Interleukin-5 deficiency promotes macrophage differentiation and exacerbates cardiac remodeling via the STAT3 pathway in angiotensin II-infused mice Running title: IL-5 alleviates cardiac remodeling

doi:10.21203/rs.3.rs-2443092/v1

Download PDF

Research Article

Interleukin-5 deficiency promotes macrophage differentiation and exacerbates cardiac remodeling via the STAT3 pathway in angiotensin II-infused mice Running title: IL-5 alleviates cardiac remodeling

https://doi.org/10.21203/rs.3.rs-2443092/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Interleukin-5 (IL-5) was reported to participate in cardiovascular diseases, this study aimed to investigate the effects of IL-5 on cardiac remodeling. Mice were infused with angiotensin II (Ang II), and we found cardiac IL-5 expression was time- and dose-dependently decreased after Ang II infusion, and was mainly derived from cardiac macrophages. Additionally, the effects of IL-5 knockout on Ang II-induced cardiac remodeling were observed, and the results exhibited that IL-5 deficiency significantly increased the expression of cardiac hypertrophy markers, elevated myocardial cell cross-sectional areas, and worsened cardiac dysfunction in Ang II-infused mice. IL-5 deletion also promoted M2 macrophage differentiation and exacerbated cardiac fibrosis. Effects of IL-5 on cardiac remodeling and M2 macrophage differentiation were reversed by S31-201. IL-5 knockout significantly increased the Ang II-induced mRNA expression of cardiac hypertrophy markers in myocardial cells that were co-cultured with macrophages, and this effect was also reversed by S31-201. Similar trends in the mRNA levels of fibrosis markers were observed when cardiac fibroblasts and macrophages were co-cultured. Our study suggests that IL-5 deficiency promotes M2 macrophages differentiation and exacerbating cardiac remodeling by activating the STAT3 pathway in Ang II-infused mice. IL-5 may be a potential target for the clinical prevention of cardiac remodeling.

Cardiac remodeling

Interleukin-5

Angiotensin II

STAT3 pathway

Macrophage differentiation

Chronic heart failure (CHF) is a complex clinical syndrome that can be caused by many pathological factors, such as hypertension, pressure load and heart diseases [1]. CHF is one of the most important causes of death worldwide, especially in economically underdeveloped areas [2]. A large number of studies have shown that the process of CHF is often accompanied by the occurrence of cardiac remodeling, and delaying the progression of cardiac remodeling can significantly improve cardiac dysfunction and improve patient prognosis [1–3].

Interleukins (ILs) are pluripotent cytokines secreted by both immune cells and non-immune cells, and several ILs have been reported to be involved in cardiac remodeling. In a recent study, down-regulation of IL-6 expression was reported to significantly alleviate cardiac hypertrophy and fibrosis in mice with transverse aortic constriction [4]. In another study, IL-10 knockout was found to significantly increase pressure overload-induced cardiac remodeling by inhibiting bone marrow fibroblast progenitor cell homing and differentiation to fibroblasts [5]. Deletion of IL-12p35, the common subunit of IL-12 and IL-35, increased the differentiation of CD4 + T lymphocyte-dependent type 2 macrophages, thereby exacerbating cardiac fibrosis through the P65 pathway in angiotensin II (Ang II)-treated mice [6]. In animal studies, IL-18 has been reported to successfully exacerbate cardiac remodeling induced by osteopontin, Ang II, or pressure overload [7–9]. IL-22-neutralizing antibodies significantly reduced Ang II-induced cardiac inflammation and alleviated cardiac hypertrophy and cardiac dysfunction [10].

IL-5, a member of the IL-2 superfamily, is secreted by immune cells such as macrophages and lymphocytes [11]. IL-5 can regulate the STAT pathway, mediate downstream signaling and participate in a variety of disease processes [12]. IL-5 has also been shown to be involved in a variety of cardiovascular diseases. Previous studies have reported that increased IL-5 expression can significantly inhibit both Ang II- and high-fat diet-induced atherosclerosis in mice, suggesting that IL-5 may be a regulatory target for atherosclerosis [13–15]. However, the role of IL-5 in cardiac remodeling remains unknown. In this study, IL-5-deficient mice were used to determine the effects of IL-5 on cardiac remodeling and explore its mechanism.

Animals and animal models

Both IL-5-knockout (IL-5-/-) mice and wild-type (WT) mice with a C57BL/6J background were purchased from the Institute of Model Zoology of Nanjing University. All mice were housed in the animal room of Wuhan University People's Hospital, and male mice aged 9 weeks were used in this study because low degree of cardiac remodeling was observed in female mice [16]. First, WT mice were infused with Ang II (1000 ng/kg/min, ENZO) for different times or infused with different Ang II concentrations for 14 days, and control mice were infused with saline. Then, cardiac IL-5 expression in each group was measured. Additionally, both WT mice and IL-5-/- mice were infused with Ang II (1000 ng/kg/min) or saline for 14 days, and body weight (BW) and heart weight (HW) measurements were obtained. Furthermore, both WT mice and IL-5-/- mice were infused with Ang II and treated daily with DMSO, or S31-201 (2.5 mg/kg, Sigma) [17]. Among which, S31-201 is the special inhibitor of STAT3 pathway and inhibits STAT3 activation by inhibiting complex formation, STAT3 tyrosine phosphorylation and DNA-binding. Each group contained 10 mice, and this study was approved by the Institutional Animal Care and Use Committee of the Ningbo First Hospital (Approval No. 2019DC1102 ).

Chronic Ang Ii Infusion

Osmotic minipumps (Alzet, Model 2002) were implanted to infuse Ang II as described in a previous study [18]. Briefly, the mice were anesthetized by inhalation of 2% isoflurane, and then the skin on the nape of the neck was cut open after disinfection. The osmotic minipumps containing Ang II (1000 ng/kg/min) were implanted, and the skin was sutured.

Detection Of Cardiac Function

After infusion with Ang II for 14 days, the mice were anesthetized and then laid flat on the operating table. The hair on the left chest was shaved, and the coupler was applied evenly. Finally, echocardiography was performed using a MyLab™ 30CV ultrasound system (Esaote SpA) equipped with a 10 MHz linear array ultrasound transducer to examine the cardiac function and structure of each mouse, and the left ventricle (LV) end-diastolic diameter (LVEDD), LV end-systolic diameter (LVESD), LV ejection fraction (EF), and fractional shortening (FS) measurements were collected and analyzed.

Western Blot Analysis

Western blot analysis

Total protein was collected after the LV tissue or macrophages (Møs) were lysed. Then, the protein samples were quantitated, separated by electrophoresis and transferred to Immobilon-FL PVDF membranes (Millipore, USA). After being blocked with 3% fetal bovine serum, the cells were incubated with anti-α-SMA, anti-collagen I, anti-collagen III, anti-TGF-β, anti-t-STAT3, anti-p-STAT3, anti-arginase-1 (Arg-1), and anti-GAPDH (all from Abcam or GeneTex) antibodies at 4°C overnight. After being incubated with the secondary antibodies at room temperature for 1 hour, the blots were scanned and analyzed.

Quantitative Polymerase Chain Reaction (Rt-qpcr)

LV tissue or cells were extracted with TRIZOL reagent, and then the total RNA of each sample was collected and reverse transcribed to synthesize cDNA using a reverse transcription kit according to the manufacturer’s instructions. Then, PCR amplification was performed using LightCycler 480 SYBR green master mix (Roche) to measure the mRNA expression of target genes, including IL-5, atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), β-myosin heavy chain (β-MHC), α-SMA, collagen I, collagen III, CTGF, Arg-1, CD163, CD206, TGF-β, IL-4, IL-10, and IL-13. All mRNA expression was normalized to that of GAPDH, and the RT-qPCR primer sequences are shown in Table 1.

Table 1

Primers used in this study.
Gene	Forward	Reverse
IL-5	CACCGAGCTCTGTTGACAAG	TCCTCGCCACACTTCTCTTT
ANP	CCTGTGTACAGTGCGGTGTC	AAGCTGTTGCAGCCTAGTCC
BNP	CTCAAGCTGCTTTGGGCACAAGAT	AGCCAGGAGGTCTTCCTACAACAA
β-MHC	TCTACCCAGCCAAGATCAAAGT	CCCATTCCTAATAAGCTGTGTGG
α-SMA	TCCTGACGCTGAAGTATCCGATA	GGCCACACGAAGCTCGTTAT
Collagen I	GCTCCTCTTAGGGGCCACT	CCACGTCTCACCATTGGGG
Collagen III	CTGTAACATGGAAACTGGGGAAA	CCATAGCTGAACTGAAAACCACC
CTGF	TGACCCCTGCGACCCACA	TACACCGACCCACCGAAGACACAG
Arg-1	AACACGGCAGTGGCTTTAACC	GGTTTTCATGTGGCGCATTC
CD36	ATGGGCTGTGATCGGAACTG	TTTGCCACGTCATCTGGGTTT
CD163	TCCACACGTCCAGAACAGTC	CCTTGGAAACAGAGACAGGC
CD206	CAGGTGTGGGCTCAGGTAGT	TGTGGTGAGCTGAAAGGTGA
TGF-β	TGTTAAAACTGGCATCTGA	GTCTCTTAGGAAGTAGGT
IL-4	ACGAGGTCACAGGAGAAGGGA	AGCCCTACAGACGAGCTCACTC
IL-10	ATAACTGCACCCACTTCCCA	GGGCATCACTTCTACCAGGT
IL-13	CGCAAGGCCCCCACTAC	TGGCGAAACAGTTGCTTTGT
GAPDH	AACTTTGGCATTGTGGAAGG	CACATTGGGGGTAGGAACAC

Enzyme-linked Immunosorbent Assay (Elisa)

Serum was collected after the blood samples were centrifuged at 3000 × g for 15 min, and then the serum IL-5 level in each group was measured using mouse IL-5 ELISA kits (Thermo Fisher) according to the manufacturer's instructions. All samples were measured in duplicate.

Histological Analysis

Mouse hearts were isolated, fixed with formaldehyde, embedded in paraffin, cut to a thickness of approximately 5 µm and mounted onto slides. Then, wheat germ agglutinin (WGA) staining was performed for histopathological analysis, and more than 200 cells in each group were used to analyze the cross-sectional areas (CSAs) of myocardial cells (MCs). Picrosirius red (PSR) staining was used to determine the LV collagen expression levels. Immunofluorescence staining was used to measure cardiac IL-5 expression. Double immunofluorescence staining using anti-F4/80 and anti-IL-5 antibodies, anti-F4/80 and anti-p-STAT3 antibodies, or anti-F4/80 and anti-CD206 antibodies was used to identify the presence of IL-5 in Møs, the expression of p-STAT3 in Møs, and M2 Møs. Fluorescence intensity was analyzed as the expression of target protein.

Cell Study And Treatment

Bone marrow-derived Møs were isolated from both WT mice and IL-5-/- mice as described in a previous study [19, 20]. Briefly, male mice aged 7–8 weeks were euthanized, and the tibias were isolated in a sterile environment. Then, both segments were opened, and the cells were flushed out from the lumen using RPMI-1640 medium. After the red blood cells were lysed, the cells were rinsed with PBS and centrifuged to obtain monocytes (Monos). The isolated cells were treated with M-CSF (50 ng/ml) and GM-CSF (50 ng/ml, both from PeproTech) for 8 days to promote differentiation into Møs and dendritic cells (DCs), respectively [19, 20]. In addition, the spleen was also isolated and prepared as a single-cell suspension. Lymphocytes were also isolated, and CD4 magnetic beads (Miltenyi Biotec) and an automatic magnetic-activated cell soring (MACS) separator were used to select CD4 + T lymphocytes (TCs). Mouse MCs and cardiac fibroblasts (CFs) were purchased from ATCC, and all cells were cultured in RPMI-1640 medium and treated as follows:

First, CD4 + TCs, Monos, Møs, DCs, MCs and CFs were treated with saline or Ang II (100 nM) [18], and the IL-5 mRNA levels in each cell type were measured.

Additionally, Møs (10⁶ cells) and MCs (10⁶ cells) were co-cultured and divided into the following 8 groups: 1: MCs + WT Møs; 2. MCs + IL-5-/- Mø; 3. MCs + WT Mø + S31-201 (10 µM) [21]; 4. MCs + IL-5-/- Mø + S31-201; 5: MCs + WT Mø + Ang II; 6. MCs + IL-5-/- Mø + Ang II; 7. MCs + WT Mø + S31-201 + Ang II; and 8. MCs + IL-5-/- Mø + S31-201 + Ang II. After treatment for 24 hours, the MCs were collected for ANP and BNP mRNA analysis.

Furthermore, Møs and CFs (10⁶ cells) were co-cultured and divided into 8 groups as described above. The mRNA expression of α-SMA, collagen I, and collagen III in CFs was measured.

Statistical analysis

All data in the present study are expressed as the mean ± standard deviation (SD) and were analyzed using GraphPad Prism 7. Student’s t-tests were used to compare the differences between two groups, and one-way or two-way ANOVA, followed by Tukey’s multiple comparisons test, was performed to compare the differences between more than two groups. A value of p < 0.05 was considered to be statistically significant.

Ang II infusion reduced IL-5 expression in cardiac macrophages in mice

Ang II infusion time-dependently reduced both cardiac IL-5 mRNA expression and serum IL-5 levels (Fig. 1A and 1B). Similar trends were observed when mice were infused with different Ang II concentrations for 14 days (Fig. 1C and 1D). Immunofluorescence staining showed that Ang II infusion for 14 days significantly reduced cardiac IL-5 expression compared with that of the control group (Fig. 1E). In addition, Ang II treatment reduced IL-5 mRNA levels in TCs, Møs and DCs, especially in Møs, but did not affect IL-5 mRNA expression in Monos, MCs, or CFs (Fig. 1F). Double staining with anti-F4/80 and anti-IL-5 antibodies also showed that cardiac Mø-derived IL-5 levels were reduced by Ang II infusion (Fig. 1G).

Il-5 Deficiency Worsened Cardiac Remodeling And Dysfunction In Ang Ii-treated Mice

In Ang II-infused mice, IL-5 deficiency increased the ratios of HW/BW (Fig. 2A). In addition, the Ang II-induced increases in the mRNA expression of hypertrophy markers, such as ANP, BNP, and β-MHC, were mitigated by IL-5 deletion (Fig. 2B-2D). The WGA staining results showed that the CSA was increased in Ang II-infused WT mice and further elevated in Ang II-infused IL-5-/- mice (Fig. 2E). In addition, IL-5 deficiency increased both the LVEDD and LVESD while decreasing both the LVEF and FS in Ang II-treated mice (Fig. 2F and 2G).

3.3. Il-5 Knockout Exacerbated Ang Ii-induced Cardiac Fibrosis

The PSR staining results showed that the degree of collagen disposition was significantly higher in the Ang II-infused IL-5-/- mice than in the Ang II-infused WT mice (Figure CA). Western blot analysis revealed that IL-5 deletion significantly increased the protein levels of cardiac α-SMA, collagen I, collagen III, and CTGF in Ang II-infused mice (Fig. 3B). Similar trends in the mRNA levels of these genes were observed (Fig. 3C).

Il-5 Deletion Promoted M2 Macrophage Differentiation In Ang Ii-infused Mice

Cardiac STAT3 phosphorylation was measured, and the results showed that both levels of p-STAT3 and Arg-1 were significantly increased in Ang II-infused WT mice and further elevated in Ang II-infused IL-5-/- mice (Fig. 4A). Increased p-STAT3 expression was observed in cardiac Møs (Fig. 4B). Furthermore, infusion with Ang II increased the number of cardiac M2 Møs, and IL-5 knockout further promoted M2 Mø differentiation in Ang II-treated mice (Fig. 4B). Similar trends in the mRNA expression of M2 Mø-related cytokines, including Arg-1, CD163, CD206, TGF-β, IL-4, IL-10, and IL-13, were observed (Fig. 4C).

S31-201 Treatment Alleviated Cardiac Remodeling And Cardiac Dysfunction In Ang Ii-infused Il-5-/- Mice

Treatment with S31-201 significantly increased the HW/BW ratios, and elevated mRNA levels of ANP, BNP, and β-MHC in Ang II-infused IL-5-/- mice (Fig. 5A-5D). In addition, both the CSA and the degree of collagen disposition were increased by S31-201 treatment in Ang II-infused IL-5-/- mice (Fig. 5E). Furthermore, lower the LVEDD and LVESD and higher LVEF and FS were observed in Ang II-infused mice when S31-201 was given (Fig. 5F and 5G).

Treatment With S31-201 Reversed M2 Macrophage Differentiation In Ang Ii-infused Il-5-/- Mice

Western blot analysis showed that treatment with S31-201 significantly reduced both Arg-1 expression and STAT3 phosphorylation in Ang II-infused IL-5-/- mice (Fig. 6A). In addition, mRNA expression levels of cardiac α-SMA, collagen I, collagen III, and CTGF were decreased by S31-201 in Ang II-infused mice (Fig. 6B). Similar trends in the mRNA levels of Arg-1, CD163, CD206, TGF-β, IL-4, IL-10, and IL-13 were observed (Fig. 6C).

Il-5 Deletion Exacerbated Ang Ii-induced Myocardial Cell Hypertrophy And Cardiac Fibroblast Collagen Deposition In Vitro

In MCs co-cultured with WT Møs, both ANP and BNP mRNA levels were increased by Ang II treatment. The ANP and BNP mRNA levels of MCs were further elevated when the cells were co-cultured with IL-5-/- Møs, but these effects were significantly reversed by S31-201 treatment (Fig. 7A and 7B). Similar trends in the mRNA levels of α-SMA, collagen I, and collagen III were observed when CFs were co-cultured with WT Møs (Fig. 7C-7E).

In the present study, our data demonstrated for the first time that Ang II treatment significantly decreased IL-5 expression, which was secreted mainly by macrophages. IL-5 deficiency promoted the development of cardiac hypertrophy, exacerbated the degree of cardiac fibrosis, and further worsened cardiac dysfunction in Ang II-infused mice. More p-STAT3 protein expression in macrophages and M2 macrophage differentiation were observed in Ang II-infused IL-5-/- mice than in Ang II-infused WT mice. When STAT3 phosphorylation was blocked by S31-201, these effects mediated by IL-5 knockout were significantly reversed. In addition, similar results were also observed in vitro.

Data from both clinical experiments and animal studies have shown that IL-5 expression is significantly altered in cardiovascular disease. Decreased IL-5 expression has been observed in human CHF, high-fat diet-induced mouse atherosclerosis and doxorubicin-induced mouse acute cardiac injury [13–15, 22]. Ang II is the joint link of renin-angiotensin system and the most important signal mediator. After bind to the receptors of target cell, especially AT1, Ang II lead to the activation of a variety of immune cells and the release of inflammatory substances, fibroblast proliferation, the production of intracellular free radicals, tissue and organ damage, mitochondrial dysfunction and other pathological processes. Therefore, it is widely used in the study of hypertension and cardiac remodeling. In this study, we found that Ang II, an important inflammatory substance that induces cardiac remodeling, time- and dose-dependently decreased cardiac IL-5 expression, which suggests that reduced IL-5 expression may be associated with Ang II-induced cardiac remodeling. Although both immune and non-immune cells are sources of IL-5, IL-5 is rarely secreted by non-immune cells and is mainly secreted by immune cells such as lymphocytes, macrophages, and dendritic cells [13, 15, 23, 24]. Our results showed that Ang II treatment decreased IL-5 expression in several immune cell types, especially in macrophages. Combined with the double-staining results, Ang II treatment significantly reduced the IL-5 expression derived from cardiac macrophages. These results suggest that the reduction in macrophage-derived cardiac IL-5 may play an important role in Ang II-induced cardiac remodeling.

To investigate the role of IL-5 in cardiac remodeling, IL-5-knockout mice were used to establish a mouse model of cardiac remodeling using Ang II infusion. The results showed that IL-5 deficiency significantly increased the mRNA expression of cardiac hypertrophy markers, such as ANP, BNP and β-MHC. Cardiac fibrosis is a serious pathological change associated with the process of cardiac remodeling, and it is also an important factor that reflects cardiac remodeling. We also determined the effect of IL-5 deletion on cardiac fibrosis, and the results showed that IL-5 knockout also exacerbated collagen deposition and elevated the mRNA expression of various markers of cardiac fibrosis. These results confirmed that IL-5 knockout significantly exacerbated Ang II-induced cardiac remodeling. Previous studies have found that IL-5 does not affect blood pressure in Ang II-infused mice, suggesting that the regulation of IL-5 in cardiac remodeling is independent of blood pressure.

Numerous studies have shown that multiple immune cell types are involved in the process of cardiac remodeling, such as macrophages, monocytes and dendritic cells [25, 26]. Among them, the relationship between macrophages and pressure overload-induced cardiac remodeling has been the most widely studied [24–26]. Due to M2 macrophage secretion of inflammation-related factors, including IL-4 and TGF-β, which can promote the synthesis of collagen in cardiac fibroblasts and the hypertrophy of myocardial cells, M2 macrophage-mediated promotion of cardiac remodeling has been widely recognized [6, 9, 18, 27]. Numerous studies have demonstrated that the STAT3 pathway is one of the important signaling pathways regulating macrophage differentiation into the M2 phenotype [18, 28]. IL-5 has been widely showed to regulate macrophage differentiation in a variety of micro-environments [15, 29–31]. Considering that STATs are the most important signaling pathways associated with IL-5, we hypothesized that IL-5 regulates macrophage differentiation into the M2 phenotype through the STAT3 pathway. To confirm this hypothesis, we first examined the phosphorylation of STAT3 pathway factors and found a significant increase in p-STAT3 expression in both the heart and cardiac macrophages in Ang II-infused IL-5-/- mice compared with Ang II-infused WT mice. Next, we examined the differentiation of M2 macrophages and the expression of M2-related markers and inflammatory cytokines. The results showed that more M2 macrophages, as well as M2 macrophage-related markers and cytokines, were observed in Ang II-infused IL-5-/- mice. These results suggest that IL-5 deletion promotes the M2 differentiation of macrophages by activating the STAT3 pathway, thus exacerbating the progression of cardiac remodeling in Ang II-infused mice.

To further confirm the above hypothesis, a specific STAT3 pathway inhibitor, which has been demonstrated to significantly decrease STAT3 phosphorylation, was used in this study. The results showed that treatment with S31-201 significantly decreased the expression of cardiac hypertrophic markers such as ANP, BNP, and β-MHC, as well as cardiac fibrosis markers such as α-SMA, collagen I, collagen III, TGF-β. In addition, the values of LVEDD and LVESD were decreased, while the values of LVEF and FS were increased by S31-201 in Ang II-infused IL-5-/- mice. These results suggested that S31-201 reversed cardiac remodeling in Ang II-infused IL-5-/- mice. In addition, decreased mRNA expression levels of M2 macrophage-related markers and cytokines were found in S31-201-treated Ang II-infused IL-5-/- mice compared with DMSO-treated Ang II-infused IL-5-/- mice. These results further support our hypothesis and demonstrate that the regulation of IL-5 deletion on Ang II-induced cardiac remodeling is mediated by the STAT3 signaling pathway.

To exclude the influence of interactions between body factors and further verify these conclusions, myocardial cells and cardiac fibroblasts were individually co-cultured with macrophages. The results showed that co-culture with IL-5-/- macrophages significantly promoted Ang II-induced myocardial cell hypertrophy, which was markedly reversed by S31-201 treatment, and similar trends in fibrosis-related cytokine mRNA expression in cardiac fibroblasts were observed. These results also suggest that IL-5 regulates Ang II-mediated cardiac hypertrophy and cardiac fibrosis through the STAT3 pathway in vitro, which is consistent with the conclusions of our animal experiments.

In summary, our study confirmed that IL-5 knockout could promote the phosphorylation of STAT3 in macrophages, thereby promoting M2 macrophage differentiation and exacerbating Ang II-induced cardiac remodeling and cardiac dysfunction. Although the specific mechanisms of the regulatory role of IL-5 in cardiac remodeling are still unclear and need to be clarified by more experiments, the regulation of M2 macrophage differentiation is still a potential mechanism. Therefore, our study suggests that IL-5 is an important target for the clinical prevention of cardiac remodeling and delaying the progression of CHF.

Conflict of interest: The authors declare no potential conflict of interest.

Availability of data and materials: Not applicable

Authors' contributions: Caijie Shen: Conceptualization, Methodology Investigation, and Software; Nan Wu: Methodology, Investigation and Writing- Original draft preparation; Jianye Peng: Investigation and Software; Mingjun Feng: Validation and Writing; Yibo Yu: Supervision and Writing; Jian Wang: Validation and Supervision; Xiaomin Chen: Experimental design, Reviewing and Editing.

Funding statement: This work was supported by the Funding of the Plan of Science and Technology on Medical and Health in Zhejiang Province (Grant No. 2021KY1002), the Natural Science Foundation of Ningbo (Grant No. 2021J266), the Ningbo province public welfare project (Grant No. 20211JCGY020364).

Herrmann M, Taban-Shomal O, Hübner U, Böhm M, Herrmann W.2006. A review of homocysteine and heart failure. Eur J Heart Fail 8(6): 571–576.
Dick SA, Epelman S. 2016. Chronic heart failure and inflammation: what do we really know? Circ Res 119(1): 159–176.
Sekaran NK, Crowley AL, de Souza FR, Resende ES, Rao SV. 2017. The role for cardiovascular remodeling in cardiovascular outcomes. Curr Atheroscler Rep 19: 23.
Kumar S, Wang G, Zheng N, Cheng W, Ouyang K, Lin H, Liao Y, Liu J. 2019. HIMF (hypoxia-induced mitogenic factor)-IL (interleukin)-6 signaling mediates cardiomyocyte-fibroblast crosstalk to promote cardiac hypertrophy and fibrosis. Hypertension 73(5): 1058–1070.
Verma SK, Garikipati VNS, Krishnamurthy P, Schumacher SM, Grisanti LA, Cimini M, Cheng Z, Khan M, Yue Y, Benedict C, Truongcao MM, Rabinowitz JE, Goukassian DA, Tilley D, Koch WJ, Kishore R. 2017. Interleukin-10 inhibits bone marrow fibroblast progenitor cell-mediated cardiac fibrosis in pressure-overloaded myocardium. Circulation 136(10): 940–953.
Li Y, Zhang C, Wu Y, Han Y, Cui W, Jia L, Cai L, Cheng J, Li H, Du J. 2012. Interleukin-12p35 deletion promotes CD4 T-cell-dependent macrophage differentiation and enhances angiotensin II-Induced cardiac fibrosis. Arterioscler Thromb Vasc Biol 32(7): 1662–1674.
Yu Q, Vazquez R, Khojeini EV, Patel C, Venkataramani R, Larson DF. 2009. IL-18 induction of osteopontin mediates cardiac fibrosis and diastolic dysfunction in mice. Am J Physiol Heart Circ Physiol 297(1): H76-H85.
Xiao H, Li H, Wang J, Zhang J, Shen J, An X, Zhang C, Wu J, Song Y, Wang X, Yu H, Deng X, Li Z, Xu M, Lu Z, Du J, Gao W, Zhang A, Feng Y, Zhang Y. 2018. IL-18 cleavage triggers cardiac inflammation and fibrosis upon β-adrenergic insult. Eur Heart J 39(1): 60–69.
Matsushita N, Ishida N, Ibi M, Saito M, Sanbe A, Shimojo H, Suzuki S, Koepsell H, Takeishi Y, Morino Y, Taira E, Sawa Y, Hirose M. 2018. Chronic pressure overload induces cardiac hypertrophy and fibrosis via increases in SGLT1 and IL-18 gene expression in Mice. Int Heart J 59(5): 1123–1133.
Ye J, Liu L, Ji Q, Huang Y, Shi Y, Shi L, Liu J, Wang M, Xu Y, Jiang H, Wang Z, Lin Y, Wan J. 2017. Anti-interleukin-22-neutralizing antibody attenuates angiotensin II-induced cardiac hypertrophy in mice. Mediators Inflamm 2017: 5635929.
Bagnasco D, Ferrando M, Caminati M, Bragantini A, Puggioni F, Varricchi G, Passalacqua G, Canonica GW. 2017. Targeting interleukin-5 or interleukin-5Rα: safety considerations. Drug Saf 40(7): 559–570.
Varricchi G, Bagnasco D, Borriello F, Heffler E, Canonica GW. 2016. Interleukin-5 pathway inhibition in the treatment of eosinophilic respiratory disorders: evidence and unmet needs. Curr Opin Allergy Clin Immunol 16(2): 186–200.
Meng K, Zeng Q, Lu Q, Lin Y, Wu B, Yu K, Dong Z, Zhang J, Chai M, Liu Y, Ji Q, Zhou Y. 2015. Valsartan attenuates atherosclerosis via upregulating the Th2 immune response in prolonged angiotensin II-treated ApoE(-/-) Mice. Mol Med 21(1): 143–153.
Zhao W, Lei T, Li H, Sun D, Mo X, Wang Z, Zhang K, Ou H. 2015. Macrophage-specific overexpression of interleukin-5 attenuates atherosclerosis in LDL receptor-deficient mice. Gene Ther 22(8): 645–652.
Daugherty A, Rateri DL, King VL. 2004. IL-5 links adaptive and natural immunity in reducing atherosclerotic disease. J Clin Invest 114(3): 317–319.
Patrizio M, Marano G. 2016. Gender differences in cardiac hypertrophic remodeling. Ann Ist Super Sanita 52(2): 223–229.
Ye J, Ji Q, Liu J, Liu L, Huang Y, Shi Y, Shi L, Wang M, Liu M, Feng Y, Jiang H, Xu Y, Wang Z, Song J, Lin Y, Wan J. 2017. Interleukin 22 promotes blood pressure elevation and endothelial dysfunction in angiotensin II-treated mice. J Am Heart Assoc 6(10): e005875.
Ye J, Que B, Huang Y, Lin Y, Chen J, Liu L, Shi Y, Wang Y, Wang M, Zeng T, Wang Z, Hu H, Xu Y, Shi L, Ye D, Liu J, Jiang H, Wan J, Ji Q. 2019. Interleukin-12p35 knockout promotes macrophage differentiation, aggravates vascular dysfunction, and elevates blood pressure in angiotensin II-infused mice. Cardiovasc Res 115(6): 1102–1113.
Kirabo A, Fontana V, de Faria AP, Loperena R, Galindo CL, Wu J, Bikineyeva AT, Dikalov S, Xiao L, Chen W, Saleh MA, Trott DW, Itani HA, Vinh A, Amarnath V, Amarnath K, Guzik TJ, Bernstein KE, Shen XZ, Shyr Y, Chen SC, Mernaugh RL, Laffer CL, Elijovich F, Davies SS, Moreno H, Madhur MS, Roberts J 2nd, 2014. Harrison DG. DC isoketal-modified proteins activate T cells and promote hypertension. J Clin Invest 124(10): 4642–4656.
Yang M, Zheng J, Miao Y, Wang Y, Cui W, Guo J, Qiu S, Han Y, Jia L, Li H, Cheng J, Du J. 2012. Serum-glucocorticoid regulated kinase 1 regulates alternatively activated macrophage polarization contributing to angiotensin II-induced inflammation and cardiac fibrosis. Arterioscler Thromb Vasc Biol 32(7): 1675–1686.
Dai B, Cui M, Zhu M, Su WL, Qiu MC, Zhang H. 2013. STAT1/3 and ERK1/2 synergistically regulate cardiac fibrosis induced by high glucose. Cell Physiol Biochem 32(4): 960–971.
Cappuzzello C, Di Vito L, Melchionna R, Melillo G, Silvestri L, Cesareo E, Crea F, Liuzzo G, Facchiano A, Capogrossi MC, Napolitano M. 2011. Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-γ in patients with chronic heart failure. J Transl Med 9: 28.
Yi H, Zhang L, Zhen Y, He X, Zhao Y. 2007. Dendritic cells induced in the presence of GM-CSF and IL-5. Cytokine 37(1): 35–43.
Ikutani M, Yanagibashi T, Ogasawara M, Tsuneyama K, Yamamoto S, Hattori Y, Kouro T, Itakura A, Nagai Y, Takaki S, Takatsu K. 2012. Identification of innate IL-5-producing cells and their role in lung eosinophil regulation and antitumor immunity. J Immunol 188(2): 703–713.
Hulsmans M, Sam F, Nahrendorf M. 2016. Monocyte and macrophage contributions to cardiac remodeling. J Mol Cell Cardiol 93: 149–155.
Frieler RA, Mortensen RM. 2015. Immune cell and other noncardiomyocyte regulation of cardiac hypertrophy and remodeling. Circulation 131(11): 1019–1030.
Wang L, Zhang Y, Lin Q, Liu Y, Guan X, Ma X, Cao H, Liu Y, Bai J, Xia Y, Du J, Li H. 2018. CXCL1-CXCR2 axis mediates angiotensin II-induced cardiac hypertrophy and remodelling through regulation of monocyte infiltration. Eur Heart J 39(20): 1818–1831.
Lee TM, Chang N, Lin S. 2017. Dapagliflozin, a selective SGLT2 Inhibitor, attenuated cardiac fibrosis by regulating the macrophage polarization via STAT3 signaling in infarcted rat hearts. Free Radic Biol Med 104: 298–310.
Formentini L, Santacatterina F, Núñez de Arenas C, Stamatakis K, López-Martínez D, Logan A, Fresno M, Smits R, Murphy MP, Cuezva JM. 2017. Mitochondrial ROS production protects the intestine from inflammation through functional M2 macrophage polarization. Cell Rep 19(6): 1202–1213.
Sabogal Piñeros YS, Bal SM, van de Pol MA, Dierdorp BS, Dekker T, Dijkhuis A, Brinkman P, van der Sluijs KF, Zwinderman AH, Majoor CJ, Bonta PI, Ravanetti L, Sterk PJ, Lutter R. 2019. Anti-IL-5 in mild asthma alters rhinovirus-induced macrophage, B-cell, and neutrophil responses (MATERIAL). a placebo-controlled, double-blind study. Am J Respir Crit Care Med 199(4): 508–517.
Xu X, Xu J, Zheng G, Lu H, Duan J, Rui W, Guan J, Cheng L, Yang D, Wang M, Lv Q, Li J, Zhao X, Chen C, Shi P, Jia X, Lin X. 2018. CARD9(S12N) facilitates the production of IL-5 by alveolar macrophages for the induction of type 2 immune responses. Nat Immunol 19(6): 547–560.

No competing interests reported.

Supplementarymaterials.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Interleukin-5 deficiency promotes macrophage differentiation and exacerbates cardiac remodeling via the STAT3 pathway in angiotensin II-infused mice Running title: IL-5 alleviates cardiac remodeling

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Animals and animal models

Chronic Ang Ii Infusion

Detection Of Cardiac Function

Western Blot Analysis

Quantitative Polymerase Chain Reaction (Rt-qpcr)

Enzyme-linked Immunosorbent Assay (Elisa)

Histological Analysis

Cell Study And Treatment

Statistical analysis

Results

Ang II infusion reduced IL-5 expression in cardiac macrophages in mice

Il-5 Deficiency Worsened Cardiac Remodeling And Dysfunction In Ang Ii-treated Mice

3.3. Il-5 Knockout Exacerbated Ang Ii-induced Cardiac Fibrosis

Il-5 Deletion Promoted M2 Macrophage Differentiation In Ang Ii-infused Mice

S31-201 Treatment Alleviated Cardiac Remodeling And Cardiac Dysfunction In Ang Ii-infused Il-5-/- Mice

Treatment With S31-201 Reversed M2 Macrophage Differentiation In Ang Ii-infused Il-5-/- Mice

Il-5 Deletion Exacerbated Ang Ii-induced Myocardial Cell Hypertrophy And Cardiac Fibroblast Collagen Deposition In Vitro

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1