Evaluation of the clinical significance of BTG1 gene expression and pepsinogen in serum and cancerous tissue and gastric atrophy

doi:10.21203/rs.3.rs-2447479/v1

Download PDF

Research Article

Evaluation of the clinical significance of BTG1 gene expression and pepsinogen in serum and cancerous tissue and gastric atrophy

https://doi.org/10.21203/rs.3.rs-2447479/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Gastric cancer is highly prevalent in Iran (approximately 26.1 cases per 100,000). However, the worldwide incidence of this cancer is dramatically declining. Late diagnosis is one of the leading factors that contribute to the high mortality rate of gastric cancer in Iran. Therefore, discovering non-invasive biomarkers for early detection and treatment of gastric cancer is eminently required. Here we aimed to evaluate the changes of BTG1 and pepsinogen one (PG1) in the serum and tissues of patients with gastric atrophy and gastric cancer. Patients were referred to the special clinic of Dezful University of Medical Sciences, and healthy individuals participated from 2016-to 2020. BTG1 and PG1 gene expression was measured in 30 gastric cancer tissue samples, 30 atrophic gastritis samples, and 30 healthy tissue samples using qRT-PCR. ELISA was used to assess the serum levels of PG1 protein in serum. After performing the data distribution test, the Mann-Whitney U test and independent T-test were used to compare the groups. The qRT-CR results showed that the expression of BTG1 and PG1 genes in gastric cancer and atrophic gastritis tissue was significantly lower than in healthy tissue.

Moreover, compared to cancer patients, serum PG1 levels of healthy individuals were considerably higher. There is also a significant difference in the expression of these genes in gastric and atrophic gastric cancer tissue and serum levels. In light of these observations, BTG1 and PG1 seem to be qualified as therapeutic and diagnostic targets for gastric cancer.

Gastric cancer

Pepsinogen 1

qRT-PCR

BTG1

Gastric cancer (GC) is one of the most common cancers globally (1). It has varying incidences in different geographical areas (2) and is most prevalent in West Asia, Latin America, and the former Soviet Union (3). The incidence in Japanese, Korean, and Iranian men is 66.7, 64.6, and 30.4%, respectively (4). GC, with an annual incidence of 7300, is one of the five most common cancers in Iranian men and women (5). This disease is the leading cause of cancer-related deaths in both sexes in Iran. A high rate of GC mortality is due to the disease diagnosis at advanced stages (6). Symptoms of CG include loss of appetite, weight loss, stomach pain, indigestion, nausea, feeling full even after eating small amounts of food, heartburn, and symptoms similar to stomach ulcers, gastritis, black stools, anemia, and a palpable mass in the upper abdomen (7). However, not all of these symptoms may be seen in patients with the GC (8). Surgery, chemotherapy, radiation therapy, and proper diet are among the most critical therapeutic approaches for GC treatment (9). CG is a complex disease, which is caused by damage to stomach cells due to prolonged exposure to carcinogens (10). Risk factors associated with GC include smoking, H. pylori infection, family history, decreased selenium, increased salt, high consumption of red meat, and low consumption of fruits and vegetables (11). One of the most important diagnostic biomarkers of CG is the serum level of pepsinogen (12).

Clinical signs of GC do not appear at the onset of the disease. Therefore, GC is usually diagnosed at more advanced stage and its symptoms include anorexia, dyspepsia, abdominal pain, and dysphagia (12). Since the treatment options for GC patients are limited to methods such as surgery and chemotherapy, the identification of GC biomarkers and gene targets may improve patients' survival and quality of life (13). Therefore, understanding the genes responsible for gastric carcinogenesis and the molecular mechanism of their functions is essential [14]. The BTG1 gene family can stimulate cell differentiation and maturation, regulate cell migration, invasion, and growth, and ultimately prevent cell apoptosis (15). Overexpression of BTG1 acts as a tumour suppressor. It suppresses the cell cycle progression, induces differentiation, and is suggested to be a potential therapeutic target (16).

Human pepsinogen 1 and 2 (PG1 &PG2) are precursors of the pepsin enzyme (17). PG1 is primarily secreted by peptic cells, while pyloric gland cells and duodenal mucosa (18) mainly secrete PG2. Serum PG1 is a functional indicator and changes in gastric mucosa, including the atrophic changes and inflammation, such as inflammation due to H Pylori infection (19). However, serum PG1 levels decreases due to atrophic changes and gastric cell loss. This is while serum PG2 levels remain constant or increase. Thus, the PG1 / PG2 ratio decreases, and this ratio is associated with severe atrophy (18.20). Decreased PG1 / PG2 ratio has been observed in various pathological conditions of the stomach, such as intestinal atrophy and atrophic gastritis, precancerous lesions of the stomach (21, 18). Many case-control and cohort studies have shown that serum PG levels have diagnostic and screening values in GC (22). In Japan, the first test for GC screening is the serum level of pepsinogen, which has replaced the photofluorographic method (23). Although serum PG assay has been accepted as a useful biomarker in GC screening and GC diagnosis, its efficacy has not yet been well-established (24). To this end, Hong et al. (2015), in a meta-analysis study, showed that the study of serum PG is a valuable non-invasive screening test for GC and atrophic gastritis (25). Given these circumstances, we aimed to evaluate the changes of BTG1 and pepsinogen one (PG1) in the serum and tissues of patients with gastric atrophy and gastric cancer.

2-1-patients

The present study is a case-control study of patients with gastric cancer. Patients were enrolled in the study from 2016 to 2020. Forty patients with gastric cancer and atrophy were referred to the special clinic of Dezful University of Medical Sciences between 2016 and 2020, and 30 normal individuals were included in the study in three separate groups. Five ccs of peripheral blood samples were taken from each person to evaluate the serum level of PEP1. Moreover, following the serum isolation, the serum concentration of PEP1 was measured by sandwich ELISA. Patients, which were undergoing chemotherapy, were dropped out of the study. Demographic information collected upon arrival included age, sex, smoking habits, alcohol consumption, medication, and history of eradication. Drinking and smoking are defined as "regular" if you consume more than 35 grams of ethanol or five cigarettes a day, respectively. The ethics committee of Dezful Medical School approved this study and informed written consent was obtained from each patient.

2-2-sample Collection Via Endoscopy

A standard forward-looking video gastroscope (Therapeutic Video Gastroscope, Olympus GIF-Q160, Olympus Optical, Tokyo, Japan) was used for standard upper gastrointestinal endoscopy. A gastroenterologist obtained the biopsy specimens, following the reference method [14] and using the unique and standard forceps. Several tissue samples (2.5 mm2) were removed from the tumour (1 sample). The tumour margin was assessed for further and more detailed examination in the GC group. Other non-tumour specimens were histologically divided into atrophic and normal groups. In the control group, gastric tissue biopsies were obtained.

2-3-RT-PCR

To evaluate the expression level of the desired genes, Real Time-PCR reaction was performed in 20 µl of reaction volume. The standard SYBR green colour method was used to identify PCR products resulting from PCR reactions. To achieve the reaction in 0.2 ml tubes, an amplitude kit (Denmark, amplitude) containing SYBR green Master Mix and components required for real-time PCR reaction were used. For each reaction, one microliter of each primer was added to the solution, mixed thoroughly, and evenly distributed between the two micro tubes. After preparation, the samples were subjected to Real-Time PCR (Germany, LightCycler® 96 system (Roche Life Science)). To measure the amplification of the PCR product, green light (470 nm) was irradiated, and the emitted fluorescent signal was measured at 510 nm. The relative expression level of the GAPDH gene was estimated by the 2^−ΔCt method. The mean 2-^ΔCt of the control group was calculated, and then 2^−ΔCt of each sample was divided by the mean value obtained to determine the equal change in BTG1 expression.

It should be noted that in many studies, 2^Ct2 has been used to calculate changes in gene expression. However, since the healthy and cancerous samples of this study were obtained from two separate individuals, the gene expression changes were analysed using the 2^−ΔCt method [26]. To reach a reliable conclusion, it must be proved that the Cts changes for the reference gene (GAPDH) are not statistically significant in the two groups.

2-4- Rna Extraction And Polymerase Chain Reaction From Gastric Tissue

To extract RNA from gastric tissue, a kit containing Trizol solution (Bioneer, made in South Korea) was used. One mm² (30 mg) of gastric tissue was mixed with 300 µl of Bioneer solution and 200 µl of chloroform in sterile microtubes and RNA extraction was performed according to the manufacturer's instructions. Finally, the extracted RNA was dissolved in 50 µl of DEPC water. The RNA concentration and quality were calculated using a Bic Tek, America (Bio Tek, America) photoconductor at 260 nm. To assess the quality and accuracy of the extracted RNA, it was transferred to agarose gel to evaluate the purification quality of RNA from gastric tissue cells. RevertAid’s first-strand cDNA synthesis kit purchased from Thermo scientific company (Ferment, Italy) was used for cDNA synthesis. According to the kit instructions, two µl of Total RNA extracted from gastric tissue was removed, and cDNA was generated using random hexamer primers and reverse transcriptase enzyme.

2-5- Serum Levels Of Pg I And Ii

Serum levels of PG II and I were measured using ELISA kits (LS test Eiken Kagaku, Inc., Tokyo, Japan). The concentrations were measured using different ELISA kits (R & D, USA) according to the instructions of the manufacturer. A microtiter plate was used for the experiment and the wells of this plate were coated with anti-PG I antibodies. Serum samples were then added to the wells and incubated at 4 ° C for 24 hours. The wells were washed with saline twine phosphate buffer. Human anti-IgG antibodies, conjugated with Horseradish peroxidase, were added and incubated at room temperature for 2 hours. Tetramethyl benzidine substrate was added to each well and the reaction was stopped with 0.5 M sulfuric acid. The plates were read at 450 nm and after drawing the standard curve, the PG I values were calculated.

2-6- Data Analysis Method:

All statistical calculations were performed using SPSS software (SPSS Inc, Chicago, IL, USA). Data were analysed using descriptive and inferential statistics. An Independent T-test was used to distribute the quantitative data. Data were entered into SPSS software and analysed using statistical tests. P values <0.05 were considered statistically significant.

3-1-patients

The characteristics of the study population were assessed based on upper gastrointestinal endoscopic findings, measurement of pepsinogen antibodies (PG), and gene analysis (BTG1). In this evaluation, 90 individuals were eligible for the study. The subjects were tried to have similar conditions in terms of demographic characteristics. 43 men and 47 women, aged between 29 and 65 years old. The basic characteristics of the study participants are presented in Table 1. To compare the number of men and women in the two groups, a chi-square test was performed. It was found that there is no significant difference between them (P = 0.935). In addition, a t-test was used to compare the age of individuals in the study groups (P = 0.147). As shown in Table 1, there is no significant difference between the age and sex of the study participants. Therefore, gender and age are not intervening factors in this study. Patients were divided into three groups, each of which included 30 patients: control, gastric atrophy, and gastric cancer.

Table 1

Descriptive data of individuals in different groups.
Variables		Gastric Cancer group (n = 30)	Gastric atrophy group (n = 30)	control group (n = 30)
H.pylori infection	Negative	9	8	14
H.pylori infection	Positive	21	22	16
Sex	Male	18	11	14
Sex	Female	12	19	16
Age(years)	> 29 year	6	8	7
	35–50 year	23	18	16
	> 50 year	4	3	5

Expression of malignant phenotype markers in different gastric diseases

3-2-evaluation Of Purity And Concentration Of Extracted Samples

In this study, the purity and concentration of the extracted RNA were measured using a nanodrop device (Bio Tek, America) and the RNA product was evaluated with 1% agarose gel. The results obtained from PicoDrop showed that the adsorption ratio at 260 and 280 nm and the adsorption ratio at 260 and 230 nm between the extraction samples are between 1.8 and 2 (Table 2). These results indicate that the extraction samples are free of protein and phenolic contaminants. The S28, 18S, and 5S bands on the 1% agarose gel indicate the high quality of the extraction process (Fig. 1). A picture of some RNA samples on gel electrophoresis as well as an example of nanodrop results are given in Table 2.

Table 2

Adsorption results for RNA extraction samples. * Indicates the ratio of light density in the wavelengths of 280/260 and 230/260, the ratios between 1.8 and 2 indicate the appropriate quality of RNA and free of protein and phenolic contamination.
Sample number	Density (ng/µl)	260*/280	260*/230
1	229	1.96	1.93
2	376	1.93	1.90
3	367	1.90	1.96
4	365	1.92	1.94

3-3- Check The Quality Of The Primer

In this study, different dilutions such as 1, 0.1, and 0.01 were prepared using cDNA and its standard curve was drawn to evaluate the quality of primers. The results of Efficiency and Slope of primers are shown in Table 3. Primer target genes were designed and regulated for exon-exon binding in mRNA sequences. Analysis of possible secondary structures in primer sequences showed that no disturbing secondary structures such as primer dimers, hairpin loops, and bulge rings could be formed under reaction conditions. The different sequences and properties of the designed primers are presented in Table 4. The standard curve gradient of PCR results for GAPDH, pG 1, and BTG1 genes was about − 3.3250, -3.4250, and − 3.5450, respectively. Efficiency was calculated as 2 and 1.95 for GAPDH/pG1 and GAPDH/BTG1, respectively. The results showed that the designed primers are of high quality. (Table 5)

Table 3

Results: Slope R2 and Efficiency primers based on 1, 0.1, and 0.01 dilutions of cDNA
R²	Efficiency	Slope	Amplicon Name
1	2	-3.3250	GAPDH
0.98	1.95	4250 3.-	PG1

Table 4

The lines and features of the designed primers.
mRNA name	Sequences	Product size (bp)	Tm C)°(	Accession number NCBI
GAPDH	5′- GTATCGTGGAAGGACTCATGAC − 3′ (forward)	136	61	>NM_014224.5
GAPDH	5′- GTAGAGGCAGGGATGATGTTC − 3′ (reverse)	136	61	>NM_014224.5
BTG1	5′- TGCTGGCAGAACATTATAAAC − 3′ (forward)	114	58	>NM_001079808.6
BTG1	5′-TGTGCTGCCTGTCCAATC -3′ (reverse)	114	58	>NM_001079808.6

Table 5

The results of primer quality assessment.
Amplicon Name	Slope	Efficiency	R2
GAPDH	-3.3250	2	1
BTG1	-3.4550	1.95	0.98

According to Kolmogorov – Smirnov statistical test, fold change values related to BTG1 and PG1 gene expression had an abnormal distribution. Accordingly, using Mann-Whitney U statistical test, changes in PG1 and BTG1 gene expression were compared. As shown in Fig. 2, the results showed that the expression of the PG1 gene in the cancerous tissue group was significantly lower compared to the control group (p < 0.001(. The expression BTG1 and PG1 is different in GC and atrophic tissues and adjacent tissues. The expression of BTG1 and PG1 is significantly reduced in GC and atrophic patients but is much higher in non-tumor tissues (Fig. 3). Figure 3 shows images of gastric adenocarcinoma and atrophic tissue. In general, BTG1, and PG1 expression were negative in GC and atrophy tissues, cancer adjacent tissues had higher BTG1 and PG1 expression, and atrophy and GC tissues had lower BTG1, and PG1 expression compared to adjacent noncancerous tissues (P = 0.023).

3-4- Pg Levels

Among the evaluated serological markers, the level of PG I was substantially different compared to other groups. PG I levels in the gastric cancer atrophy group were significantly lower than in the control group (P < 0.523). The PGI / PG II ratio was also decreased in the gastric cancer atrophy group (P < 0.001) (Table 6). However, no statistically significant difference in PGIl was observed between the two groups (p < 0.001) (Fig. 4‌).

Table 6

Data on serum PG levels in different groups
	Gastric cancer n p-value	Gastric atrophy n p-value	Control n p-value
PGl(µg/L)	30 0.0275	0.523 30	30 1.000
PGll(µg/L)	30 0.0903	30 0.5922	30 1.000
PGl/ll(µg/L)	30 0.0528	30 0.0462	30 1.000
Data are expressed as median PGpepsinogen

3-5- Results Of Changes In Serum Pg1 Protein Levels In The Study Groups

Serum PG1 levels were assessed in cancerous tissue and healthy tissue using the ELISA method. Forty samples, including 30 GC samples and 30 samples from healthy individuals, were examined. It was found that serum PG1 level was significantly lower in the cancerous tissue group than in the control group (p < 0.001). Serum level analysis was performed using statistical indicators such as mean and standard deviation (Fig. 5a). To compare the ratio of serum PG1 levels in the two groups, the distribution of data was analyzed using the Kolmogorov-Smirnov test. According to the characteristics of the results, parametric and non-parametric tests (Mann-Whitney and Student t-test) were used to examine them. According to the standard diagram (Fig. 5b), the amount of adsorption was converted to concentration.

GC is the third leading cause of cancer-related deaths in the world (26). However, the worldwide prevalence of this cancer is declining dramatically (18). The late diagnosis of GC is one of the leading factors behind its high mortality (14). Upon early diagnosis, the 5-year survival rate of this disease will exceed 90% (27). Early diagnosis and treatment are certainly among the most influential factors in the recovery and treatment of this disease. In this regard, an effective method of screening seems to be eminently required. (28) New, simple, and cost-effective diagnostic methods are preferred for the early diagnosis of GC. The method should be economically desired and less invasive for the early diagnosis of GC and precancerous lesions (29).

Due to the high prevalence of GC in almond eyes, the first nationwide screening was performed in Korea and Japan. People over the age of forty were tested (30). However, since the employed methods were aggressive and costly, researchers were always looking for new and non-invasive approaches (31). Ultimately, measuring the pepsinogen 1 and 2 concentration and their ratios for people with a family history was used to screen for gastric cancer on Matzu Island between Taiwan and China (32).

Pepsinogen is a chemical produced by the main cells and mucous cells of the neck of the gastric glands (33). Type I pepsinogen is produced by the nasal mucosa, while type II pepsinogen is secreted by both the nasal mucosa and the duodenum (34). Numerous studies have shown that serum pepsinogen levels indicate the precise function of the gastric mucosa (35). Using serum pepsinogen for GC screening is a more straightforward, easier, and more cost-effective method. This method is more desired than other methods, including endoscopy, which is inconvenient and costly for the patient (36).

The results of the present study showed that the expression of PG1 mRNA in gastric cancer tissue and its serum level is significantly lower in cancer patients compared to healthy individuals. In line with our results, Zhang et al. (2014) have shown that the serum PG1 levels are significantly lower in people with early-stage GC than in healthy individuals (37). The results of Zhang et al. also have shown that the serum level of PG1 in normal individuals is not significantly different from patients with non-inflammatory gastritis and inflammatory gastritis. However, this rate was significantly lower in people with duodenal ulcers (38). Song et al. have showed that PG1 levels are significantly lower in people with GC than in healthy people (39).

Moreover, they have shown that PG1 depletion is a good marker for the prediction of GC (39). Rafael et al. have also achieved similar results in Portugal (40). Like the present study, Petrof et al. have studied healthy individuals, nonspecific atrophic gastritis, specific atrophic gastritis, and patients with GC. However, pepsinogen1 levels were lower in cancer patients than in healthy individuals and nonspecific atrophic gastritis. (41).

Our results are consistent with recent research suggesting that BTG1 may be a tumor-inhibiting gene (42). Unregulated BTG1 is a favorable prognosis marker in ovarian cancer, breast cancer, thyroid cancer, esophageal cancer, throat cancer, and liver cell cancer (43, 44, 45). Sheng et al. (46) have shown that BTG1 expression is associated with inhibition of proliferation, increased autophagy, increased apoptosis, and worse prognosis in patients with GC. They also suggested that low BTG1 expression might increase gastric tumorigenesis (47). To confirm these results, muscle tissue was removed from the gastric mucosa to prevent muscle-related impurities of BTG1. To get rid of stromal or inflammatory cells, endoscopy was used to collect normal tissue, cancer cells, and atrophic cells. Our Real Time-PCR score for normal tissue, atrophy, and cancer cells provided similar data regarding the gastric tissue. It also was found that BTG1 mRNA and BTG1 protein expression were very low in atrophic and gastric cancer cells. These observations were consistent with studies evaluating lung, breast, liver, and ovarian cancers (48, 46, 49, 50, 51).

We found that the level of serum pepsinogen I in patients with gastric cancer was significantly lower than in the control group. Loss of specific cells and gastric glands is the characteristic of atrophic gastritis, which is considered a precursor lesion of GC (52). BTG1, Pepsin precursors and serum PG levels indicate the functional and morphological status of the gastric mucosa (53). It is important to note that certain variables, such as race, age, sex, and H. pylori infection, also influence PGI levels, while PG II levels are mostly constant and unchanged (54,55). Thus, a gradual decrease in the PGI / PG II ratio is closely related to the progression of atrophic gastritis (56). However, PG I can be considered a functional marker in clinical diagnosis (57). In fact, BTG1 and PG I reflect the physiological or pathophysiological functions of the gastric system (58, 27). Several studies have examined serum PG II levels as an independent biomarker with potential clinical applications (42). Higher expression of PG II has been shown in patients with gastric ulcers. PG II levels indicate chronic inflammation in chronic gastritis associated with Helicobacter pylori infection (59,60)

The obtained results showed that serum PG I levels are significantly reduced in patients with GC, suggesting that PG I can be used as an independent diagnostic marker for GC. PGI screening is cost-effective in countries with a high incidence of gastric cancer compared to the high cost of endoscopy (61). Further studies on the natural domains of BTG1 and PG I, and their changes in gastric diseases may shed light on their physiological and pathological functions. It can therefore be concluded that BTG1 and PG I can serve as an independent diagnostic markers for cancer. These observations may also indicate that decreased regulation of BTG1 may alter epithelial malignancy. Low expression of BTG1 may be used as a molecular target for future gene therapy strategies.

The results of our study for the expression of BTG1 and PG1 genes in GC tissue were concordant with the results of Ping et al. at the protein level. However, it could be claimed that the expression of BTG1 and PG1 is reduced at both mRNA and protein levels. It should be noted that only 1% of pepsinogen produced in the stomach enters the bloodstream (62). The mechanism underlying this decrease should be further elucidated.

PG and BTG1 could show good diagnostic performance for GC and could be exploited as a tool to screen this cancer for high-risk people with gastric atrophy. Although no studies have directly demonstrated that BTG1 and PG screening can reduce GC mortality, it seems a practical, effective, and valuable strategy to identify high-risk groups that require endoscopy. This new serum pepsinogen testing method could become a standard for the prevention of GC shortly.

Conflicts of interests: The authors declare that they have no conflict of interest.

Authors' contributions: All authors contributed to the study conception and design. Material preparation, data collection, and analysis were performed by all authors. All authors read and approved the final manuscript.

Funding: No funding was received for conducting this study.

Availability of data and material: Data sharing not applicable to this article as no datasets were generated or analysed during the current study.

Code availability: not applicable

Ethics approval: This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Dezful University of Medical Sciences.

Consent to participate: Informed consent was obtained from all individual participants included in the study. The ethics committee of Dezful University of Medical Sciences approved and supervised the conduction of this study under the ethics code of IR.DUMS.REC.1396.15.

Consent to participate: Informed consent was obtained from all individual participants included in the study.

Consent for publication: not applicable

Farmanfarma KK, Mahdavifar N, Mohammadian-Hafshejani A, Salehiniya H. Testicular cancer in the world: an epidemiological review. WCRJ. 2018;5(4):e1180. [Google Scholar]
Parkin DM. International variation. Oncogene. 2004;23:6329–40. [PubMed] [Google Scholar]
Sitarz R, Skierucha M, Mielko J, Offerhaus GJA, Maciejewski R, Polkowski WP. Gastric cancer: epidemiology, prevention, classification, and treatment. Cancer Manag Res. 2018;10:239–48.
Torre LA, Siegel RL, Ward EM, Jemal A. Global cancer incidence and mortality rates and trends—an update. Cancer Epidemiol Biomarkers Prev. 2016;25(1):16–27. doi:10.1158/1055-9965.EPI-15-0578 [PubMed] [CrossRef] [Google Scholar]
Dehdari T, Dehdari L, Jazayeri S. Diet-related stomach cancer behavior among iranian college students: a text messaging intervention. Asian Pac J Cancer Prev. 2016;17(12):5165–5172. [PMC free article] [PubMed] [Google Scholar].
Akhavan A, Binesh F, Seifaddiny A. Results of combination chemotherapy and radiation therapy in non-metastatic gastric cancer in Yazd–Iran. Indian J Cancer. 2015;52(1):40–43. doi:10.4103/0019-509X.175583 [PubMed] [CrossRef] [Google Scholar]
Merchant, S.J., Booth, C.M. ASO Author Reflections: Palliative Chemotherapy for Upper Gastrointestinal Cancer: Balancing Hope, Reality, Survival, and Symptoms. Ann Surg Oncol 28, 88–89 (2021). https://doi.org/10.1245/s10434-020-09295-8
Merchant, S.J., Kong, W., Brundage, M. et al. Symptom Evolution in Patients with Esophageal and Gastric Cancer Receiving Palliative Chemotherapy: A Population-Based Study. Ann Surg Oncol (2020). https://doi.org/10.1245/s10434-020-09289-6 Download citation
Orditura M, Galizia G, Sforza V, Gambardella V, Fabozzi A, Laterza MM, et al. Treatment of gastric cancer. World J Gastroenterol. 2014;20(7):1635.
Sierra, J.C., Piazuelo, M.B., Luis, P.B. et al. Spermine oxidase mediates Helicobacter pylori-induced gastric inflammation, DNA damage, and carcinogenic signaling. Oncogene 39, 4465–4474 (2020). https://doi.org/10.1038/s41388-020-1304-6
Prashanth, R., & Barsouk, A. (2019). Epidemiology of gastric cancer: global trends, risk factors and prevention. Przeglad Gastroenterologiczny., 14(1), 26–38. https://doi.org/10.5114/pg.2018.80001 CAS Article Google Schola
Van Cutsem E, Sagaert X, Topal B, Haustermans K, Prenen H. Gastric cancer. Lancet. 2016;388(10060):2654–64.
Zheng HC, Li J, Shen DF, Yang XF, Zhao S, Wu YZ, Takano Y, Sun HZ, Su RJ, Luo JS, Gou WF. BTG1 expression correlates with pathogenesis, aggressive behaviors and prognosis of gastric cancer: a potential target for gene therapy. Oncotarget. 2015;6:19685–19705. doi: 10.18632/oncotarget.4081.
Liu, N., Wu, Y., Cheng, W. et al. Identification of novel prognostic biomarkers by integrating multi-omics data in gastric cancer. BMC Cancer 21, 460 (2021). https://doi.org/10.1186/s12885-021-08210-y.
Kanda M, Oya H, Nomoto S, Takami H, Shimizu D, Hashimoto R, Sueoka S, Kobayashi D, Tanaka C, Yamada S, Fujii T, Nakayama G, Sugimoto H, Koike M, Fujiwara M, Kodera Y. Diversity of clinical implication of B-Cell translocation gene 1 expression by histopathologic and anatomic subtypes of gastric cancer. Dig Dis Sci. 2015;60:1256–1264.
Dinis-Ribeiro M, da Costa-Pereira A, Lopes C, Barbosa J, Guilherme M, MoreiraDias L, et al. Validity of serum pepsinogen I/II ratio for the diagnosis of gastric epithelial
Miki K, Urita Y. Using serum pepsinogens wisely in a clinical practice. J Dig Dis. 2007;8(1):8–14.
Samloff IM, Varis K, Ihamaki T, Siurala M, Rotter JI. Relationships among serum pepsinogen I, serum pepsinogen II, and gastric mucosal histology.A study in relatives of patients with pernicious anemia. Gastroenterology. 1982;83(1 Pt 2):204–9.
Graham DY, Nurgalieva ZZ, El-Zimaity HM, Opekun AR, Campos A, Guerrero L, et al. Noninvasive versus histologic detection of gastric atrophy in a Hispanic population in North America. Clin Gastroenterol Hepatol. 2006;4(3):306–14.
Correa P. Human gastric carcinogenesis: a multistep and multifactorial process–First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res. 1992;52(24):6735–40.
Hongzhang Shen, Kangwei Xiong, Xiangyu Wu, Sile Cheng, Qifeng Lou, Hangbin Jin, Xiaofeng Zhang, "The Diagnostic Value of Serum Gastrin-17 and Pepsinogen for Gastric Cancer Screening in Eastern China", Gastroenterology Research and Practice, vol. 2021, Article ID 6894248, 8 pages, 2021. https://doi.org/10.1155/2021/6894248
Mukoubayashi C, Yanaoka K, Ohata H, Arii K, Tamai H, Oka M, et al. Serum pepsinogen and gastric cancer screening. Intern Med. 2007;46(6):261–6.
Osumi H, Fujisaki J, Suganuma T, et al. A significant increase in the pepsinogen I/II ratio is a reliable biomarker for successful Helicobacter pylori eradication. PLoS One. 2017;12:e0183980.
Huang Y-k, Yu J-c, Kang W-m, Ma Z-q, Ye X, Tian S-b, et al. Significance of serum pepsinogens as a biomarker for gastric cancer and atrophic gastritis screening: a systematic review and meta-analysis. PloS one. 2015;10(11):e0142080.
Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. methods, 2001. 25(4): p. 402–408.
J. Ferlay, I. Soerjomataram, R. Dikshit et al., “Cancer incidence andmortality worldwide: sources, methods and majorpatterns in
D. Compare, A. Rocco, and G. Nardone, “Screening for and surveillance of gastric cancer,” World Journal of Gastroenterology, vol. 20, no. 38, pp. 13681–13691, 2014
Nie Y, Wu K, Yu J, Liang Q, Cai X, Shang Y, Zhou J, Pan K, Sun L, Fang J, et al: A global burden of gastric cancer: The major impact of China. Expert Rev Gastroenterol Hepatol. 11:651–661. 2017. View
Kim, Y., Yoon, H.J., Kim, JH. et al. Effect of histologic differences between biopsy and final resection on treatment outcomes in early gastric cancer. Surg Endosc 34, 5046–5054 (2020). https://doi.org/10.1007/s00464-019-07301-z
Chapelle N, Petryszyn P, Blin J, Leroy M, Tamara Matysiak ||| udnik (2020) A panel of stomach: specific biomarkers (gastropanel) for the diagnosis of atrophic gastritis: a prospective, multicenter study in a low gastric cancer incidence area. Helicobacter 25(5):2020
Kim N, Jung HC. The role of serum pepsinogen in the detection of gastric cancer. GUT LIVER. 2010;4(3):307.
Miki K. Gastric cancer screening by combined assay for serum anti-Helicobacter pylori IgG antibody and serum pepsinogen levels - “ABC method” Proc Jpn Acad Ser B Phys Biol Sci. 2011;87:405–414
Zhang, Xm., Li, Jx., Zhang, Gy. et al. The value of serum pepsinogen levels for the diagnosis of gastric diseases in Chinese Han people in midsouth China. BMC Gastroenterol 14, 9006 (2014). https://doi.org/10.1186/1471-230X-14-3
Samloff IM, Varis K, Ihamaki T, Siurala M, Rotter JI. Relationships among serum pepsinogen I, serum pepsinogen II, and gastric mucosal histology. A study in relatives of patients with pernicious anemia. Gastroenterology 1982; 83: 204–9.
Zhang, Xm., Li, Jx., Zhang, Gy. et al. The value of serum pepsinogen levels for the diagnosis of gastric diseases in Chinese Han people in midsouth China. BMC Gastroenterol 14, 9006 (2014). https://doi.org/10.1186/1471-230X-14-3
Junjun Xia, Zhenzhen Liu, Kaiguang Zhang, "Pepsinogen Serology and Gastritis OLGA Staging in Mucosal Atrophy Assessment: A Cross-Sectional Study Involving East China Endoscopy Population", Gastroenterology Research and Practice, vol. 2020, Article ID 2324505, 7 pages, 2020. https://doi.org/10.1155/2020/2324505
Tu, H, Sun, L, Dong, X, et al. A serological biopsy using five stomach-specific circulating biomarkers for gastric cancer risk assessment: a multi-phase study. Am J Gastroenterol 2017; 112: 704–715
Zhang X-m, Li J-x, Zhang G-y, Li X-h, Gu H. The value of serum pepsinogen levels for the diagnosis of gastric diseases in Chinese Han people in midsouth China. BMC Gastroenterol. 2014;14(1):9006.
Song HJ, Jang SJ, Yun S-C, Park YS, Kim M-J, Lee S-M, et al. Low levels of pepsinogen I and pepsinogen I/II ratio are valuable serologic markers for predicting extensive gastric corpus atrophy in patients undergoing endoscopic mucosectomy. GUT LIVER. 2010;4(4):475.
Lomba-Viana R, Dinis-Ribeiro M, Fonseca F, Vieira AS, Bento MJB, Lomba-Viana H. Serum pepsinogen test for early detection of gastric cancer in a European country. Eur J Gastroenterol. 2012;24(1):37–41.
Agkoc M, Dursun H, Albayrak F, Yilmaz O, Kiziltunc A, Yilmaz A, et al. Usefulness of serum pepsinogen levels as a screening test for atrophic gastritis and gastric cancer. Eurasian J Med. 2010;42(1):15
Xiu-qiong Chen, Fan-qiao Meng, Hua Xiong, Ya-li Wang, Wen-hua Tang, Yan-mei Zou, Identification of BTG1 Status in Solid Cancer for Future Researches Using a System Review and Meta-analysis, Current Medical Science, 10.1007/s11596-020-2150-z, 40, 1, (85–94), (2020).
Rouault, J.-P., et al., BTG1, a member of a new family of antiproliferative genes. The EMBO journal, 1992. 11(4): p. 1663–1670.
Winkler, G.S., The mammalian anti-proliferative BTG/Tob protein family. Journal of cellular physiology, 2010. 222(1): p. 66–72.
Zhu, R., et al., Upregulation of BTG1 enhances the radiation sensitivity of human breast cancer in vitro and in vivo. Oncology reports, 2015. 34(6): p. 3017–3024.
Kanda, M., et al., Diversity of clinical implication of B-cell translocation gene 1 expression by histopathologic and anatomic subtypes of gastric cancer. Digestive diseases and sciences, 2015. 60(5): p. 1256–1264.
Sheng, S., C. Zhao, and G. Sun, BTG1 expression correlates with the pathogenesis and progression of breast carcinomas. Tumor Biology, 2014. 35(4): p. 3317–3326.
Sun, G., et al., The expression of BTG1 is downregulated in NSCLC and possibly associated with tumor metastasis. Tumor Biology, 2014. 35(4): p. 2949–2957.
Lu, Y., et al., BTG1 expression in thyroid carcinoma: diagnostic indicator and prognostic marker. International journal of oncology, 2014. 45(4): p. 1574–1582.
Fock KM, Talley N, Moayyedi P, Hunt R, Azuma T, Sugano K, Xiao SD, Lam SK, Goh KL, Chiba T, et al. Asia-Pacific consensus guidelines on gastric cancer prevention. J Gastroenterol Hepatol. 2008;23:351–365. [PubMed] [Google Scholar]
Nasrollahzadeh D, Aghcheli K, Sotoudeh M, Shakeri R, Persson EC, Islami F, Kamangar F, Abnet CC, Boffetta P, Engstrand L, et al. Accuracy and cut-off values of pepsinogens I, II and gastrin 17 for diagnosis of gastric fundic atrophy: influence of gastritis. PLoS One. 2011;6:e26957. [PMC free article] [PubMed] [Google Scholar]
Pimanov SI, Makarenko EV, Voropaeva AV, Matveenko ME, Voropaev EV. Helicobacter pylori eradication improves gastric histology and decreases serum gastrin, pepsinogen I and pepsinogen II levels in patients with duodenal ulcer. J Gastroenterol Hepatol. 2008;23:1666–1671. [PubMed] [Google Scholar]
Ren JS, Kamangar F, Qiao YL, Taylor PR, Liang H, Dawsey SM, Liu B, Fan JH, Abnet CC. Serum pepsinogens and risk of gastric and oesophageal cancers in the General Population Nutrition Intervention Trial cohort. Gut. 2009;58:636–642. [PMC free article] [PubMed] [Google Scholar]
Kim HY, Kim N, Kang JM, Park YS, Lee DH, Kim YR, Kim JS, Jung HC, Song IS. Clinical meaning of pepsinogen test and Helicobacter pylori serology in the health check-up population in Korea. Eur J Gastroenterol Hepatol. 2009;21:606–612. [PubMed] [Google Scholar]
Di Mario F, Cavallaro LG, Moussa AM, Caruana P, Merli R, Maini A, Bertolini S, Dal Bó N, Rugge M, Cavestro GM, et al. Usefulness of serum pepsinogens in Helicobacter pylori chronic gastritis: relationship with inflammation, activity, and density of the bacterium. Dig Dis Sci. 2006;51:1791–1795. [PubMed] [Google Scholar]
Chung HW, Kim JW, Lee JH, Song SY, Chung JB, Kwon OH, Lim JB. Comparison of the validity of three biomarkers for gastric cancer screening: carcinoembryonic antigen, pepsinogens, and high sensitive C-reactive protein. J Clin Gastroenterol. 2009;43:19–26. [PubMed] [Google Scholar]
Zhang X, Xue L, Xing L, Wang J, Cui J, Mi J, Xing X, Wang J, Du Z, Misumi J, et al. Low serum pepsinogen I and pepsinogen I/II ratio and Helicobacter pylori infection are associated with increased risk of gastric cancer: 14-year follow up result in a rural Chinese community. Int J Cancer. 2012;130:1614–1619. [PubMed] [Google Scholar]
Smiraglia DJ, Rush LJ, Frühwald MC, Dai Z, Held WA, Costello JF, et al. Excessive CpG island hypermethylation in cancer cell lines versus primary human malignancies. Hum Mol Genet. 2001;10(13):1413–9.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Evaluation of the clinical significance of BTG1 gene expression and pepsinogen in serum and cancerous tissue and gastric atrophy

Status:

Version 1

Abstract

Figures

1- Introduction

2- Materials And Methods:

2-1-patients

2-2-sample Collection Via Endoscopy

2-3-RT-PCR

2-4- Rna Extraction And Polymerase Chain Reaction From Gastric Tissue

2-5- Serum Levels Of Pg I And Ii

2-6- Data Analysis Method:

3- Results

3-1-patients

3-2-evaluation Of Purity And Concentration Of Extracted Samples

3-3- Check The Quality Of The Primer

3-4- Pg Levels

3-5- Results Of Changes In Serum Pg1 Protein Levels In The Study Groups

4- Discussion

5- Conclusion

Declarations

References

Additional Declarations

Status:

Version 1