PCSK9 inhibitor cooperatively with high triglyceride induces adverse pregnancy outcomes by impairing mitochondrial function

doi:10.21203/rs.3.rs-2453552/v1

Download PDF

Research Article

PCSK9 inhibitor cooperatively with high triglyceride induces adverse pregnancy outcomes by impairing mitochondrial function

https://doi.org/10.21203/rs.3.rs-2453552/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The two monoclonal antibodies targeting proprotein convertase subtilisin/kexin type 9 (PCSK9), namely evolocumab and alirocumab, were first approved by the U.S. Food and Drug Administration (FDA) in 2015. PCSK9 inhibitor (PCSK9i) has served as a viable new therapeutic option to lower cholesterol levels and associated cardiovascular events. However, a better understanding of safety issue of PCSK9i is necessarily needed. We present here an increased risk of adverse pregnancy outcomes, including stillbirths and embryonic defects, particularly neural tube defects, following PCSK9i treatment harnessing a high-fat diet-based mouse model. Proteomics of PCSK9i-treated neural stem cells uncovered that PCSK9i may disrupt mitochondrial function via succinic dehydrogenase complex subunit A (SDHA), which is a key enzyme in the mitochondrial respiratory chain. Furthermore, PCSK9i-induced SDHA deficiency combines with high triglyceride to drive the production of reactive oxygen species and subsequent apoptosis during embryonic development, which may account for the occurrence of adverse pregnancy outcomes. Our findings reveal the existence of a hitherto unknown risk of PCSK9i in pregnant women, as well as novel gene-environment interaction.

PCSK9 inhibitor

adverse pregnancy outcomes

neural tube defects

high triglyceride

mitochondrial dysfunction

Hypercholesterolaemia is an important risk factor for atherosclerosis and a leading cause of cardiovascular disease (CVD) (1). Since proprotein convertase subtilisin/kexin type 9 (PCSK9) was first discovered in 2003 (2), it has attracted widespread attention for its clinical relevance to hypercholesterolaemia and associated CVD (3). PCSK9 downregulates low-density lipoprotein receptor (LDLR) by binding and directing to the lysosome for degradation. Accordingly, PCSK9 inhibition contributes to increased LDLR density, thereby decreasing circulating levels of low-density lipoprotein cholesterol (LDL-C) (4).

In the last decade, the development of PCSK9 inhibitors (PCSK9i) has progressed rapidly, especially following the first two monoclonal antibodies targeting PCSK9, namely evolocumab and alirocumab, being approved by the U.S. Food and Drug Administration (FDA) in mid-2015 (5, 6). Currently, PCSK9i could be a valuable new therapeutic option for patients with familial hypercholesterolaemia, statin intolerance, or those at high-risk of atherosclerotic CVD, due to reducing serum LDL-C levels by 50–60% (7, 8). PCSK9i has been recently approved by the European Medicines Agency, Health Canada and China National Medical Products Administration to reduce cardiovascular events in patients with established atherosclerotic CVD (9). However, it is virtually a given that when a new medicine is introduced to the market, the list of potential adverse effects is often not exhaustive. Some studies have reported an increased rate of adverse neurocognitive, plaque progression, and ophthalmologic events associated with the use of PCSK9i compared with a placebo (6, 10, 11). Considering the novel nature of PCSK9i, it is likely that the full array of adverse effects is yet to be uncovered, thus early detection of such safety issues can aid in their prevention.

PCSK9 is a useful biomarker of human neural tube defects (NTDs) as reported in our previous study (12). NTDs, which occur following failure of neural tube closure during the fourth week of embryonic development, are among the most common and devastating congenital anomalies of the central nervous system (13). Typical NTDs include spina bifida, anencephaly, and exencephaly, according to the location and severity of the lesion, which pose huge medical, financial, and psychological costs on affected families (14).. A more recent study confirmed that reduced PCSK9 in maternal serum is a potential biomarker for human pregnancies with open NTDs (15). PCSK9 is expressed in the brain at certain crucial stage during embryonic neurulation, which is a key time point in NTD formation (2, 16, 17). Knockdown of PCSK9 mRNA in zebrafish eggs resulted in embryonic death due to defective neurogenesis (17). Moreover, a phenome-wide association study of 29,722 human patients showed a significant relationship between R46L loss-of-function variants in PCSK9 and an increased risk of NTDs (18). Therefore, it is plausible that reduced PCSK9 may lead to an increased incidence of foetal NTDs. However, clear evidence for this hypothesis is still lacking, thus warranting further investigation of the latent connections between PCSK9i administration in pregnant women and foetal NTD development.

Maternal obesity is thought to represent an increased risk of NTD outcomes in foetuses, particularly exencephaly and spina bifida (19, 20). Similarly, female mice fed a high-fat diet (HFD) exhibited increased NTD formation in their offspring (21). However, the mechanism underlying this relationship remains unclear. Obesity is often linked to dyslipidaemia, which is significantly associated with foetal NTDs (22, 23). Thus, dyslipidaemia and PCSK9i are both associated with an increased risk of NTD outcomes and both related to lipid metabolism. Noticeably, mounting evidence indicates that PCSK9 is independently associated with serum triglyceride (TG) levels (24, 25). PCSK9i predominantly exhibits good effects on high cholesterol; however, it is highly uncertain whether PCSK9i can efficiently reduce elevated TG levels caused by the LDLR-independent effects of PCSK9 on TG-rich lipoprotein metabolism (26, 27). As such, it is unknown whether the use of PCSK9i in pregnant women with dyslipidaemia has a synergistic effect with high triglyceride (HTG) on the reproductive risk of NTDs. Because obese pregnant women with dyslipidaemia are not included in clinical trials, the potential of this adverse effect will not be determined until the medicine is available in the market.

Therefore, to unravel this doubt, we explore the synergistic effect of PCSK9i and high fat on adverse pregnancy outcomes for the first time by administering PCSK9i to an HFD-based female mouse model. Notably, HFD embryos exhibit higher incidences of stillbirths and defects, including exencephaly, spina bifida, and cleft lip palate, following PCSK9i treatment. Moreover, PCSK9i-induced succinic dehydrogenase complex subunit A (SDHA) deficiency and TG accumulation cooperatively drive the production of reactive oxygen species (ROS) and subsequent apoptosis during embryonic development, which may account for the occurrence of NTDs. Our findings highlight the potential safety challenges associated with PCSK9i treatment in pregnant women with dyslipidaemia.

Experimental animals

All animal experiments followed the National Institutes of Health guidelines for the care and use of laboratory animals. The study protocol was approved by the Committee for Animal Care of Shengjing Hospital, China Medical University (2021PS238K). Wistar rats and C57BL/6J mice were purchased from the Animal Centre of China Medical University. PCSK9 knockout mice were purchased from the Jackson Laboratory. In our previous work (28, 29) and other studies (30), a rodent model of ATRA-induced NTDs was employed for research on NTD embryopathy. Briefly, at E10.5/E8.5, pregnant rats/mice were randomised into two groups: the experimental group was treated with ATRA (140 mg/kg body weight/70 mg/kg body weight; Sigma-Aldrich, St. Louis, MO, USA) by gavage to develop NTD, whereas the control group received the same volume of olive oil.

For the HFD-based female mouse model, four-week-old female C57BL/6J mice were assigned to two diet groups: the experimental group received an HFD with 20% protein, 20% carbohydrates, and 60% fat (H10060, HFK Bio-Technology, Beijing, China), whereas the normal diet (ND) group received a general diet with 20% protein, 70% carbohydrates, and 10% fat for 12 weeks. Body weights were recorded weekly. After 12 weeks, the BMI of mice was determined using the Lee’s Index. HFD-fed mice were intraperitoneally administered 10 mg/kg/day of small-molecule inhibitor of PCSK9 (SBC-115076; APE×BIO, Boston, USA) or subcutaneously injected with 10 mg/kg/day of monoclonal antibodies targeting PCSK9 (evolocumab; Amgen Manufacturing Limited, Juncos, PR, USA) daily from E5.5 to E9.5. Thus, the developing embryos were exposed to PCSK9i during neurulation (E8–10.5). At E11.5, and E18.5, the mice were euthanised and the embryos were collected. At E11.5, and E18.5, the mice were euthanized by intraperitoneal injection of pentobarbitone sodium (60 mg/kg body weight) and the embryos were collected.

Lipidomic assay

The serum of pregnant rats with NTD foetuses or normal foetuses, as well as the neural tubes (from the inferior margin of the forelimb bud to the tail bud) of the corresponding embryos, were collected at E11.5 for lipidomics analysis. Lipid separation and lipidomics analysis were performed using a Nexera LC-30A ultra-high-performance liquid chromatography system (SHIMADZU, Japan) coupled to Q Exactive Plus (Thermo Fisher Scientific, Waltham, MA, USA), as previously described (31). Lipid identification, peak alignment, retention time correction, and peak area extraction were assessed using Lipid Search software version 4.2 (Thermo Fisher Scientific).

Cell culture, transfection, and reagent treatment

The mouse neural stem cells (C17.2) used in this study were purchased from Beina Chuanglian Biology Research Institute and cultured as previously described (29). C17.2 cells were cultured in six-well plates at a density of 1 × 10⁵ cells/well for 24 h before treatment. The PCSK9 plasmid (Addgene, Cambridge, MA, USA) was transfected into C17.2 cells according to the manufacturer’s protocols using JetPRIME (Polyplus Transfection, Illkirch, France). Cells were collected 48 h after transfection and used in subsequent experiments. C17.2 were treated with 0.3 mM of OA (Sigma-Aldrich) and 30 µM of PCSK9i (SBC-115076) for 12 h. DMSO was used as the solvent for PCSK9i, which served as the control.

Proteomics

C17.2 cells were treated with 30 µM of PCSK9i (SBC-115076) or the same volume of DMSO for proteomic analysis on tandem mass tag (TMT)-based liquid chromatography tandem mass spectrometry (LC-MS/MS). After trypsin digestion, the peptides were labelled according to the manufacturer’s protocol for the TMT kit (Thermo Fisher Scientific) and analysed by LC-MS/MS in Q Exactive™ Plus (Thermo Fisher Scientific), as previously specified. The raw MS data were analysed using Proteome Discoverer^™ Software 1.4.

Mitochondrial respiration

An Agilent cell mitochondrial stress test kit (Agilent Technologies) and Seahorse XFe96 Analyser were used to evaluate the oxygen consumption rate(OCR) (Seahorse Bioscience, Billerica, MA, USA). Cells were seeded into a Seahorse XF cell culture plate and treated with the indicated agents for 12 h. C17.2 cells were rinsed, and the media was changed with pre-warmed XF assay medium supplemented with 1 mM of pyruvate, 10 mM of glucose, and 2 mM of glutamine, then incubated for 1 h in a CO₂-free incubator at 37°C. After recording the basic measurements, OCR was calculated by sequential measurement cycles following each reagent addition in dilutions according to the manufacturer’s recommendations (2 µM oligomycin, 1 µM FCCP, 0.5 µM Rotenone/antimycin A) using a SeahorseXFe96 FluxPak. OCR was calculated using the Seahorse XFe96 program and expressed as basal, maximal, ATP generation, and non-mitochondrial respiration.

Transmission electron microscopy analysis(TEM)

The treated C17.2 cells were carefully collected, fixed in 2.5% glutaraldehyde, and post-fixed in 1% osmium tetraoxide. The cells were then dissected, and TEM images were acquired at 30,000× magnification in randomly selected fields under an 80-kV transmission electron microscope (JTM-1400Flash, JEOL, Japan).

Reactive oxygen specie(ROS) generation

ROS quantification was performed using the ROS Assay Kit (Beyotime, Shanghai, China) after seeding C17.2 cells in 12-well plates and treating them with the indicated agents for 12 h. After three washes with cell medium, cells were incubated with 2, 7-dichlorofluorescein diacetate at 37°C for 25 min. The distribution of dichlorofluorescein fluorescence was measured using a fluorescence microscope (Nikon Eclipse Ti, Kyoto, Japan) and a fluorescence microplate reader (Tecan Infinite M200Pro, Mannedorf, Switzerland).

Mitochondrial permeability transition pore and JC-1 staining

The MPTP Staining Kit was used to measure mitochondrial permeability (Beyotime), and the mitochondrial membrane potential (MMP) was detected using a JC-1 Staining Kit (Beyotime). A decrease in the green fluorescence intensity of calcein flowing out of the mitochondria indicates MPTP opening. The ratio of red fluorescence intensity to green fluorescence intensity represents the MMP. Fluorescence intensity was determined using a microplate reader (Tecan Infinite M200 Pro) or fluorescence microscope (Olympus IX73, Tokyo, Japan).

Detection of apoptosis

A terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) assay was carried out to evaluate the apoptosis rate of cells using the One-Step TUNEL Apoptosis Assay Kit (Roche, Mannheim, Germany). Nuclei were stained with DAPI to categorise the cells, and the staining was evaluated using a fluorescence microscope (Nikon ECLIPSE 80i). The activity of caspase 3 in the cells was analysed using a GreenNuc kit (Beyotime) according to the manufacturer’s instructions. Images were obtained using a fluorescence microscope (Nikon Eclipse Ti).

Quantitative reverse transcription polymerase chain reaction (qPCR)

Total RNA was extracted from the neural tube tissues of embryos and C17.2 cells using TRIzol reagent (TakaRa, Ohtsu, Japan), then reverse transcribed into cDNA using PrimeScript RT Master Mix (TaKaRa, Tokyo, Japan). qPCR was performed using the SYBR Premix Ex Taq kit (TaKaRa) on a 7500 Real-Time PCR system (StepOnePlus, ABI Company, Oyster Bay, NY, USA). The results were normalised to GAPDH levels. The primer sequences for PCSK9 and GAPDH were as follows: PCSK9-F TGGCTGCATGACATTGCTTCTC, PCSK9-R GCACTGGAGAACCACACAGG; GAPDH-F 5ʹ-TGCCGCCTGGAGAAACCTGC-3ʹ, GAPDH-R 5ʹ-AGCAATGCCAGCCCCAGCAT-3ʹ.

Immunoblotting

Neural tube tissues in embryos and C17.2 cells were lysed using RIPA lysis buffer (Beyotime) to extract the protein, and protein concentrations were measured with a BCA kit (Takara, Ohtsu, Japan). Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis then transferred to nitrocellulose membranes, as previously described²⁹. After blocking with 5% milk, the membranes were incubated overnight at 4°C with primary antibodies against PCSK9 (Abcam, 1:1000), SDHA (Proteintech, 1:1000), caspase 9 (Proteintech, 1:1000), caspase 3 (Cell Signalling Technology, 1:1000), GAPDH (Invitrogen, 1:5000), and β-actin (Proteintech, 1:5000). Horseradish peroxidase-conjugated secondary antibodies (Jackson, 1:5000) were incubated after washing the membranes. Chemiluminescent substrate (Millipore, MA, USA) was used to visualise the signals.

Statistical analysis

Graph Pad-Prism8 software was used for graphic presentation and statistical analysis. The results are expressed as the mean per group ± s.e.m. The data were analysed as reported in the figure legends and *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 were considered statistically significant. We employed a t-test approach for comparisons between two groups and one-way ANOVA test for multiple comparisons. Significant differences in NTD incidence between groups, expressed by the number of embryos, were analysed by the Chi-square test. All experiments were completely randomised and repeated in triplicate.

PCSK9 deficiency increased the risk of adverse pregnancy outcomes during embryonic development

Our previous studies showed that maternal plasma levels of PCSK9 are associated with the incidence of human NTDs (12). Moreover, we explored the expression of the PCSK9 protein and mRNA in the neural tubes during embryonic development from E11 to E20. The mRNA levels of PCSK9 in the normal foetal rats are gradually elevated with embryonic neurulation (Fig. 1A). Compared with normal controls, both the mRNA (Fig. 1A) and protein (Fig. 1, B and C) levels of PCSK9 decreased significantly in the ATRA-induced foetal NTD group on each embryonic day.

However, the definitive effects of PCSK9 deficiency on neural tube closure remains to be defined. To this end, we investigated the role of PCSK9 deficiency in NTD formation using PCSK9 knockout mice, in which, deletion of the PCSK9 gene evidently increased the incidence of all-trans retinoic acid (ATRA)-induced adverse pregnancy outcomes, especially NTDs, albeit PCSK9 knockout embryos alone did not exhibit any NTD phenotypes (Table S1). Thus, PCSK9 may play a vital role in embryonic neural development and PCSK9 deficiency may contribute to foetal NTDs.

Lipidomic profiling of maternal and foetal samples from NTD model

PCSK9 and NTDs have been known to be implicated in lipid metabolism (3, 32). However, to the best of our knowledge, the overall lipid composition associated with NTDs is lacking. Therefore, we performed mass spectrometry-based lipidomics analysis of the plasma of pregnant rats with NTD or normal foetuses, as well as the neural tubes of the corresponding embryos. According to the principal component analysis, we observed clearly distinguished clusters of NTD and control groups in the maternal plasma (Fig. S1A) and foetal neural tubes, respectively (Fig. S1B). Moreover, the orthogonal projections to latent structures discriminant analysis (OPLS-DA) plot also showed a clear separation of NTD and control groups in the maternal plasma (Fig. 2A) and foetal neural tubes (Fig. 2B). The deregulated lipid species were screened with the OPLS-DA model, using a variable importance in projection (VIP) score > 1 and a p value < 0.05 as selection criteria. The results showed that 57 lipid species in the plasma and 27 lipid species in the neural tube were significantly altered. The samples were clustered into two different phenotypic groups, NTDs and controls, in an unsupervised manner in the maternal plasma (Fig. 2C) and foetal neural tubes (Fig. 2D). Impressively, compared to the control group, the TG levels in lipid species (Fig. 2, E and F) and lipid classes (Fig. 2, G and H) were robustly upregulated in both the maternal plasma and neural tubes of the corresponding embryos from the NTD group. These results indicate a critical role of TG in the occurrence of foetal NTDs.

PCSK9i increased the incidence of adverse pregnancy outcomes in HFD mice

Now that PCSK9i and high fat are both disadvantageous factors for NTDs in offspring, we investigated their synergistic effect on foetal outcomes. To this end, we utilised an HFD-based female mouse model. Female mice were continuously fed with an HFD or normal diet (ND) for 12 weeks beginning at 4 weeks of age (Fig. S2) (we refer to the mothers as ‘HFD mice’ and ‘ND mice’ and to their embryos as ‘HFD embryos’ and ‘ND embryos’, respectively). HFD embryos appeared higher incidences of stillbirths and defects, including exencephaly, spina bifida, and cleft lip palate, after administration of a small-molecule inhibitor of PCSK9 (SBC-115076) in the first-trimester (from E5.5 to E9.5) (Table 1). Moreover, we applied evolocumab, a PCSK9i already approved for clinical use, to confirm the reliability of the results of SBC-115076. Similarly, the percentage of total abnormal embryos, including those exhibiting NTDs, stillbirth, and developmental delay, increased when HFD mice were subcutaneously injected with 10 mg/kg/day of evolocumab from E5.5 to E9.5 (Table 1). Typical images of the neural tubes of embryos are shown in Fig. S3. The above observations suggest that PCSK9i-exposed HFD mice have higher incidences of foetal NTDs.

Table 1

Effects of PCSK9 inhibitors on NTD rate of HFD embryos
	HFD	HFD	HFD
	Control	SBC-115076	evolocumab
Litters (n)	8	11	6
Embryos (n)	65	74	51
Normal embryos [n (%)]	57 (87.69)	48 (64.86)*	34 (66.67)*
NTDs [n (%)]	0 (0.00)	5 (6.76)*	4 (7.84)*
Other Defects [n (%)]^a	3 (4.62)	6 (8.11)	5 (9.80)
Stillbirth [n (%)]	5 (7.69)	17 (22.97)*	10 (19.61)*
^aOther defects include developmental delay, cleft lip palate, craniofacial malformation, and ocular malformation. p < 0.05 vs. control group using Chi*-square test.

Proteomic analysis revealed mitochondrial dysfunction following PCSK9i administration

To understand the pathway mediating the role of PCSK9i in embryonic development, proteomic analysis of PCSK9i-treated C17.2 cells were carried out. Clustering analysis of the overall protein expression heat map indicated that cells treated with or without PCSK9i were completely divided into two groups with different protein expression profiles (Fig. 3A). A total of 426 proteins were identified as differentially expressed (fold-change > 1.2; p < 0.05). Strikingly, KEGG pathway analysis and Gene Ontology (GO) analysis revealed three pathways (Fig. 3B) and four biological processes (Fig. S4A) enriched in the PCSK9i group, all of which were associated with mitochondrial function. Specifically, the proteins in the pathways of thermogenesis, oxidative phosphorylation, the tricarboxylic acid (TCA) cycle, and the biological process of succinate metabolic process all experienced downregulation, whereas all proteins in the biological processes (BP) of the cellular/response to ROS and oxidative stress were upregulated in the PCSK9i group compared to the PCSK9i group. Moreover, the cellular components (CC) of GO analysis indicated that the participation of differentially expressed proteins mainly occurred in the mitochondria (Fig. S4B). Detailed proteomic analysis revealed that impaired mitochondrial function arose from the proteins of the key structural components of electron transport chain (ETC) mitochondrial complexes (complex I–V), which were affected in the PCSK9i group but not in the control group (Fig. 3C). Furthermore, gene set enrichment analysis (GSEA) of differentially expressed proteins identified the top five enriched terms related to PCSK9i, including oxidative phosphorylation and fatty acid metabolism (Fig. 3D). In particular, oxidative phosphorylation was dramatically enriched in response to PCSK9i treatment (false discovery rate [FDR] = 0.011) (Fig. 3D). These findings imply that mitochondrial dysfunction is the predominant process following PCSK9i treatment.

PCSK9i resulted in SDHA deficiency and mitochondrial abnormalities

We further compared the three pathways related to mitochondrial function derived from KEGG analysis, which included thermogenesis, oxidative phosphorylation, and the citrate cycle. Among these pathways, the only protein in the overlap is SDHA, a key enzyme of the mitochondrial respiratory chain (Fig. 4A). Based on the above data, we consider SDHA to be a valuable target gene of PCSK9i. We then verified the modulation of PCSK9i on SDHA by western blot analysis. Suppressed expression of PCSK9, a higher level of LDLR was observed (Fig. S5A). Consistent with the results of proteomic analysis, the administration of PCSK9i decreased the expression of SDHA in C17.2 cells (Fig. 4B). In contrast, PCSK9 overexpression improved the protein levels of SDHA in vitro (Fig. 4C). In addition, downregulation of PCSK9i on SDHA was confirmed in vivo. Reduced expression of SDHA protein, as well as a higher level of LDLR, was observed in embryos with PCSK9i treatment compared to those without PCSK9i treatment (Fig. 4D and Fig. S5B). Given the potential role of PCSK9 in SDHA-mediated mitochondrial function, we examined the impact of PCSK9i on energy metabolism. PCSK9i-treated C17.2 cells exhibited a distinct reduction in the mitochondrial OCR compared to control cells under maximal coupled and uncoupled respiration (Fig. 4E). Accordingly, TEM analysis of mitochondria showed less dense, less organised, or even absent mitochondrial cristae in cells treated with PCSK9i than in the control (Fig. 4F). Collectively, these data suggest that PCSK9i disrupts the expression of SDHA both in vitro and in vivo and impairs mitochondrial function.

PCSK9i cooperatively HTG drives mitochondrial damage

At the molecular level, on the one hand, TG accumulation and fatty acid overload impair mitochondrial function (33) and on the other hand, PCSK9 deficiency reduces the expression of SDHA, a key enzyme in the mitochondrial respiratory chain. Therefore, we explored the cooperative effects of PCSK9 deficiency and HTG treatment on mitochondrial damage. Oleic acid (OA), the most prevalent free FA was used to induce TG accumulation. Following 12 h of OA treatment drives ROS production compared to the control group (Fig. 5, A and B). Intriguingly, under the joint effect of PCSK9i and OA, the increase of ROS activity was much greater than that in the OA group (Fig. 5, A and B). Furthermore, a significant reduction in mitochondrial membrane potential according to JC-1 staining (Fig. 5, C and D), as well as an obvious increase in mitochondrial permeability transition pore (MPTP) opening (Fig. 5, E and F), were observed in the PCSK9i and OA treatment group compared to the OA group. These findings support the cooperative effects of PCSK9i and HTG on mitochondrial damage.

Cooperative effects of PCSK9i and HTG on apoptosis

Although the knockdown of PCSK9 in zebrafish eggs can lead to defective neurogenesis (17), there is currently no evidence to detect the influence of PCSK9 on apoptosis in embryonic neurulation, which accounts for NTD formation. Given the effect of PCSK9i and HTG on mitochondrial damage, we assessed the induction of apoptosis by PCSK9i and HTG treatment. The OA group in the C17.2 neural stem cell line exhibited a higher percentage of apoptotic cells compared to the control group according to TUNEL (Fig. 6A) and active caspase 3 assays (Fig. 6B). Moreover, the combined effects of PCSK9i and OA evidently exacerbated cell apoptosis compared with OA treatment alone (Fig. 6, A and B). In addition, analysis of the apoptosis-related pivotal proteins cleaved caspase 9 and cleaved caspase 3 in C17.2 cells further confirmed the induction of apoptosis by PCSK9i and OA (Fig. 6C). Similarly, cleaved caspase 9 and cleaved caspase 3 were more abundant in HFD embryos with PCSK9i treatment than in those without PCSK9i treatment and ND embryos (Fig. 6D). These results suggest the important role of PCSK9 deficiency combined with HTG in triggering apoptosis during embryonic neurulation, which further infers their cooperative effects on neural tube closure through mitochondrial damage and subsequent apoptosis.

It is worth mentioning that from preclinical discovery to clinical development, PCSK9i has been authorised for clinical application for only a few years, potential adverse outcomes, and yet requires extra investigation. In addition to the most frequently reported side effects, including injection-site reactions and upper respiratory tract infections (34), accumulating evidence also indicates that PCSK9i increases the rate of adverse events such as diabetes and neurocognitive deficits. Specifically, participants receiving PCSK9i reported an absolute increase in fasting blood glucose and HbA_1c as well as an increased risk of incident diabetes (35).. Additionally, both alirocumab and evolocumab are reportedly associated with an increased risk of adverse neurocognitive events compared to a placebo (6, 11). Notably, the safety of using PCSK9i during pregnancy is yet to be clearly established, particularly as PCSK9i has been shown to cross the placental barrier (18). Our prior research as well as a recent study identified lower PCSK9 expression in the serum of pregnant women with NTD fetuses (12, 15), assuming that NTDs could be possible side effects among pregnant women exposed to PCKS9i. However, there is no evidence to manifest the safety of PCSK9i with regard to foetal NTDs.

In this work, we demonstrated that PCSK9 knockout mice noticeably increased the incidence of ATRA-induced adverse pregnancy outcomes, particularly NTDs, although PCSK9 knockout embryos alone did not exhibit any NTD phenotypes. Nevertheless, whether other risk factors interacting with PCSK9 deficiency generate rising incidence of adverse pregnancy outcomes remains unclear. Lipids known to be involved in the formation of NTDs (32)notwithstanding, lipidomic profiling of NTDs has never before been surveyed. This study utilised lipidomics to investigate the global pattern of lipid profiles in the serum of pregnant rats with NTD, as well as in the neural tubes of NTD embryos. Interestingly, we observed higher TG levels, both in lipid species and lipid classes, in the NTD group than in the control group. In further animal experiments, our data showed that PCSK9i treatment (SBC-115076 or evolocumab) raised the occurrence of stillbirths and defects, including exencephaly, spina bifida, and cleft lip palate, in HFD embryos, indicating the risk of PCSK9i and HTG interaction for adverse pregnancy outcomes, especially NTDs. Thus, a vital issue arose: might this novel medicine is safe and beneficial for all patients?

Despite the potent clinical benefits of PCSK9i, large gaps remain in our understanding of PCSK9i effects. PCSK9i causes an increase in LDLR by disrupting the binding and degradation of PCSK9 to LDLR, thereby decreasing circulating cholesterol levels, which have been widely described in the liver (4). PCSK9, however, has less well-known functions and target proteins in extrahepatic tissues, which will aid to determine the hidden adverse effects of targeting PCSK9. PCSK9 has been reported to cause a reduction in ABCA1, which facilitates the pro-atherosclerotic status of macrophages in the vasculature (36). Here, we provide evidence that PCSK9 expression in the neural tube of normal foetal rats gradually elevated with embryonic neurulation; meanwhile, decreased significantly in NTD foetuses at each embryonic day.

Furthermore, detailed profiling was performed under PCSK9-deficient conditions in neural stem cells by proteomic analysis. Impaired mitochondrial function, consisting of thermogenesis, oxidative phosphorylation, the TCA cycle, and the succinate metabolic process, paralleled by the enhanced biological processes of response to ROS and oxidative stress, are revealed to be associated with PCSK9 deficiency. As further assessed by biological functions as well as mitochondrial morphology, the current work firstly provides firm evidence for the impact of PCSK9 deficiency on mitochondrial dysfunction, with subsequent ROS production and apoptosis in the nervous system, which are pivotal causes of NTD formation. Overwhelming evidence, including our previous studies, has documented that impaired mitochondrial function, followed by ROS production and apoptosis, causes an insufficient number of neuroepithelial cells within the neural folds, which is a pivotal cause of NTD formation (29, 37, 38). Although some existing studies have shown the dual behaviour of PCSK9 in the regulation of apoptosis in neurodegenerative diseases (39), increasing evidence suggests that PCSK9 regulates apoptosis in CVD and tumourigenesis (40–44).

Among the related proteins in functional pathway analysis of the proteome following PCSK9i treatment, SDHA is of utmost concern. We further confirmed the regulation of PCSK9 on SDHA both in vitro and in vivo, which has not been previously elucidated. SDHA, the most important catalytic subunit of complex II, serves as a key enzyme involved in both oxidative phosphorylation and TCA cycle in mitochondrial respiration, and is responsible for catalysing succinate to fumarate and maintaining ROS homeostasis (45). SDHA deficiency-induced succinate accumulation drives ROS production and subsequent apoptosis (46, 47). However, no previous research has characterised the critical role of SDHA in NTD development. Herein, we discovered that PCSK9 deficiency mediates NTD induction by causing mitochondrial damage followed by ROS production and apoptosis, probably via the inhibition of SDHA.

Despite the reported connection between hypertriglyceridaemia in pregnant women and foetal NTDs (22, 23), to date, the underlying mechanisms remain undefined. Our findings from both animal models and cell experiments support the hypothesis that mitochondrial dysfunction arises from both TG accumulation and PCSK9i-induced SDHA deficiency, is responsible for ROS production and subsequent apoptosis that disrupts closure of the neural tube. Despite compelling evidence that susceptibility to NTDs is determined by genetic and environmental factors (48), the precise nature of the link is poorly understood. Our findings revealed that PCSK9 deficiency did not cause NTDs in ND-fed mice but caused a significant rising in NTD occurrence among HFD-fed embryos, demonstrating a gene-environment interaction between the loss of PCSK9 and HTG. Succinate accumulation from fatty acid overload due to HTG coupled with PCSK9i-induced SDHA deficiency, which drives ROS production and subsequent apoptosis, may provide an explanation for the synergistic effects of the environment and genes. However, further clinical investigations based on large-scale, multicentre population studies will be required to support the results from animal experiments. Additionally, continued research into the exact molecular mechanisms should address the regulatory effect of PCSK9 on SDHA.

With the rapid progress of PCSK9i agents, more attention should be directed to the safety issues associated with this novel therapeutic agent. Here, we identified an increased risk of adverse pregnancy outcomes following PCSK9i treatment harnessing an HFD-based female mouse model, which revealed a previously unknown side effect of PCSK9i. We also defined a mechanism whereby PCSK9i-induced SDHA deficiency and hypertriglyceridemia-induced TG accumulation cooperatively give rise to ROS production and subsequent apoptosis, which in turn leads to adverse pregnancy outcomes(Fig. 7). These findings highlight the potential safety challenges of PCSK9i therapy for hypercholesterolaemia and CVD in pregnant women.

Data sharing statement

The related data and materials are available for sharing upon request to Prof. Hui Gu and Prof. Zhengwei Yuan.

Acknowledgement

This work was supported by the National Key R&D Program of China (2021YFC2701003, 2021YFC2701104), the National Natural Science Foundation of China (Grant numbers: 82271730, 81771595, 82171649, 81901565, 82001643, 82101740)，Shenyang Science and Technology Planning Project (Grant numbers: 22-321-33-22) and the 345 Talent Project.

Declaration of Interests

The authors have declared that no competing interest exists

Contributors:

H.G., and Z.Y. conceived the study, designed the experiments, and wrote the manuscript. W.H., J.F., Y.L., and T.H. performed the experiments and data analyses. X.W., D.L., W.L., W.M., S.C., and S.J. designed experiments and/or oversaw the research. Y.H., and S.D. participated in data analyses. All authors reviewed the manuscript and approved the submitted version.

Benjamin EJ, Blaha MJ, Chiuve SE, Cushman M, Das SR, Deo R, de Ferranti SD, Floyd J, Fornage M, Gillespie C, Isasi CR, Jimenez MC, Jordan LC, Judd SE, Lackland D, Lichtman JH, Lisabeth L, Liu S, Longenecker CT, Mackey RH, Matsushita K, Mozaffarian D, Mussolino ME, Nasir K, Neumar RW, Palaniappan L, Pandey DK, Thiagarajan RR, Reeves MJ, Ritchey M, Rodriguez CJ, Roth GA, Rosamond WD, Sasson C, Towfighi A, Tsao CW, Turner MB, Virani SS, Voeks JH, Willey JZ, Wilkins JT, Wu JH, Alger HM, Wong SS, Muntner P, American Heart Association Statistics C, Stroke Statistics S (2017) Heart Disease and Stroke Statistics-2017 Update: A Report From the American Heart Association. Circulation 135 (10):e146-e603. https://doi.org/10.1161/CIR.0000000000000485
Seidah NG, Benjannet S, Wickham L, Marcinkiewicz J, Jasmin SB, Stifani S, Basak A, Prat A, Chretien M (2003) The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc Natl Acad Sci U S A 100 (3):928-933. https://doi.org/10.1073/pnas.0335507100
Natarajan P, Kathiresan S (2016) PCSK9 Inhibitors. Cell 165 (5):1037. https://doi.org/10.1016/j.cell.2016.05.016
Sabatine MS (2019) PCSK9 inhibitors: clinical evidence and implementation. Nat Rev Cardiol 16 (3):155-165. https://doi.org/10.1038/s41569-018-0107-8
Blom DJ, Hala T, Bolognese M, Lillestol MJ, Toth PD, Burgess L, Ceska R, Roth E, Koren MJ, Ballantyne CM, Monsalvo ML, Tsirtsonis K, Kim JB, Scott R, Wasserman SM, Stein EA, Investigators D (2014) A 52-week placebo-controlled trial of evolocumab in hyperlipidemia. N Engl J Med 370 (19):1809-1819. https://doi.org/10.1056/NEJMoa1316222
Robinson JG, Farnier M, Krempf M, Bergeron J, Luc G, Averna M, Stroes ES, Langslet G, Raal FJ, El Shahawy M, Koren MJ, Lepor NE, Lorenzato C, Pordy R, Chaudhari U, Kastelein JJ, Investigators OLT (2015) Efficacy and safety of alirocumab in reducing lipids and cardiovascular events. N Engl J Med 372 (16):1489-1499. https://doi.org/10.1056/NEJMoa1501031
Schmidt AF, Carter JL, Pearce LS, Wilkins JT, Overington JP, Hingorani AD, Casas JP (2020) PCSK9 monoclonal antibodies for the primary and secondary prevention of cardiovascular disease. Cochrane Database Syst Rev 10:CD011748. https://doi.org/10.1002/14651858.CD011748.pub3
Schmidt AF, Pearce LS, Wilkins JT, Overington JP, Hingorani AD, Casas JP (2017) PCSK9 monoclonal antibodies for the primary and secondary prevention of cardiovascular disease. Cochrane Database Syst Rev 4:CD011748. https://doi.org/10.1002/14651858.CD011748.pub2
Cardoso R, Blumenthal RS, Kopecky S, Lopez-Jimenez F, Martin SS (2019) How Low to Go With Lipid-Lowering Therapies in a Cost-effective and Prudent Manner. Mayo Clin Proc 94 (4):660-669. https://doi.org/10.1016/j.mayocp.2018.08.011
Honda S, Puri R, Anderson T, Kastelein JJP, Brennan DM, Kassahun H, Somaratne R, Wasserman SM, Nissen SE, Nicholls SJ (2022) Determinants of Plaque Progression Despite Very Low Low-Density Lipoprotein-Cholesterol Levels With the PCSK9 Inhibitor, Evolocumab. JACC Cardiovasc Imaging 15 (4):709-711. https://doi.org/10.1016/j.jcmg.2021.11.014
Sabatine MS, Giugliano RP, Wiviott SD, Raal FJ, Blom DJ, Robinson J, Ballantyne CM, Somaratne R, Legg J, Wasserman SM, Scott R, Koren MJ, Stein EA, Open-Label Study of Long-Term Evaluation against LDLCI (2015) Efficacy and safety of evolocumab in reducing lipids and cardiovascular events. N Engl J Med 372 (16):1500-1509. https://doi.org/10.1056/NEJMoa1500858
An D, Wei X, Li H, Gu H, Huang T, Zhao G, Liu B, Wang W, Chen L, Ma W, Zhang H, Cao S, Yuan Z (2015) Identification of PCSK9 as a novel serum biomarker for the prenatal diagnosis of neural tube defects using iTRAQ quantitative proteomics. Sci Rep 5:17559. https://doi.org/10.1038/srep17559
Iskandar BJ, Finnell RH (2022) Spina Bifida. N Engl J Med 387 (5):444-450. https://doi.org/10.1056/NEJMra2116032
Lee S, Gleeson JG (2020) Closing in on Mechanisms of Open Neural Tube Defects. Trends Neurosci 43 (7):519-532. https://doi.org/10.1016/j.tins.2020.04.009
Erol SA, Tanacan A, Firat Oguz E, Anuk AT, Goncu Ayhan S, Neselioglu S, Sahin D (2021) A comparison of the maternal levels of serum proprotein convertase subtilisin/kexin type 9 in pregnant women with the complication of fetal open neural tube defects. Congenit Anom (Kyoto) 61 (5):169-176. https://doi.org/10.1111/cga.12432
Rousselet E, Marcinkiewicz J, Kriz J, Zhou A, Hatten ME, Prat A, Seidah NG (2011) PCSK9 reduces the protein levels of the LDL receptor in mouse brain during development and after ischemic stroke. J Lipid Res 52 (7):1383-1391. https://doi.org/10.1194/jlr.M014118
Poirier S, Prat A, Marcinkiewicz E, Paquin J, Chitramuthu BP, Baranowski D, Cadieux B, Bennett HP, Seidah NG (2006) Implication of the proprotein convertase NARC-1/PCSK9 in the development of the nervous system. J Neurochem 98 (3):838-850. https://doi.org/10.1111/j.1471-4159.2006.03928.x
Jerome RN, Pulley JM, Roden DM, Shirey-Rice JK, Bastarache LA, G RB, L BE, Lancaster WJ, Denny JC (2018) Using Human 'Experiments of Nature' to Predict Drug Safety Issues: An Example with PCSK9 Inhibitors. Drug Saf 41 (3):303-311. https://doi.org/10.1007/s40264-017-0616-0
Shaw GM, Velie EM, Schaffer D (1996) Risk of neural tube defect-affected pregnancies among obese women. JAMA 275 (14):1093-1096. https://doi.org/10.1001/jama.1996.03530380035028
Huang HY, Chen HL, Feng LP (2017) Maternal obesity and the risk of neural tube defects in offspring: A meta-analysis. Obes Res Clin Pract 11 (2):188-197. https://doi.org/10.1016/j.orcp.2016.04.005
Wu Y, Wang F, Fu M, Wang C, Quon MJ, Yang P (2015) Cellular Stress, Excessive Apoptosis, and the Effect of Metformin in a Mouse Model of Type 2 Diabetic Embryopathy. Diabetes 64 (7):2526-2536. https://doi.org/10.2337/db14-1683
Gupta S, Arora S, Trivedi SS, Singh R (2009) Dyslipidemia in pregnancy may contribute to increased risk of neural tube defects -a pilot study in north Indian population. Indian J Clin Biochem 24 (2):150-154. https://doi.org/10.1007/s12291-009-0027-9
Gupta S, Arora S, Trivedi SS, Singh R (2007) Metabolic syndrome and risk of fetal neural tube defects. Int J Gynaecol Obstet 99 (2):144-145. https://doi.org/10.1016/j.ijgo.2007.04.032
Hamamura H, Adachi H, Enomoto M, Fukami A, Nakamura S, Nohara Y, Morikawa N, Sakaue A, Toyomasu K, Yamamoto M, Fukumoto Y (2021) Serum Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) is Independently Associated with Insulin Resistance, Triglycerides, Lipoprotein(a) Levels but not Low-Density Lipoprotein Cholesterol Levels in a General Population. J Atheroscler Thromb 28 (4):329-337. https://doi.org/10.5551/jat.56390
Furuhashi M, Omori A, Matsumoto M, Kataoka Y, Tanaka M, Moniwa N, Ohnishi H, Yoshida H, Saitoh S, Shimamoto K, Miura T (2016) Independent Link Between Levels of Proprotein Convertase Subtilisin/Kexin Type 9 and FABP4 in a General Population Without Medication. Am J Cardiol 118 (2):198-203. https://doi.org/10.1016/j.amjcard.2016.04.037
Dijk W, Le May C, Cariou B (2018) Beyond LDL: What Role for PCSK9 in Triglyceride-Rich Lipoprotein Metabolism? Trends Endocrinol Metab 29 (6):420-434. https://doi.org/10.1016/j.tem.2018.03.013
Chan DC, Watts GF, Somaratne R, Wasserman SM, Scott R, Barrett PHR (2018) Comparative Effects of PCSK9 (Proprotein Convertase Subtilisin/Kexin Type 9) Inhibition and Statins on Postprandial Triglyceride-Rich Lipoprotein Metabolism. Arterioscler Thromb Vasc Biol 38 (7):1644-1655. https://doi.org/10.1161/ATVBAHA.118.310882
Zou J, Wang F, Yang X, Wang H, Niswander L, Zhang T, Li H (2020) Association between rare variants in specific functional pathways and human neural tube defects multiple subphenotypes. Neural Dev 15 (1):8. https://doi.org/10.1186/s13064-020-00145-7
Aflaki E, Radovic B, Chandak PG, Kolb D, Eisenberg T, Ring J, Fertschai I, Uellen A, Wolinski H, Kohlwein SD, Zechner R, Levak-Frank S, Sattler W, Graier WF, Malli R, Madeo F, Kratky D (2011) Triacylglycerol accumulation activates the mitochondrial apoptosis pathway in macrophages. J Biol Chem 286 (9):7418-7428. https://doi.org/10.1074/jbc.M110.175703
Ji C, Bai J, Zhou J, Zou Y, Yu M (2022) Adverse event profiles of PCSK9 inhibitors alirocumab and evolocumab: Data mining of the FDA adverse event reporting system. Br J Clin Pharmacol. https://doi.org/10.1111/bcp.15460
Chen Q, Wu G, Li C, Qin X, Liu R, Zhang M (2020) Safety of Proprotein Convertase Subtilisin/Kexin Type 9 Monoclonal Antibodies in Regard to Diabetes Mellitus: A Systematic Review and Meta-analysis of Randomized Controlled Trials. Am J Cardiovasc Drugs 20 (4):343-353. https://doi.org/10.1007/s40256-019-00386-w
Adorni MP, Cipollari E, Favari E, Zanotti I, Zimetti F, Corsini A, Ricci C, Bernini F, Ferri N (2017) Inhibitory effect of PCSK9 on Abca1 protein expression and cholesterol efflux in macrophages. Atherosclerosis 256:1-6. https://doi.org/10.1016/j.atherosclerosis.2016.11.019
Zhong J, Xu C, Gabbay-Benziv R, Lin X, Yang P (2016) Superoxide dismutase 2 overexpression alleviates maternal diabetes-induced neural tube defects, restores mitochondrial function and suppresses cellular stress in diabetic embryopathy. Free Radic Biol Med 96:234-244. https://doi.org/10.1016/j.freeradbiomed.2016.04.030
Huang W, Huang T, Liu Y, Fu J, Wei X, Liu D, Ma W, Gu H, Yuan Z (2021) Nuclear factor I-C disrupts cellular homeostasis between autophagy and apoptosis via miR-200b-Ambra1 in neural tube defects. Cell Death Dis 13 (1):17. https://doi.org/10.1038/s41419-021-04473-2
Zhang L, Dong Y, Wang W, Zhao T, Huang T, Khan A, Wang L, Liu Z, Xie J, Niu B (2020) Ethionine Suppresses Mitochondria Autophagy and Induces Apoptosis via Activation of Reactive Oxygen Species in Neural Tube Defects. Front Neurol 11:242. https://doi.org/10.3389/fneur.2020.00242
Wu Q, Tang ZH, Peng J, Liao L, Pan LH, Wu CY, Jiang ZS, Wang GX, Liu LS (2014) The dual behavior of PCSK9 in the regulation of apoptosis is crucial in Alzheimer's disease progression (Review). Biomed Rep 2 (2):167-171. https://doi.org/10.3892/br.2013.213
Piao MX, Bai JW, Zhang PF, Zhang YZ (2015) PCSK9 regulates apoptosis in human neuroglioma u251 cells via mitochondrial signaling pathways. Int J Clin Exp Pathol 8 (3):2787-2794
Xu X, Cui Y, Cao L, Zhang Y, Yin Y, Hu X (2017) PCSK9 regulates apoptosis in human lung adenocarcinoma A549 cells via endoplasmic reticulum stress and mitochondrial signaling pathways. Exp Ther Med 13 (5):1993-1999. https://doi.org/10.3892/etm.2017.4218
Bai J, Na H, Hua X, Wei Y, Ye T, Zhang Y, Jian G, Zeng W, Yan L, Tang Q (2017) A retrospective study of NENs and miR-224 promotes apoptosis of BON-1 cells by targeting PCSK9 inhibition. Oncotarget 8 (4):6929-6939. https://doi.org/10.18632/oncotarget.14322
Zaid A, Roubtsova A, Essalmani R, Marcinkiewicz J, Chamberland A, Hamelin J, Tremblay M, Jacques H, Jin W, Davignon J, Seidah NG, Prat A (2008) Proprotein convertase subtilisin/kexin type 9 (PCSK9): hepatocyte-specific low-density lipoprotein receptor degradation and critical role in mouse liver regeneration. Hepatology 48 (2):646-654. https://doi.org/10.1002/hep.22354
Da Dalt L, Castiglioni L, Baragetti A, Audano M, Svecla M, Bonacina F, Pedretti S, Uboldi P, Benzoni P, Giannetti F, Barbuti A, Pellegatta F, Indino S, Donetti E, Sironi L, Mitro N, Catapano AL, Norata GD (2021) PCSK9 deficiency rewires heart metabolism and drives heart failure with preserved ejection fraction. Eur Heart J 42 (32):3078-3090. https://doi.org/10.1093/eurheartj/ehab431
Tretter L, Patocs A, Chinopoulos C (2016) Succinate, an intermediate in metabolism, signal transduction, ROS, hypoxia, and tumorigenesis. Biochim Biophys Acta 1857 (8):1086-1101. https://doi.org/10.1016/j.bbabio.2016.03.012
Zhang Y, Zhang M, Zhu W, Yu J, Wang Q, Zhang J, Cui Y, Pan X, Gao X, Sun H (2020) Succinate accumulation induces mitochondrial reactive oxygen species generation and promotes status epilepticus in the kainic acid rat model. Redox Biol 28:101365. https://doi.org/10.1016/j.redox.2019.101365
Sun Y, Xu Z, Jiang J, Xu T, Xu J, Liu P (2020) High Expression of Succinate Dehydrogenase Subunit A Which Is Regulated by Histone Acetylation, Acts as a Good Prognostic Factor of Multiple Myeloma Patients. Front Oncol 10:563666. https://doi.org/10.3389/fonc.2020.563666
Han L, Ren C, Li L, Li X, Ge J, Wang H, Miao YL, Guo X, Moley KH, Shu W, Wang Q (2018) Embryonic defects induced by maternal obesity in mice derive from Stella insufficiency in oocytes. Nat Genet 50 (3):432-442. https://doi.org/10.1038/s41588-018-0055-6
Liu YS, Gu H, Huang TC, Wei XW, Ma W, Liu D, He YW, Luo WT, Huang JT, Zhao D, Jia SS, Wang F, Zhang T, Bai YZ, Wang WL, Yuan ZW (2020) miR-322 treatment rescues cell apoptosis and neural tube defect formation through silencing NADPH oxidase 4. CNS Neurosci Ther 26 (9):902-912. https://doi.org/10.1111/cns.13383
Danzer E, Schwarz U, Wehrli S, Radu A, Adzick NS, Flake AW (2005) Retinoic acid induced myelomeningocele in fetal rats: characterization by histopathological analysis and magnetic resonance imaging. Exp Neurol 194 (2):467-475. https://doi.org/10.1016/j.expneurol.2005.03.011
Luan CX, Xie WD, Liu D, Li W, Yuan ZW (2022) Candidate Circulating Biomarkers of Spontaneous Miscarriage After IVF-ET Identified via Coupling Machine Learning and Serum Lipidomics Profiling. Reprod Sci 29 (3):750-760. https://doi.org/10.1007/s43032-021-00830-w

No competing interests reported.

SI.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

PCSK9 inhibitor cooperatively with high triglyceride induces adverse pregnancy outcomes by impairing mitochondrial function

Status:

Version 1

Abstract

Figures

Introduction

Methods

Experimental animals

Lipidomic assay

Cell culture, transfection, and reagent treatment

Proteomics

Mitochondrial respiration

Transmission electron microscopy analysis(TEM)

Reactive oxygen specie(ROS) generation

Mitochondrial permeability transition pore and JC-1 staining

Detection of apoptosis

Quantitative reverse transcription polymerase chain reaction (qPCR)

Immunoblotting

Statistical analysis

Results

PCSK9 deficiency increased the risk of adverse pregnancy outcomes during embryonic development

Lipidomic profiling of maternal and foetal samples from NTD model

PCSK9i increased the incidence of adverse pregnancy outcomes in HFD mice

Proteomic analysis revealed mitochondrial dysfunction following PCSK9i administration

PCSK9i resulted in SDHA deficiency and mitochondrial abnormalities

PCSK9i cooperatively HTG drives mitochondrial damage

Cooperative effects of PCSK9i and HTG on apoptosis

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1