recO enhances resistance of Pasteurella multocida to fluoroquinolones

doi:10.21203/rs.3.rs-2452312/v1

Download PDF

Article

recO enhances resistance of Pasteurella multocida to fluoroquinolones

https://doi.org/10.21203/rs.3.rs-2452312/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Pasteurella multocida capsular type A (PmA) is one of the main pathogens causing bovine respiratory disease in China. The prevention and control measures against Pm are traditionally based on the use of broad-spectrum antibiotics. Previous studies found that Pm was prone to antibiotic resistance and tolerance mutation under the action of low concentrations of antibiotics, ultimately causing difficulties in prevention and control against Pm. In this study, highly pathogenic Pm fluoroquinolone-sensitive strain P3 and fluoroquinolone-resistant strain P32 induced by sub-inhibitory concentration of enrofloxacin were selected as research objects. RNA-seq was used to screen the differential gene recO of SOS response of P3 and P32 for functional verification. In addition, through MIC, MBC, induced resistance time, time-kill curve analysis and antibiotic tolerance test, the effect of recO gene on the resistance and tolerance of Pm to fluoroquinolone was clarified. At the same time, using fluorescent reporter vector, it was found that recO gene affected SOS repair response. In conclusion, the inhibition of recO gene can not only reduce their resistance to fluoroquinolone, but also prolong the formation time of fluoroquinolone resistance. It is speculated that recO gene is a potential target of fluoroquinolone synergistic antibacterial agent.

Biological sciences/Microbiology

Biological sciences/Molecular biology

SOS response

recO

fluoroquinolones resistance

antibiotic tolerance

Pasteurella multocida type A (PmA) is considered to be one of the main pathogens causing bovine respiratory disease. In recent years, the level of drug resistance has gradually increased and the drug resistance spectrum has also expanded. Previous studies found that clinically isolated bovine Pm type A had strong adaptability and could easily produce strong drug resistance to antibiotics (Kong et al., 2014). Finding new targets for the existing antimicrobials and developing efficient synergists combined with existing drugs are considered to be feasible strategies to slow down the virulence, drug resistance development, and spread of bacterial pathogens.

SOS response refers to the response mechanism initiated by bacteria when DNA replication is severely damaged to maintain genome integrity and improve the probability of cell survival (Rodgers and McVey, 2016). Relevant studies have shown that the recO protein in the SOS response pathway can participate in DNA repair and homologous recombination repair process through the RecFOR pathway. The RecFOR protein can replace single-stranded DNA (ssDNA)-binding protein and promote the production of the RecA–ssDNA complex to repair DNA fissure damage (Klitgaard et al., 2018). Some researchers have proposed that this process promotes and enhances the tolerance of bacteria to external ultraviolet and ionizing radiations. However, the effect of this process on the development of antimicrobial resistance and tolerance has not been reported.

A preliminary study on the isolated strain P3 revealed its pathogenicity and sensitivity to fluoroquinolone (FQ). The transcriptome analysis showed that recO and other SOS response genes were significantly upregulated during the development of antibiotic-resistant strain P32 under subinhibitory concentrations. It was speculated that strain P3 might participate in or mediate the development of resistance or tolerance to FQ (Kong et al., 2014).

A recO gene deletion mutant was constructed based on the strongly pathogenic Pm FQ-sensitive strain P3 and FQ-resistant strain P32, and a strong constitutive promoter complementary vector of Pasteurella multocida was constructed to supplement the recO gene of the deleted strain to confirm the function of recO in the development of FQ resistance of Pm. The mutation frequency of antibiotic-resistant bacteria in a mouse infection treatment model was analyzed by detecting the changes in drug resistance−related phenotype and SOS response, and the effect of the recO gene on the development of FQ resistance in Pm was speculated. In this study, we targeted the knockout of differentially expressed genes of Pm SOS and analyzed the changes in FQ resistance and tolerance-related phenotype before and after knockout so as to lay a foundation for the screening of Pm FQ antibacterial synergist targets.

Bacterial strains, plasmids, growth conditions, reagents and PCR primer

P. multocida type A strains P3 and P32 were obtained (Kong et al., 2014; Kong et al., 2016) and grown on a Brain Heart Infusion (BHI) agar medium (Sigma 70138) at 37℃. Plasmids pMD18-T and pUC18 (Ampr) were used for gene cloning and expression, and pRE112 (Cmrr) was used in the gene deletion system. Restriction endonucleases and related reagents were purchased from Beijing TransGen Biotechnology Co., Ltd. All the antibiotics used in this study were purchased from The Chinese Institute for Food and Drug Control. Polymerase chain reaction (PCR) primers designed and used in this study are shown in Table 1.

Table 1

Primers used in the experiment
Gene	Sequence(5’-3’)
M13	F: CGCCAGGGTTTTCCCAGTCACGAC R: AGCGGATAACAATTTCACACAGGA
Kmt1	F: ATCCGCTATTTACCCAGTGG R: GCTGTAAACGAACTCGCCAC
pRE112	F: GCGATGAGTGGCAGGGC R: TTACCGACTGCGGCCTGAGT
recO	P1: CGTCTAGACATTCTTTCTCCTCGTGA P2: CCATAGTTTCCTCAACTTTTGCTAAC P3: AAAGTTGAGGTAAACTATGGTATTACACTATAC P4: TAGAGCTCATGAAACCGCACGCTTA
∆recO	P1: CGTCTAGACATTCTTTCTCCTCGTGA P4: TAGAGCTCATGAAACCGCACGCTTA
recO-ORF	F: GTTATCGAAAATTGGCAACGG R: CAACATATATTGAGTAAATAATTCTCGGC
recO-C	F: CGAGCTCTTGAGGCAAGTTATCGAAAATTGG R: GCTCTAGACCATAGTTTATTTTTGATACAACATATATTGAGTA
PtpiA	F:ATGAATTCTTTCACTAAAACGAATACGATTCGTC AAAAAAGCCAAAGTGCGGTCAGGATTTTCCGA R:CTGCAGGTCGACGATATCTCTAGAGGATCCGGTAC CGAGCTCAATTTTCTCCGTATTAAAGTAATAA
TtpiA	F:GAGCTCGGTACCGGATCCTCTAGAGATATCGTCGAC CTGCAGTTGATTCGTCAATGTAAAAAGCAGA R:GCAAGCTTAGATTTTATTGCACGCGACATTCTACA GTATATTGGTCGAGATTCTGTGGGGTTCCCTAA
PtpiAT	F:ATGAATTCTTTCACTAAAACGAATACGATTCGTC AAAAAAGCCAAAGTGCGGTCAGGATTTTCCGA R:GCAAGCTTAGATTTTATTGCACGCGACATTCTAC AGTATATTGGTCGAGATTCTGTGGGGTTCCCTAA

Construction of recO-deficient and recO-deletion-repaired mutants

The upstream (P1, P2) and downstream (P3, P4) homologous arm sequences of recO gene were amplified by PCR with two pairs of primers. After being ligated by Overlap PCR, it was ligated with pRE112 suicide plasmid by double endonuclease digestion site to construct recombinant suicide plasmid. Finally, the recO-deficient strain was obtained. The pUC18-tpiA plasmid was introduced into two Pm strains with recO gene deletion by electroshock transformation, and the deletion-repaired strain was constructed. Plasmids used in this experiment shown in Table 2.

Table 2

Plasmids used in the experiment
Plasmids	Source
pMD18-T	Commercial cloning vector(TAKARA)
pRE112	Gene deletion vector(TAKARA)
pUC18	Modified clone vector(TAKARA)
pRE112-∆recO	recO gene deletion vector(The construction of this experiment)
pUC18-PtpiAT	TpiA promoter enhanced vector(The construction of this experiment)
pUC18-PtpiAT-recO	recO gene deletion-repaired vector(The construction of this experiment)

Reverse transcription-quantitative PCR(RT-qPCR)

Reverse transcription-quantitative PCR (RT-qPCR) was used to detect the relative expression of the recO gene in P3 and P32, recO-deficient strain and deletion-repaired strain, respectively. Briefly, total RNA was extracted using TRIzol reagent, and cDNA was synthesized by reverse transcription. The mRNA expression was analyzed using real-time fluorescence PCR (relative quantification) by the SYBR Green I method. A 16S rRNA was used as the housekeeping gene to standardize the expression levels. Data obtained from mRNA relative expression analysis were processed using the 2^−ΔΔCt method.

Morphological observation and Growth assays of strains

Gram staining was performed according to the requirements of the Solebo Gram stain kit. The color slides were dried at room temperature, and the morphology of bacteria was observed under a 100× oil immersion microscope. The overnight culture of 2 mL was inoculated in a BHI broth medium at 37℃, and a 50µL sample was used to determine OD₆₀₀ with a UV spectrophotometer after every 2h. The average value was measured three times, and the growth curve was drawn.

Ethics Statement

All of the experimental procedures with mice were performed at the Experimental Animal Center under protocol number JLAU20210423001. The experiments were conducted under the supervision of the Experimental Animal Welfare and Ethics Committee of Jilin Agricultural University. Confirms that the complied with the ARRIVE guidelines. All methods were performed in accordance with the relevant guidelines and regulations.

Determination of pathogenicity

SPF mice (purchased from the Animal Center of Jilin University) were used as model animals to determine the LD₅₀ for each strain. A total of 200 mice were randomly divided into 10 groups, five concentration gradients were set(1×10⁶-1×10¹⁴,), and the mice were infected by intraperitoneal injection. The mice were observed for 48 hours, and the results of bacterial pathogenicity were statistically analyzed. The LD₅₀ of each strain was calculated by Bliss (Headley et al., 2018) method using GraphPad Prism software.

Biofilm formation assays

A 200 µL of the strains with the OD₆₀₀ of 0.4–0.6 were added to a 96-well plate, each sample was repeated 6 times, and BHI broth medium was added as the negative control. After incubation at 37^oC for 24 h, the culture medium was discarded and the samples were washed with PBS four times. Then, the samples were fixed with formaldehyde for 25 min, and the medium was discarded again. Crystal violet dye was added for 25 min, and the absorbance was measured at 595 nm.

Determination of MIC and MBC of each strain

Four FQs (CIP, ENR, NOR, and LVX) were selected, and MIC and MBC were determined by the microdilution method as described by Kong et al. (Kong et al., 2014; Kong et al., 2016). Each strain was repeated three times for different drugs, and the repeated results were judged. The judging criteria referred to the clinical turning point of FQ resistance stipulated by the American Association for Clinical and Laboratory Standards Institute (CLSI).

Determination of formation time and Time-kill curve of drug resistance induced by each strain under sub-MIC of ENR

A 5 mL BHI broth containing ½ MIC ENR with 1% inoculum was shaken at 37℃ for 12 h each time. In the case of bacterial growth, a 50 µL aliquot was taken out and inoculated in a BHI broth with MIC and cultured at 37℃ for 12 h. In the case of no growth, the previous generation was selected for further cultivation, and the record algebra was increased by one generation until the level of drug resistance was above the clinical drug resistance tipping point of CLSI (2 µg/mL).

The culture algebra of each change in drug resistance level was recorded, which was the development time of FQ-induced drug resistance. After OD₆₀₀ = 0.5, 1% inoculum was added to 10 mL broth medium containing enrofloxacin with 10×MIC. Each strain was taken out at the rate of 100 µL/h to be counted by the dilution and coating plate method, cultured overnight, and counted the next day. The colonies of multiple plates were counted, and the average value was taken to draw the time-kill curve.

Detection of tolerance of strains to ENR

A total of 10⁶ CFU/mL bacteria were extracted, then ENR with a final concentration of 10 × MIC was added to the broth, and 0.5 mL culture was added to each culture tube. Then, 200 µL of culture medium was taken out every 1 hour and added to the 96-well plate for 4 hours, continuously diluted to 10^− 5. The diluted bacterial solution was inoculated on a BHI agar plate with the multi-point inoculation instrument and cultured overnight. The colony growth was observed, and the results were recorded the next day.

Evaluation of therapeutic effect of ENR on infection model in vivo

The method using the mouse infection model was the same as that of LD₅₀ determination, and the challenge dose was 1/10 LD₅₀. All the mice were euthanized after the administration, The method of euthanasia refers to “VMA Guidelines for the Euthanasia of Animals (2020)”, all mice were euthanized by cervical dislocation by skilled personnel. The death was recorded, and the histopathological sectioning and HE staining of the lungs were performed. A successful mouse infection model was established to determine the formation frequency of antibiotic-resistant bacteria. The treatment concentrations were 1/2 MIC, 1 MIC, and 4 MIC. The control group was injected with normal saline. The mice were euthanized after 24 h, 48 h, and 72 h, and the lungs were collected. After grinding, the tissue homogenate was coated on BHI agar, and the same amount of diluent was coated on BHI agar with ENR concentration of 2 µg/ml. The amount of bacteria in tissues and the number of drug-resistant bacteria were measured the next day.

Detection of SOS related gene expression and SOS activity

RT-PCR was used to detect the relative expression of SOS related genes (recA, recC and dnaG) in WT, deletion strain and complementary strain. Based on pUC-18 vector, a fluorescent reporter vector pUC18-recA-eGFP containing GFP was constructed by using primers in Table1. The change of bacterial SOS activity was detected by detecting the change of recA gene. The constructed plasmid map is shown in Fig. 8. The pUC18-recA-eGFP plasmid was transformed into P3 and O3 strains by electric shock, and the bacteria were cultured overnight. 1% of the inoculum was inoculated in the BHI liquid medium containing enrofloxacin with the final concentration of 1/2 MIC, and cultured at 37 ℃. The 200 µl solution was taken from each 30 min, and the bacteria were collected after centrifugation. The fluorescence signal was detected by fluorescence enzyme meter, and the Relative Fluorescence Unit (RFU) was calculated.

Statistical analysis

Wilcoxon rank-sum tests were performed by using GraphPad Prism (version 9.0, USA) and expressed as the mean ± SEM to determine statistical significance. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Construction of recO-deficient and recO-deletion-repaired mutants

The product amplified using overlapping PCR was ligated to the pMD18-T vector to obtain the recombinant plasmid pMD18-T-ΔrecO. Then, double restriction endonuclease digestion was performed with the pRE112 suicide plasmid. Connecting with T4 ligase, suicide plasmid pRE112-∆recO was constructed for homologous recombination with Pm. Pm capsule-specific primers (Kmt1-F and Kmt1-R) and capsule ∆recO primers (recO-P1 and recO-P4) were used for simultaneous identification. The positive result of homologous recombinant bacteria was that Kmt1 primers could amplify 457 bp fragments of the expected size (Fig. 1A). The target fragment with the deletion of the 711 bp recO gene compared with the positive genome (2 626 bp) was amplified using the primer ∆recO (Fig. 1B). It was proved that the deletion strains O3 (P3-∆recO) and O32 (P32-∆recO) of P3 and P32 were successfully constructed. The pUC18-PtpiAT-recO gene complementary vector was transferred to Pm recO gene–deleted strains O3 and O32 by electroshock transformation. The gene complementary strains C3 (O3-recO) and C32 (O32-recO) were obtained.

Verification of recO gene expression by RT-qPCR

RT-qPCR was used to detect the recO gene expression of P3, P32, O3, O32, C3, and C32 to further clarify the deletion of the Pm recO gene and the expression of the recO gene after supplementation (Fig. 1C). Compared with P3 and P32, the relative expression of the recO gene of O3 and O32 decreased significantly and approached to 0 infinitely. The relative expression of the recO gene of C3 and C32 increased significantly (P < 0.01), but it was slightly lower than that of P3 and P32 (P > 0.05). The relative expression of the recO gene between P3 and C3 was not significant (P > 0.05). So far, the recO-deletion strain and recO-deletion-repaired strain were constructed successfully.

recO changes strain morphology and growth rate

Some differences were observed in cell morphology between P3 and P32 strains. The P3 was two-stage strongly stained Brevibacterium, but the morphology of P32 was relatively long (Fig. 2A-2F). At the same time, the deletion and deletion-repaired recO gene did not affect this difference. The results of the growth curve showed some differences in the growth rates of P3 and P32. The growth of P32 decreased relatively, but the time when the growth curve reached the plateau was significantly prolonged; also, the overall bacterial density increased significantly. The deletion of the recO gene weakened this effect slightly, but did not completely change the growth characteristics of P3 and P32. The growth characteristics of C3 and C32 were similar to those of P3 and P32 (Fig. 2G).

Effect of recO on the bofilm formation ability and virulence

The deletion and deletion-repaired recO genes did not affect the biofilm formation ability of Pm (Fig. 3), but a significant difference in biofilm formation ability was observed between sensitive and resistant strains. The test results of LD₅₀ are shown in Table 3. We found that the deletion of recO led to a slight increase in LD₅₀, but the confidence interval was in a similar range, indicating no significant change in the virulence level (P > 0.05).

Table 3

LD₅₀ of P3, P32 and *recO* gene deletions in mice
Strain	LD50 (CFU/mL)	95% confidence limit
Strain	LD50 (CFU/mL)	Upper limit	Lower limit
P3	2.297×108	6.048×107	7.695×108
O3	6.624×107	1.697×107	2.426×108
P32	1.166×1013	2.255×1012	9.655×1013
O32	2.716×1013	5.435×1012	2.169×1014

Effect of recO on bactericidal ability of FQ

Four FQ antibiotics (CIP, ENR, NOR, and LVX) commonly used in clinical practice were selected for determining MIC and MBC of P3, P32, O3, and O32 by the broth dilution method. No difference was observed in MIC test results of the four FQs against P3, P32, O3, and O32 strains (Table 4). However, the MBC decreased two times (Table 5).

Table 4

MIC of quinolones against P3, P32 and *recO* gene deletion strains
Strain	CIP(µg/mL)	ENR(µg/mL)	NOR(µg/mL)	LVX(µg/mL)
P3	0.25	0.25	0.25	0.25
O3	0.25	0.25	0.25	0.25
P32	64	64	64	64
O32	64	64	64	64
ATCC 25922	< 0.03	< 0.03	< 0.03	< 0.03
CIP: ciprofloxacin; ENR: enrofloxacin; NOR: Norfloxacin; LVX: Levofloxacin; ATCC 25922: Drug sensitive quality control strain

Table 5

MBC of quinolones against P3, P32 and *recO* gene deletion strains
Strain	CIP(µg/mL)	ENR(µg/mL)	NOR(µg/mL)	LVX(µg/mL)
P3	0.5	0.5	0.5	0.5
O3	0.25	0.25	0.25	0.25
P32	128	128	128	128
O32	64	64	64	64
CIP: ciprofloxacin; ENR: enrofloxacin; NOR: Norfloxacin; LVX: Levofloxacin; ATCC 25922: Drug sensitive quality control strain

recO affects the development time of drug resistance and prolongs the sterilization time of ENR

Under continuous induction with subinhibitory concentrations (1/2 MIC) in vitro, the drug resistance of bovine Pm gradually increased. Strain P3 could survive normally in 4 µg/mL ENR after continuous culture to the ninth generation. Compared with strain P3, the development time of induced drug resistance in strain O3 was effectively prolonged. The strain O3 could not reach the same level of drug resistance as the strain P3 cultured to the 9th generation after continuous culture with a subinhibitory concentration of ENR to the 12th generation (Fig. 4A). Under the action of ENR at MIC, strain P3 achieved a lower level of resistance within 6 h (10–100 CFU/mL). The deletion of the recO gene significantly enhanced the killing of the strain by ENR (P < 0.05). The germicidal efficacy of ENR at the concentration of P32 MIC was weakened, and the killing was slightly enhanced after the deletion of recO (Fig. 4B).

recO can increase the tolerance to ENR

The tolerance of P3, P32, O3, and O32 to ENR was determined according to the ENR time-kill curve (Fig. 5). Compared with P3, the tolerance of O3 to ENR was obviously reduced. The weakening level was about 10 times after 2 to 3 h treatment, and the weakening level at 4 h was about 10–100× (P < 0.05). For P32, the change in the tolerance of O32 was relatively insignificant (P > 0.05).

recO can enhance virulence but effectively reduce the formation frequency of antibiotic resistant bacteria

Different degrees of death occurred in P3- and O3-infected mice during the establishment of the infection model. The virulence in the P3 group was relatively weak. The 96-h survival rate of P3- and O3-infected mice was 93.36% and 89.03%, respectively (Fig. 6A). Under the condition of in vivo treatment, developing antibiotic-resistant bacteria under the action of 1/2× MIC (0.125 mg/kg) and 1× MIC (0. 25 mg/kg) dose ENR was easier (Fig. 6B). At the same time, the formation frequency of O3-resistant bacteria was relatively lower compared with P3.

The deletion of recO gene decreased the SOS reaction activity of bacteria under the action of ENR.

The relative expressions of recO, recA, recC and dnaG in fluoroquinolone-sensitive strain P3 were significantly down-regulated compared with that in fluoroquinolone-resistant strain P32 without treatment. However, the recA, recC and dnaG genes of fluoroquinolone-sensitive strain P3 and drug-resistant strain P32 were up-regulated significantly after the addition of enrofloxacin at sub-inhibitory concentration, while the expression of recO gene did not change significantly before and after the induction of P3 (P3-1), but P32 (P32-1) was up-regulated significantly after the induction of enrofloxacin at sub-inhibitory concentration(Fig. 7A-7D).After adding inducer (ENR) for 60 min, SOS fluorescence reporting activity of O3 began to decrease significantly, and this decrease effect gradually increased with the extension of induction time(Fig. 7E).

Bovine Pm type A is one of the main bacterial pathogens causing bovine respiratory disease (BRD) in China. Since it was first discovered and reported in 2008, its abundance has gradually increased with the expansion of aquaculture to reduce long-distance transportation costs. However, the implementation of nonresistant aquaculture has become the mainstream trend to save costs. In addition to the normal feeding management, the main approach for ordinary farmers to deal with BRD is still the use of broad-spectrum, long-acting antibiotics (Theurer et al., 2021). The long-term unreasonable abuse of antibiotics in aquaculture and related fields increases the adaptability of BRD pathogens and leads to the development of drug resistance. It also affects the survival status of other bacteria in the culture environment, resulting in the horizontal transmission of drug resistance (Satoh et al., 2012). Previous studies of our research group found that the long-term use of cephalosporins, FQ, and macrolides, which are effective in treating Pm infections in farms, can lead to relapse after the effective control of BRD. Under the action of sub-bacteriostatic concentrations of FQ and macrolides for a long time in vitro, Pm can easily develop antibiotic resistance. The isolated PmFQ-sensitive strain P3 and its artificially induced high-level drug-resistant strain P32 were analyzed. The results showed that the expression of the recO gene was significantly upregulated during the formation of FQ-resistant bacteria (Kong et al., 2014).

Several recent studies showed a certain correlation between the bacterial SOS response system and FQ resistance or tolerance (Recacha et al., 2017). The research on the SOS response pathway mainly focused on Escherichia coli. In recent years, the function of the SOS response system in the development of drug resistance was verified by E. coli isolates with the deletion of the key gene recA of the SOS pathway or artificial mutation repressor gene LexA combined with different levels of FQ resistance (Theodore et al., 2013; Rodríguez-Rosado et al., 2019). However, the relationship between the recO gene and FQ resistance was not found.

Therefore, the recO gene deletion strains O3 and O32 of bovine type A PmFQ-sensitive strain P3 and drug-resistant strain P32 were constructed by a homologous recombination strategy mediated by the pRE112 suicide plasmid. At the beginning of the experiment, suicide plasmid construction strategy, conjugation transfer, and homologous recombination screening were mainly carried out as described by Zhang et al. (Zhang et al., 2020). However, it was found that the influence of conjugation transfer efficiency could not realize the successful transformation of Pm by the suicide plasmid. The solutions to this issue include changing the level of resistance, increasing the ratio of recipient cells, and prolonging the culture time appropriately. In addition, many studies reported that the homologous recombination of Pm by the suicide plasmid could be completed by electroshock transformation (San Millan et al., 2009; Nazierbieke et al., 2013). Attempts were made in the course of the study, but without success. However, the established electroporation transformation system was successfully used in the construction of the recO gene deletion-repaired strain.

The relative expression of the Pm recO gene in each strain before and after deletion and supplementation was detected. The results showed that the relative expression level of the recO gene in the deletion strain decreased significantly, while the relative expression level of the recO gene in the supplement strain increased significantly. Thus, the Pm recO gene deletion strain and deletion-repaired strain were successfully constructed. However, the relative expression level of the recO gene in the recO gene deletion-repaired strain was still at a relatively low level compared with that in the original Pm strain. It was thought to be related to the relatively reduced ability of Pm to express the foreign plasmid. The Gram staining, growth curve, biofilm-forming ability, and phenotypic experiments related to basic growth characteristics such as LD₅₀ were used to identify the Pm gene deletion strain and deletion-repaired strain. The results showed that the deletion of the recO gene had no significant effect on the phenotype related to the basic growth characteristics of Pm. However, related studies found that the recO gene played an important role in the response of radiation-resistant cocci to extreme radiation. After the deletion of the recO gene, the growth of radiation-resistant cocci slowed down significantly, and their resistance to ultraviolet and γ-rays was weakened (Devigne et al., 2015).

The phenotypic changes related to the fluoroquinolone resistance of Pm induced by enrofloxacin with recO gene deletion were verified by differential gene recO screening from PmFQ-sensitive and drug-resistant strains induced by the subinhibitory concentrations of enrofloxacin. The results showed that the deletion of the recO gene did not affect the MIC of FQ on Pm but decreased the MBC of FQ on Pm two times. Therefore, we speculated that the recO gene could affect the tolerance of Pm to FQ, which was confirmed by subinhibitory concentration–induced drug resistance test, minimum inhibitory concentration time-kill curve test, and tolerance test. In exploring the molecular function of recO, researchers also found that recO could mediate the resistance of E. coli, radiation-resistant cocci, and other strains to the changes in the culture environment (Devigne et al., 2015; Prada Medina et al., 2016; Ithurbide et al., 2020). The results of this study also provided evidence for the involvement of the recO gene in the process of bacterial antibiotic tolerance. Many studies confirmed that the deletion of the recO gene could lead to FQ resistance in bacteria (Recacha et al., 2017; Ortiz-Padilla et al., 2020; Machuca et al., 2021). The literature reported that the deletion of the recO molecule affected the level of FQ resistance in Pm. However, in this experiment, recO gene deletion did not have a significant effect on FQ MIC. At the same time, the reduction of tolerance-related phenotypic indexes after artificially induced recO gene deletion in antibiotic-resistant strain P32 was limited. Therefore, we speculated that the mechanism of fluoroquinolone resistance in Pm might not be fully explained by the spontaneous mutation of the FQ resistance target caused by SOS. The phenotypic drug tolerance mediated by recO and other genes also improved the survival rate of Pm under stress to some extent. Furthermore, the SOS response was activated by low levels of FQ in the culture environment, and other SOS-related genes mediated the development of drug resistance mutations.

Through establishing the Pm mouse infection and fluoroquinolone treatment model, it was found that recO-deletion strain O3 induced a stronger inflammatory response in the lungs of mice, combined with its slightly increased LD₅₀ test results. We speculated that the gene deletion of recO not only reduced the level of tolerance but also caused a partial increase in virulence. Relevant studies pointed out that the acquisition of drug resistance often reduced the adaptability of antibiotic-resistant bacteria (Björkman et al., 1998; Kapil and Sharma, 2021). The adaptive compensation mechanism often occurred in antibiotic-resistant mutants, which was consistent with the significant decrease in LD₅₀ in P32 strains during the development of drug resistance. The results of the development frequency of antibiotic-resistant bacteria in vivo showed that the gene deletion of recO reduced the development frequency of FQ-resistant bacteria to a certain extent.

The most effective way to inhibit the development of bacterial antibiotic resistance is still to use antibiotics reasonably according to the recommended concentration. Because FQs are concentration-dependent and broad-spectrum fungicides, choosing appropriate antibiotic concentration and administration scheme is helpful to control bacterial diseases. The development of recO gene inhibitors may be an effective strategy to slow down the development of antibiotic resistance of PmA.

Author contributions

L-C K and H-X M contributed to the conception of the study. X-S L, J-Z X, and R-G H contributed significantly to analysis and manuscript preparation, Y Q and Inam performed the data analyses and wrote the manuscript. Y-H G and T-L W helped in performing the analysis with constructive discussions. All authors contributed to the article have approved the submitted version.

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article.

Competing Interests Statement

The authors declare no conflicts of interest.

Funding

This work was supported by the Jilin Provincial Department of Science and Technology key Science and Technology projects [20160204002NY] , the Natural Science Foundation of JilinProvince [20190201294JC] and the Natural Science Foundation of China（31902310）.

Björkman, J., Hughes, D., Andersson, D., 1998. Virulence of antibiotic-resistant Salmonella typhimurium. Proceedings of the National Academy of Sciences of the United States of America 95, 3949-3953.
Devigne, A., Ithurbide, S., Bouthier de la Tour, C., Passot, F., Mathieu, M., Sommer, S., Servant, P., 2015. DdrO is an essential protein that regulates the radiation desiccation response and the apoptotic-like cell death in the radioresistant Deinococcus radiodurans bacterium. Molecular microbiology 96, 1069-1084.
Headley, S., Okano, W., Balbo, L., Marcasso, R., Oliveira, T., Alfieri, A., Negri Filho, L., Michelazzo, M., Rodrigues, S., Baptista, A., Saut, J., Alfieri, A., 2018. Molecular survey of infectious agents associated with bovine respiratory disease in a beef cattle feedlot in southern Brazil. Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 30, 249-251.
Ithurbide, S., Coste, G., Lisboa, J., Eugénie, N., Bentchikou, E., Bouthier de la Tour, C., Liger, D., Confalonieri, F., Sommer, S., Quevillon-Cheruel, S., Servant, P., 2020. Deinococcus radioduransNatural Transformation in : A Genetic Analysis Reveals the Major Roles of DprA, DdrB, RecA, RecF, and RecO Proteins. Frontiers in microbiology 11, 1253.
Kapil, S., Sharma, V., 2021. d-Amino acids in antimicrobial peptides: a potential approach to treat and combat antimicrobial resistance. Canadian journal of microbiology 67, 119-137.
Klitgaard, R., Jana, B., Guardabassi, L., Nielsen, K., Løbner-Olesen, A., 2018. E. coliDNA Damage Repair and Drug Efflux as Potential Targets for Reversing Low or Intermediate Ciprofloxacin Resistance in K-12. Frontiers in microbiology 9, 1438.
Kong, L., Gao, D., Gao, Y., Liu, S., Ma, H., 2014. Fluoroquinolone resistance mechanism of clinical isolates and selected mutants of Pasteurella multocida from bovine respiratory disease in China. The Journal of veterinary medical science 76, 1655-1657.
Kong, L., Gao, D., Jia, B., Wang, Z., Gao, Y., Pei, Z., Liu, S., Xin, J., Ma, H., 2016. Antimicrobial susceptibility and molecular characterization of macrolide resistance of Mycoplasma bovis isolates from multiple provinces in China. The Journal of veterinary medical science 78, 293-296.
Machuca, J., Recacha, E., Gallego-Mesa, B., Diaz-Diaz, S., Rojas-Granado, G., García-Duque, A., Docobo-Pérez, F., Blázquez, J., Rodríguez-Rojas, A., Pascual, A., Rodríguez-Martínez, J., 2021. Effect of RecA inactivation on quinolone susceptibility and the evolution of resistance in clinical isolates of Escherichia coli. The Journal of antimicrobial chemotherapy 76, 338-344.
Nazierbieke, W., Zhang, Y., Gong, F., Takuo, S., Borrathybay, E., 2013. Construction and characterization of ompH gene knockout mutant of avian Pasteurella multocida C48-3. Acta microbiologica Sinica 53, 66-73.
Ortiz-Padilla, M., Diaz-Diaz, S., Machuca, J., Tejada-Gonzalez, A., Recacha, E., Docobo-Pérez, F., Pascual, A., Rodríguez-Martínez, J., 2020. Role of low-level quinolone resistance in generating tolerance in Escherichia coli under therapeutic concentrations of ciprofloxacin. The Journal of antimicrobial chemotherapy 75, 2124-2132.
Prada Medina, C., Aristizabal Tessmer, E., Quintero Ruiz, N., Serment-Guerrero, J., Fuentes, J., 2016. Survival and SOS response induction in ultraviolet B irradiated Escherichia coli cells with defective repair mechanisms. International journal of radiation biology 92, 321-328.
Recacha, E., Machuca, J., Díaz de Alba, P., Ramos-Güelfo, M., Docobo-Pérez, F., Rodriguez-Beltrán, J., Blázquez, J., Pascual, A., Rodríguez-Martínez, J., 2017. Quinolone Resistance Reversion by Targeting the SOS Response. mBio 8.
Rodgers, K., McVey, M., 2016. Error-Prone Repair of DNA Double-Strand Breaks. Journal of cellular physiology 231, 15-24.
Rodríguez-Rosado, A., Valencia, E., Rodríguez-Rojas, A., Costas, C., Galhardo, R., Rodríguez-Beltrán, J., Blázquez, J., 2019. N-acetylcysteine blocks SOS induction and mutagenesis produced by fluoroquinolones in Escherichia coli. The Journal of antimicrobial chemotherapy 74, 2188-2196.
San Millan, A., Escudero, J., Gutierrez, B., Hidalgo, L., Garcia, N., Llagostera, M., Dominguez, L., Gonzalez-Zorn, B., 2009. Multiresistance in Pasteurella multocida is mediated by coexistence of small plasmids. Antimicrobial agents and chemotherapy 53, 3399-3404.
Satoh, K., Kikuchi, M., Ishaque, A., Ohba, H., Yamada, M., Tejima, K., Onodera, T., Narumi, I., 2012. The role of Deinococcus radiodurans RecFOR proteins in homologous recombination. DNA repair 11, 410-418.
Theodore, A., Lewis, K., Vulic, M., 2013. Tolerance of Escherichia coli to fluoroquinolone antibiotics depends on specific components of the SOS response pathway. Genetics 195, 1265-1276.
Theurer, M., Fox, J., McCarty, T., McCollum, R., Jones, T., Simpson, J., Martin, T., 2021. Evaluation of the reticulorumen pH throughout the feeding period for beef feedlot steers maintained in a commercial feedlot and its association with liver abscesses. Journal of the American Veterinary Medical Association 259, 899-908.
Zhang, H., Kang, Y., Kong, L., Ju, A., Wang, Y., Muhammad, I., Zhang, D., Qian, A., Shan, X., Ma, H., 2020. Functional analysis of hisJ in Aeromonas veronii reveals a key role in virulence. Annals of the New York Academy of Sciences 1465, 146-160.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

recO enhances resistance of Pasteurella multocida to fluoroquinolones

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Bacterial strains, plasmids, growth conditions, reagents and PCR primer

Reverse transcription-quantitative PCR(RT-qPCR)

Morphological observation and Growth assays of strains

Ethics Statement

Determination of pathogenicity

Biofilm formation assays

Determination of MIC and MBC of each strain

Detection of tolerance of strains to ENR

Detection of SOS related gene expression and SOS activity

Statistical analysis

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1