment

Multiplex	gene	Primer name	Primer sequence 5’-3’	Temp in ^oC	Amplicon size	References
Multiple 1(NDM and VIM	bla_NDM	Forward	GGTTTGGCGATCTGGTTTTC	An initial denaturing 5min at 94ºC, then 35 cycles of 94ºC for 30s, 50ºC for 30s 72ºC for 60s and terminate at 72ºC for 10min	624	Shoja et al., 2013, Mahmoud et al 2020
		reverse	CGGAATGGCTCATCACGATC
	bla_VIM	Forward	GGTGTTTGGTCGCATATCGCAA		502	Shoja et al., 2013, Mahmoud et al 2020
		Reverse	ATTCAGCCAGATCGGCATCGGC
Multiplex 2(KPC and OXA 48	bla_KPC	Forward	CATTCAAGGGCTTTCTTGCTGC	An initial denaturing 5min at 94ºC, then 35 cycles of 94ºC for 60s, 46ºC for 40s and 72ºC for 60s. and terminate at 72ºC for 10mins	498	Mushi et al 2014, Mahmoud et al 2020
		Reverse	ACGACGGCATAGTCATTTGC
	bla_OXA-48	Forward	: GCTTGATCGCCCTCGATT		238	Mushi et al 2014, Mahmoud et al 2020
		Reverse	GATTTGCTCCGTGGCCGAAA
Multiplex 3(IPM and SPM)	bla_IPM	Forward	TCGTTTGAAGAAGTTAACG	An initial denaturing 5min at 94ºC, then 35 cycles of 94ºC for 30s 52ºC for 30s and 72ºC for 60s and terminate at 72ºC for 10min	568	Shoja et al., 2013, Mahmoud et al 2020
		Reverse	ATGTAAGTTTCAAGAGTGATGC
	bla_SPM	Forward	AAAATCTGGGTACGCAAACG		271	Shoja et al., 2013, Mahmoud et al 2020
		Reverse	ACATTATCCGCTGGAACA

Statistical analysis.

The Evolutionary analyses was conducted using Molecular Evolutionary Genetics Analysis version 11 software (MEGA11). Sequence alignment was done using ClustalW pairwise and multiple alignment, with gap opening and extension penalty at 15.00 and 6.66 respectively.Test of phylogeny was done using Bootstrap statistical method at 500 replications.

Molecular identification by DNA extraction, amplification and sequencing methods of 16S rRNA using 27F and 1625R universal primer pair (Mushi et al., 2014). About 14 bacterial isolates were identified from species of Proteus mirabilis, Providencia alcalifaciens, E.coli, Shigella flexneri, Enterococcus faecalis and Bacillus cereus as represented in Table 1. All 14 bacterial isolate sequences have been submitted to the NCBI database with their accession numbers.

The antibiotics susceptibility testing was represented in Table 2 and this shows that the bacterial isolates resistant to Meropenem are still very sensitive to old antibiotics Fosfomycin, Nitrofuratoin, Tigercycine and Gentamycin even some the isolates like E.coli, Providencia alcalifaciens were resistant to gentamycin and most of the isolates are also resistant to Polymyxin b as this cannot be recommended for infection caused by Meropenem resistant bacteria

Table 3 is percentage susceptibility/resistant pattern of bacterial isolates to antibiotics and it shows that 64.23% of bacterial isolates were sensitive to Polymyxin b and 35.7% were resistant. 92.86% of bacterial isolates were sensitive to Gentamycin and 7.14% resistant. 85.71% of bacterial isolates were sensitive to Nitrofurantoin and 14.29% resistant, 92.86% of bacterial isolates were sensitive to Fosfomycin and 7.14% resistant and 92.86% of bacterial isolates were sensitive to Tigecycline and 7.14% resistant

Table 1

The molecular identification of bacterial isolates from pig in selected farms in Ado Ekiti, Ekiti State, Nigeria
S/N	Sample sources		Scientific Name	Percentage Identity	Accession no
1.	Female Pig	fr4	Proteus mirabilis	99.66%	ON715740
2.	Female Pig	F11	Providencia alcalifaciens	99.77%	ON715731
3.	Female Pig	F14	Bacillus cereus	99.66%	ON715732
4.	Female Pig	Fr1	Bacillus cereus	99.55%	ON715737
5.	Female Pig	Fr2	Enterococcus faecalis	99.89%	ON715739
6.	Male pig	M11	Escherichia coli	100.00%	ON715741
7.	Male pig	M12	Escherichia coli	100.00%	ON715742
8.	Male pig	M12p	Escherichia coli	100.00%	ON715743
9.	Male pig	M13	Escherichia coli	99.88%	ON715744
10.	Male pig	M16	Escherichia fergusonii	99.88%	ON715745
11.	Male pig	M24	Shigella flexneri	99.76%	ON715746
12.	Male pig	M25	Shigella flexneri	100.00%	ON715749
13.	Male pig	Mr11	Bacillus cereus	99.55%	ON715748
14.	Male pig	Mr5	Bacillus cereus	99.55%	ON715747

Note M- Male pig, F-Female pig and D-Dog

Table 2

The Antibiotic susceptibility testing of bacteria isolates from pig farm in Ado- Ekiti
S/N		Sample sources	Organisms	PB(200) µg Polymyxin b	CN(30) µg Gentamycin	F(300) µg Nitrofuratoin	Fos(100 µg Fosfomycin	Tgc(15 µg) Tigercycline
1.	M11	Pig	Escherichia coli	10(R)	19(S)	22(R)	22(S)	18(S)
2.	M12	Pig	Escherichia coli	20(S)	20(S)	22(S)	23(S)	25(S)
3.	M12p	Pig	Escherichia coli	25(S)	20(S)	20(S)	20(S)	22(S)
4.	M13	Pig	Escherichia coli	25(S)	20(S)	20(S)	20(S)	22(S)
5.	M16	Pig	Escherichia fergusonii	20(S)	20(S)	22(S)	23(S)	20(S)
6.	M24	Pig	Shigella flexneri	25(S)	20(S)	20(S)	20(S)	22(S)
7.	M25	Pig	Shigella flexneri	20(S)	25(S)	25(S)	24(S)	20(S)
8.	Mr11	Pig	Bacillus cereus	18(S)	20(S)	22(S)	23(S)	19(S)
9.	M11	Pig	Escherichia coli	10(R)	19(S)	22(R)	22(S)	18(S)
10.	F11	Pig	Providencia alcalifaciens	10(R)	12(R)	20(S)	12(R)	20(S)
11.	F14	Pig	Bacillus cereus	10(R)	26(S)	20(S)	25(S)	25(S)
12.	Fr1	Pig	Bacillus cereus	10(R)	16 (S)	20 (S)	22(S)	21(S)
13.	Fr2	Pig	Enterococcus faecalis	20(S)	19(S)	20(S)	22(S)	20(S)
14.	Fr4	Pig	Proteus mirabilis	15(S)	20(S)	25(S)	23(S)	20(S)

R-Resistant , S – sensitive, M- Male , F- Female

Table 3

Percentage susceptibility/resistant of bacterial isolates to antibiotics
Antibiotics	Sensitive	Resistant
Polymyxin b	64.23%	35.7%
Gentamycin	92.86%	7.14%
Nitrofuratoin	85.71%	14.29%
Fosfomysin	92.86%	7.14%
Tigercycline	92.86%	7.14%

Plate 1: Multiplex PCR for amplification of bla_NDM (624) and bla_VIM(502) amplicons size of genes on 2% agarose gel electrophoresis 6lanes: DNA ladder 600 bp. Fr1b, Fr4, and Mr11 are positive for bla_VIM while Fr1, fr2, and Mr 5 have no gene.

Plate 2 is the result of Multiplex PCR for amplification of blaNDM (624) and bla_VIM (502 from pig and M11, M12, M13, M16, M24 (first band) M25 were all positive for bla_NDM and M24 (Second band) is positive for bla_VIM while M12p lack both genes

Plate 3 Multiplex PCR for amplification of bla_KP (498) and bla_OXA−48 (238) genes on 2% agarose gel electrophoresis: 6lanes: DNA ladder 500 bp. Only Fr1 is positive for bla_KPC while Fr1b, Fr2, Fr4, Mr11 and Mr5 shows no gene to bla_KPC and bla_OXA−48 genes.

Plate 4 M11 is positive for bla_OXA−48 and M12p positive for bla_KPC while M12, M13, M16,M24, M25 show no gene to bla_KP (498) and bla_OXA−48 (238)

Plate 5 and 6 is the multiplex PCR for amplification of bla_SPM and bla_IPM genes on 2% agarose gel electrophoresis: 6lanes: DNA ladder 600 bp. None of the isolates on this plate 5 and 6 is positive for bla_SPM(271) and bla_IPM (568) genes. None of the isolates on this plate is positive for bla_SPM and bla_IPM genes. Note: M-Male Pig and f-female pig.

Table 4 is showing the occurrence of carbapenamase genes in the bacterial isolates from pig. F14 from a female pig identified as Bacillus cereus has the highest number of carbapenemase genes(4) bla_NDM, bla_VIM bla_OXA−48, bla_{IPM .}F11 from another female pig has 3 carbapenemase genes and this organism is identified as Providencia alcalifaciens fr2 (Enterococcus faecalis ) and Mr5 (Bacillus cereus ) do not have any genes. However, other bacterial isolates have one or two Carbapenemase genes.

Table 5 is the percentage occurrence of the carbapenemase genes from the bacterial isolates from pig with highest seen in bla_NDM, 9(42.85%) bla_VIM 5(23.81%) bla_OXA-48,3(14.29)_, bla_IkpC2(9.52), bla_IPM1(4.76) _andbla_SPM1(4.76).

Table 4

Occurrence of carbapenamase genes in bacterial isolates from Pig samples
Sample source	Sample ID	bla_NDM	bla_VIM	bla_KPC	bla _OXA−48	bla_IPM	bla_SPM	No genes per samples	Genes identified per sample	Bacterial isolates
Pig (F)	Fr1	-	-	+	-	-	-	1	bla _KPC	Bacillus cereus
Pig(F)	Fr1b	-	+	-	-	-	-	1	bla _VIM	Bacillus cereus
Pig (F)	Fr2	-	-	-	-	-	-	0	-	Enterococcus faecalis
Pig(F)	Fr4	-	+	-	-	-	-	1	bla _VIM	Proteus mirabilis
Pig (F)	F11	+	-	-	+	-	+	3	bla_NDM, bla_OXA−48 bla_SPM	Providencia alcalifaciens
Pig (F)	F14	+	+	-	+	+	-	4	bla_NDM, bla_VIM bla_OXA−48, bla_IPM	Bacillus cereus
Pig(M)	Mr5	-	-	-	-	-	-	0	-	Bacillus cereus
Pig(M)	M11	+	-	-	+	-	-	2	bla_NDM, bla _OXA−48	Bacillus cereus
Pig(M)	M12	+	-	-	-	-	-	1	bla_NDM	Escherichia coli
Pig(M)	M12p	-	+	+	-	-	-	2	bla_VIM bla _KPC	Escherichia coli
Pig(M)	M13	+	-	-	-	-	-	1	bla_NDM	Escherichia coli
Pig(M)	M16	+	-	-	-	-	-	1	bla_NDM	Escherichia fergusonii
Pig(M)	M24	+	+	-	-	-	-	2	bla_NDM bla _VIM	Shigella flexneri
Pig(M)	M25	+	-	-	-	-	-	1	bla_NDM	Shigella flexneri

F-Female, M- Male +-positive, - negative

Table 5

Percentage occurrence of the carbapenamse genes from the bacterial isolates from pig
Genes	Percentage carbapenamase genes (%)
bla_NDM,	9(42.85)
bla_VIM	5(23.81)
bla_OXA−48,	3(14.29)
Bla_kpc	2(9.52)
bla_IPM	1(4.76)
Bla_spm	1(4.76)

Animals, like people, carry bacteria in their guts. Antibiotic-resistant bacteria present in the guts of animals can get in food in several ways especially when animals are slaughtered and processed for food, resistant bacteria can contaminate meat or other animal products, and animal feces can contain resistant bacteria and get into the surrounding environment. People can get antibiotic-resistant intestinal infections by handling or eating contaminated food or coming in contact with animal waste (poop), either through direct contact with animals and animal environments or through contaminated drinking or swimming water.

Food animals in the United States are often exposed to antimicrobials to treat and prevent infectious diseases or to promote growth. Many of these antimicrobials are identical to or closely resemble drugs used in humans. Precise figures for the number of antimicrobials used in animals are not publicly available in the United States, and estimates vary widely. Antimicrobial resistance has emerged in zoonotic enteropathogens (e.g., Salmonella spp., Campylobacter spp.), commensal bacteria (e.g., Escherichia coli, enterococci), and bacterial pathogens of animals (e.g., Pasteurella, Actinobacillus spp.), but the prevalence of resistance varies. Antimicrobial resistance emerges from the use of antimicrobials in animals and the subsequent transfer of resistance genes and bacteria among animals and animal products and the environment. To slow the development of resistance, some countries have restricted antimicrobial use in feed, and some groups advocate similar measures in the United States. Alternatives to growth-promoting and prophylactic uses of antimicrobials in agriculture include improved management practices, wider use of vaccines, and introduction of probiotics. Monitoring programs, prudent use guidelines, and educational campaigns provide approaches to minimize the further development of antimicrobial resistance (Scott and Paula,2002).

Swine. Swine are usually raised in confinement, either from birth through slaughter (farrow-finish) or in aggregated management systems (e.g., nursery, grower, finishing) (Tanner et al., 2000), with many farms of both types practicing all-in, all-out management to control infectious diseases. Average herd size is increasing; in 1995, ∼60% of pigs were raised on farms of ã1000 head (Animal and Plant Health Inspection Service ). Antimicrobial use is predominantly in feed, at relatively low concentrations, for growth promotion or disease prophylaxis (Dewey et al 1997), with antimicrobials typically removed at the finishing stages of production to avoid residues. Therapeutic treatments are also administered in feed, although producers also treat individual swine. Most pigs receive antimicrobials in feed after weaning (“starter rations”) (Dewey et al 1999) when they are most vulnerable to infectious disease.

Several antimicrobials (e.g., ceftiofur, sulfonamides, tetracyclines, tiamulin) are used to treat and prevent pneumonia, an important problem among swine (Dewey et al 1997). Gentamicin, apramicin, and neomycin are used to treat bacterial diarrhea, another important problem, caused by organisms such as E. coli and Clostridium perfringens. Swine dysentery (Serpulina hyodysenteriae) and ileitis (Lawsonia intracellularis) are other important diseases that may be treated with antimicrobials such as lincomycin, tiamulin, or macrolides (Dewey et al., 1999) Overall, the antimicrobials used most frequently in swine are tetracyclines, tylosin, and sulfamethazine or other sulfas

The study highlighted the bitter truth that antibiotic resistance is spreading faster day by day. It is a matter of great concern that the environmental samples are developing strong antibiotic resistance for various antibiotics. Antibiotics are used indiscriminately in Bangladesh due to lack of proper regulation and surveillance. This study will serve as a base that would recommend necessary initiatives to monitor and limit the practice of antibiotics, as well as proper surveillance following standardized protocol throughout the nation.

Recommendation

Therefore, hand washing interventions i.e. proper hand washing and especially hand hygiene after handling farm and companion animals dungs
enhanced environmental cleaning/decontamination i.e. proper channelling of sewage drainage and treatment of animals dungs of farm animals before releasing into the environment to avoid contamination of rivers to prevent the spread of infections
Appropriate regulation of antibiotics use among the farm animals and companion animals should be in place
Proper diagnosis of diseases should be conducted among veterinary and human being before prescription,
Livestock animals after processed should be properly washed especially when contaminated with it faecal samples and properly cooked before eating.

The major limitation is that some farm manager prevented access to their pigs because they felt the use of swab stick will affect the animal even after showing video evidence of collections of samples from other farms

blaKPC (Klebsiella pneumoniae carbapenemase),

blaIMP (Imipenem metallo-beta-lactamase),

blaNDM (New Delhi metallo-beta-lactamase),

blaVIM (Verona integron-encoded metallo-beta-lactamase) and OXA (Oxacillin carbapenemases) among others is

blaSPM Metallo-β-Lactamase Gene in Imipenem-Resistant (Sao Paulo metallo-β-lactamase)

Ethical approval

Ethical approval was received from the Ekiti state Veterinary Clinic before the collection of the samples. The owner of the farm consented to the collection of the sample from their animals

Consent for publication

Not applicable.

Availability of data and materials

All data generated or analyzed during this study are included in this published article. Original data set are available from the corresponding author upon reasonable request.

Competing interests

There authors declare that they have no competing interest

Funding

The research was supported by funding by TET FUND through the approval of the Vice Chancellor, Prof V.O Adeoluwa of the Bamidele Olumilua University of Education Science and Technology Ikere –Ekiti, Nigeria.

Authors' contributions

This work was carried out in collaboration between all authors. Author MJAO designed the study, OKE wrote the protocol, and carried out the study. Authors MJAO and OKE revised the protocol and designed the data collection tool. Authors OKE did sample collection, performed the laboratory analysis, and author MJAO entered and helped in interpreting data. OKE EOK wrote the draft of the manuscript. Authors MJAO supervised the work, reviewed the drafts, and provided suggestions. All authors contributed to the literature searches and approved the final manuscript. All authors read and approved the final manuscript

Acknowledgments

I like to acknowledge TET FUND through the Vice Chancellor Prof V.O Adeoluwa of the Bamidele Olumilua University of Education Science and Technology Ikere –Ekiti, Nigeria. The financial support has really helped the research to go a long way. The author is grateful for the support of my supervisors Dr Oyinloye and family for financial support towards the research

Animal and Plant Health Inspection Service. Swine 2000. Part 1: Reference of 2000 swine management practices. 2001.Washington, DC US Department of Agriculture
Clinical Infectious Diseases, Volume 34, Issue Supplement_3, June 2002, Pages S93-106, https://doi.org/10.1086/340246
Dewey,C.E., Cox,B.D.,Straw, B.E., (1997).Associations between off-label feed additives and farm size, veterinary consult use, and animal age, Previous Veterinary Medicine., vol.31(pg. 133-46)
Dewey,C.E., Cox,B.D.,Straw, B.E.,(1999).Use of antimicrobials in swine feeds in the United States, Swine Health Production, vol. 07 (pg. 19-25
Iowa State University Pres(pg. 637-655
Scott A. McEwen, Paula J. Fedorka-Cray(2002) Antimicrobial Use and Resistance in Animals
Sheu C-C, Chang Y-T, Lin S-Y, Chen Y-H and Hsueh P-R (2019) Infections Caused by Carbapenem-Resistant Enterobacteriaceae: An Update on Therapeutic Options. Front. Microbiology. 10:80. doi: 10.3389/fmicb.2019.00080
Tanner, A.C., Prescott,J.F., Baggot, J.D., Walker,R.D (2000). Antimicrobial drug use in poultry.Antimicrobial therapy in veterinary medicine. 3rd ed.Ames, IA
Yohei Doi (2019)Treatment Options for Carbapenem-resistant Gramnegative Bacterial Infections Clinical Infectious Diseases® 2019;69(S7):S565–575

Plate 1 to 6 are available in the Supplemental Files section.

No competing interests reported.

Plate1to6.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Antibiotics Susceptibility testing of Meropenem-resistant bacterial isolates from pigs in some selected farms in Ado Ekiti

Status:

Version 1

Abstract

Background

Methods

Study design

Collection Of Samples

Isolation Of Bacterial Isolates From The Sample

Molecular Identification Of Bacteria Isolates

Selection Of Antibiotic

Multiplex PCR For Genetic Characterisation Of Carbapenemase Producing Bacterial

Molecular detection of the identified bacteria

Statistical analysis.

Result

Discussion

Conclusion

Recommendation

Limitations

Abbreviations

Declarations

References

Plate

Additional Declarations

Supplementary Files

Status:

Version 1